Starting /dee2/code/volunteer_pipeline.sh SRR7169552 current disk space = 3057392619520 free memory = 1160845284 SRR7169552 SRAfilesize 786dc81c2173c0caecdb7f8b8909013c SRR7169552.sra SRR7169552.sra file validated SRR7169552 is paired end SRR7169552 is conventional basespace SRR7169552 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169552_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.97175 34.0 33.0 34.0 33.0 34.0 2 33.35525 34.0 33.0 34.0 33.0 34.0 3 33.50025 34.0 34.0 34.0 33.0 34.0 4 33.4875 34.0 34.0 34.0 33.0 34.0 5 33.521 34.0 34.0 34.0 33.0 34.0 6 37.2625 38.0 38.0 38.0 36.0 38.0 7 37.43125 38.0 38.0 38.0 37.0 38.0 8 37.48725 38.0 38.0 38.0 37.0 38.0 9 37.5385 38.0 38.0 38.0 38.0 38.0 10-14 37.53405 38.0 38.0 38.0 38.0 38.0 15-19 37.507 38.0 38.0 38.0 37.8 38.0 20-24 37.545550000000006 38.0 38.0 38.0 38.0 38.0 25-29 37.5259 38.0 38.0 38.0 38.0 38.0 30-34 37.512350000000005 38.0 38.0 38.0 38.0 38.0 35-39 37.42875 38.0 38.0 38.0 37.4 38.0 40-44 37.33624999999999 38.0 38.0 38.0 37.0 38.0 45-49 37.29155 38.0 38.0 38.0 37.0 38.0 50-54 37.2615 38.0 38.0 38.0 37.0 38.0 55-59 37.26715 38.0 38.0 38.0 37.0 38.0 60-64 37.2315 38.0 38.0 38.0 37.0 38.0 65-69 37.181799999999996 38.0 38.0 38.0 36.4 38.0 70-74 37.12955 38.0 38.0 38.0 36.2 38.0 75-79 37.057900000000004 38.0 38.0 38.0 36.0 38.0 80-84 37.04025 38.0 38.0 38.0 36.0 38.0 85-89 36.95739999999999 38.0 38.0 38.0 36.0 38.0 90-94 36.91665 38.0 38.0 38.0 35.4 38.0 95-99 36.81395 38.0 38.0 38.0 35.4 38.0 100-104 36.709900000000005 38.0 38.0 38.0 35.0 38.0 105-109 36.5721 38.0 38.0 38.0 34.6 38.0 110-114 36.47645 38.0 38.0 38.0 34.0 38.0 115-119 36.26225 38.0 38.0 38.0 34.0 38.0 120-124 36.107800000000005 38.0 37.6 38.0 33.6 38.0 125-129 36.0338 38.0 37.4 38.0 33.2 38.0 130-134 35.7805 38.0 36.8 38.0 32.4 38.0 135-139 35.58085 38.0 36.0 38.0 31.8 38.0 140-144 35.28305 38.0 36.0 38.0 30.6 38.0 145-149 34.84535 38.0 36.0 38.0 29.8 38.0 150-151 32.222875 37.0 33.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 1.0 14 2.0 15 2.0 16 1.0 17 1.0 18 4.0 19 2.0 20 6.0 21 1.0 22 5.0 23 5.0 24 6.0 25 10.0 26 16.0 27 14.0 28 23.0 29 24.0 30 44.0 31 35.0 32 56.0 33 61.0 34 116.0 35 194.0 36 480.0 37 2888.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.79695431472081 13.096446700507613 8.47715736040609 33.629441624365484 2 23.325000000000003 15.55 31.45 29.675 3 18.925 21.224999999999998 27.125 32.725 4 22.45 29.049999999999997 24.375 24.125 5 21.375 32.15 23.674999999999997 22.8 6 18.2 36.125 25.5 20.175 7 14.924999999999999 27.625 40.5 16.950000000000003 8 17.849999999999998 25.674999999999997 29.75 26.724999999999998 9 16.1 25.374999999999996 34.225 24.3 10-14 19.825 30.070000000000004 26.705000000000002 23.400000000000002 15-19 19.46 28.675 27.785 24.08 20-24 20.145 28.83 27.765 23.26 25-29 19.755 29.085 27.05 24.11 30-34 20.205000000000002 28.465 27.12 24.21 35-39 19.925 28.849999999999998 27.229999999999997 23.995 40-44 19.655 28.99 27.41 23.945 45-49 19.915 28.285 27.565 24.235 50-54 19.785 28.189999999999998 27.950000000000003 24.075 55-59 20.380000000000003 28.425 27.155 24.04 60-64 19.855 28.335 27.625 24.185000000000002 65-69 20.52 28.310000000000002 27.715 23.455000000000002 70-74 19.97 27.93 28.044999999999998 24.055 75-79 20.53 28.375 27.250000000000004 23.845 80-84 19.99 28.365000000000002 27.605 24.04 85-89 20.365 28.444999999999997 27.345000000000002 23.845 90-94 20.474999999999998 29.005 27.065 23.455000000000002 95-99 20.085 28.205000000000002 27.815 23.895 100-104 19.905 28.955 27.175 23.965 105-109 20.69 28.384999999999998 27.029999999999998 23.895 110-114 20.51 27.944999999999997 27.235 24.310000000000002 115-119 20.8 27.534999999999997 27.634999999999998 24.03 120-124 20.885 28.725 26.365 24.025 125-129 20.82 28.315 27.310000000000002 23.555 130-134 20.805 28.225 27.175 23.794999999999998 135-139 21.04 28.435 26.755000000000003 23.77 140-144 20.78 27.925 26.735 24.560000000000002 145-149 20.7 28.854999999999997 26.284999999999997 24.16 150-151 21.3 27.8375 26.187500000000004 24.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 0.5 22 1.5 23 3.0 24 3.0 25 3.0 26 6.5 27 9.0 28 9.0 29 18.0 30 22.0 31 22.5 32 32.5 33 44.5 34 60.0 35 66.0 36 74.5 37 99.5 38 131.0 39 155.5 40 178.0 41 207.5 42 228.0 43 251.5 44 273.0 45 270.5 46 269.0 47 269.0 48 231.5 49 201.5 50 178.5 51 146.0 52 126.0 53 108.5 54 79.5 55 43.5 56 38.0 57 36.5 58 24.5 59 21.5 60 15.5 61 6.5 62 4.5 63 5.0 64 5.0 65 3.5 66 2.5 67 2.5 68 3.5 69 3.5 70 1.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32041278630757 98.65 2 0.6795872136924239 1.35 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.07500000000000001 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.6625000000000001 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.8625 0.0 0.0 0.0 0.0 106-107 1.075 0.0 0.0 0.0 0.0 108-109 1.3 0.0 0.0 0.0 0.0 110-111 1.4125 0.0 0.0 0.0 0.0 112-113 1.6 0.0 0.0 0.0 0.0 114-115 1.8 0.0 0.0 0.0 0.0 116-117 2.1375 0.0 0.0 0.0 0.0 118-119 2.4125 0.0 0.0 0.0 0.0 120-121 2.5999999999999996 0.0 0.0 0.0 0.0 122-123 2.8125 0.0 0.0 0.0 0.0 124-125 3.0625 0.0 0.0 0.0 0.0 126-127 3.3375 0.0 0.0 0.0 0.0 128-129 3.675 0.0 0.0 0.0 0.0 130-131 4.1 0.0 0.0 0.0 0.0 132-133 4.3875 0.0 0.0 0.0 0.0 134-135 4.8375 0.0 0.0 0.0 0.0 136-137 5.325 0.0 0.0 0.0 0.0 138-139 5.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTCTTG 10 0.006832588 144.9875 3 CCTTCTT 20 0.0059376103 28.9975 15-19 >>END_MODULE SRR7169552 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169552_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.90325 33.0 33.0 34.0 32.0 34.0 2 32.97975 34.0 33.0 34.0 32.0 34.0 3 32.991 34.0 33.0 34.0 32.0 34.0 4 32.97875 34.0 33.0 34.0 33.0 34.0 5 32.975 34.0 33.0 34.0 33.0 34.0 6 37.1225 38.0 38.0 38.0 37.0 38.0 7 37.10075 38.0 38.0 38.0 37.0 38.0 8 37.12275 38.0 38.0 38.0 37.0 38.0 9 37.10625 38.0 38.0 38.0 37.0 38.0 10-14 37.0805 38.0 38.0 38.0 37.0 38.0 15-19 37.01985 38.0 38.0 38.0 37.0 38.0 20-24 36.93599999999999 38.0 38.0 38.0 36.4 38.0 25-29 36.88935 38.0 38.0 38.0 36.4 38.0 30-34 36.859449999999995 38.0 38.0 38.0 36.2 38.0 35-39 36.86275 38.0 38.0 38.0 36.0 38.0 40-44 36.89125 38.0 38.0 38.0 36.2 38.0 45-49 36.90065 38.0 38.0 38.0 36.0 38.0 50-54 36.8525 38.0 38.0 38.0 36.0 38.0 55-59 36.8293 38.0 38.0 38.0 36.0 38.0 60-64 36.7594 38.0 38.0 38.0 36.0 38.0 65-69 36.7605 38.0 38.0 38.0 36.0 38.0 70-74 36.63015 38.0 38.0 38.0 35.4 38.0 75-79 36.607600000000005 38.0 38.0 38.0 35.2 38.0 80-84 36.5044 38.0 38.0 38.0 35.0 38.0 85-89 36.422349999999994 38.0 38.0 38.0 34.4 38.0 90-94 36.413599999999995 38.0 38.0 38.0 34.6 38.0 95-99 36.31945 38.0 38.0 38.0 34.0 38.0 100-104 36.234399999999994 38.0 38.0 38.0 34.0 38.0 105-109 36.1453 38.0 38.0 38.0 34.0 38.0 110-114 35.959849999999996 38.0 38.0 38.0 33.4 38.0 115-119 35.74355 38.0 37.6 38.0 32.4 38.0 120-124 35.5706 38.0 37.0 38.0 31.4 38.0 125-129 35.27525000000001 38.0 36.8 38.0 30.2 38.0 130-134 35.15024999999999 38.0 36.2 38.0 29.8 38.0 135-139 34.69885 38.0 36.0 38.0 27.6 38.0 140-144 34.42775 38.0 35.6 38.0 25.8 38.0 145-149 33.87305 38.0 34.8 38.0 22.8 38.0 150-151 30.575625000000002 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 2.0 4 1.0 5 2.0 6 3.0 7 0.0 8 0.0 9 2.0 10 3.0 11 0.0 12 2.0 13 1.0 14 3.0 15 3.0 16 2.0 17 7.0 18 6.0 19 10.0 20 6.0 21 11.0 22 13.0 23 17.0 24 9.0 25 22.0 26 16.0 27 17.0 28 32.0 29 29.0 30 42.0 31 41.0 32 67.0 33 86.0 34 107.0 35 188.0 36 479.0 37 2755.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.99323816679189 24.417731029301276 12.246431254695718 24.34259954921112 2 29.42649636864513 25.845229151014276 28.424743300776356 16.30353117956424 3 21.15818500877413 28.653797944346955 30.358485836049137 19.82953121082978 4 23.552994237033325 34.803307441743925 22.650964670508642 18.992733650714104 5 24.07314629258517 37.04909819639279 21.46793587174349 17.409819639278556 6 20.732013035848585 35.7984457257458 24.79318124843319 18.676359989972426 7 21.43394334419654 21.659563800451238 37.001754825770874 19.90473802958135 8 22.73752820255703 25.996490348458263 27.02431687139634 24.241664577588367 9 22.325231771485843 24.931094963668254 29.19067902781258 23.552994237033325 10-14 24.0413053285879 28.457566795328088 26.191789062108377 21.309338813975636 15-19 23.703072527692846 27.91840008019648 26.976091423988773 21.4024359681219 20-24 23.581026875250704 27.752707581227437 27.68251103088648 20.98375451263538 25-29 23.88448811791838 27.950466258899027 27.79003308934122 20.37501253384137 30-34 23.435386080072153 28.14551285263316 27.75968331913614 20.65941774815854 35-39 23.854636591478698 27.137844611528823 28.140350877192983 20.8671679197995 40-44 23.328655908589756 28.07457151448331 27.783902976846747 20.812869600080184 45-49 23.903783512904035 28.358807316462038 27.261338010523676 20.476071160110248 50-54 23.46043994588365 28.36598687177431 27.15337976649797 21.020193415844066 55-59 24.36616895480509 28.149113137588937 27.126966629922837 20.357751277683136 60-64 24.129290904535207 27.61212728639439 27.54196943122025 20.71661237785016 65-69 24.078993534158688 28.048719362437975 27.537466793644427 20.334820309758907 70-74 23.877080409063563 28.233406857830357 27.757168638459994 20.13234409464608 75-79 24.12531328320802 27.45363408521303 27.939849624060148 20.481203007518797 80-84 23.725500025063916 27.861045666449446 27.570304275903556 20.84315003258309 85-89 23.60373007119222 27.343828336508576 28.186102476687054 20.866339115612153 90-94 23.219208982906412 28.046518622487344 27.856032883853825 20.87823951075242 95-99 24.1807796372382 27.482713698767412 27.57791361859906 20.75859304539533 100-104 24.04429079613207 27.496367553484642 27.621624329876248 20.83771732050704 105-109 24.06711745554721 27.50313047833709 27.848735286751815 20.581016779363885 110-114 24.264595339513907 27.762465547481835 27.231270358306187 20.74166875469807 115-119 24.680467144504036 27.70788431657561 27.30690190967871 20.30474662924164 120-124 24.492455762193593 27.795879492706398 27.394856885056896 20.31680786004311 125-129 24.72422783794625 27.562174087444845 27.5220617729643 20.191536301644604 130-134 24.603890894504612 27.461893301243485 27.251303650220613 20.68291215403129 135-139 24.51118018650356 28.161034793943646 27.04802968013637 20.279755339416425 140-144 24.78825239312384 27.950684107652986 27.038540570340295 20.222522928882874 145-149 24.911049862189927 28.48408920070158 26.670007516913053 19.934853420195438 150-151 25.822594770424125 27.73676967346428 26.84849243087702 19.59214312523458 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 7.0 1 3.5 2 0.0 3 0.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.0 21 0.5 22 0.5 23 1.5 24 1.5 25 0.5 26 1.0 27 3.0 28 5.0 29 6.0 30 8.0 31 8.0 32 12.5 33 28.5 34 37.0 35 39.5 36 67.5 37 96.0 38 126.5 39 161.5 40 190.5 41 232.5 42 258.0 43 286.0 44 288.0 45 288.5 46 297.0 47 277.0 48 252.0 49 213.0 50 174.0 51 133.5 52 109.5 53 97.0 54 70.0 55 51.0 56 43.0 57 29.5 58 24.0 59 21.0 60 16.0 61 9.5 62 3.0 63 2.5 64 3.0 65 5.0 66 4.5 67 2.0 68 1.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.17500000000000002 3 0.27499999999999997 4 0.22499999999999998 5 0.2 6 0.27499999999999997 7 0.27499999999999997 8 0.27499999999999997 9 0.22499999999999998 10-14 0.255 15-19 0.245 20-24 0.27999999999999997 25-29 0.27 30-34 0.215 35-39 0.25 40-44 0.22999999999999998 45-49 0.22499999999999998 50-54 0.215 55-59 0.21 60-64 0.22499999999999998 65-69 0.245 70-74 0.26 75-79 0.25 80-84 0.255 85-89 0.27 90-94 0.255 95-99 0.21 100-104 0.20500000000000002 105-109 0.17500000000000002 110-114 0.22499999999999998 115-119 0.245 120-124 0.255 125-129 0.27999999999999997 130-134 0.27999999999999997 135-139 0.27 140-144 0.23500000000000001 145-149 0.22499999999999998 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62302085951245 99.1 2 0.3267152550892184 0.65 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025131942699170642 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.5874999999999999 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.675 0.0 0.0 0.0 0.0 104-105 0.8375 0.0 0.0 0.0 0.0 106-107 1.075 0.0 0.0 0.0 0.0 108-109 1.3 0.0 0.0 0.0 0.0 110-111 1.4125 0.0 0.0 0.0 0.0 112-113 1.6 0.0 0.0 0.0 0.0 114-115 1.775 0.0 0.0 0.0 0.0 116-117 2.1125 0.0 0.0 0.0 0.0 118-119 2.3875 0.0 0.0 0.0 0.0 120-121 2.5999999999999996 0.0 0.0 0.0 0.0 122-123 2.825 0.0 0.0 0.0 0.0 124-125 3.0999999999999996 0.0 0.0 0.0 0.0 126-127 3.3875 0.0 0.0 0.0 0.0 128-129 3.7249999999999996 0.0 0.0 0.0 0.0 130-131 4.1875 0.0 0.0 0.0 0.0 132-133 4.4625 0.0 0.0 0.0 0.0 134-135 4.9125 0.0 0.0 0.0 0.0 136-137 5.4 0.0 0.0 0.0 0.0 138-139 5.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 948139 spots for SRR7169552.sra Written 948139 spots for SRR7169552.sra Read 948139 spots for SRR7169552.sra Written 948139 spots for SRR7169552.sra Read 948139 spots for SRR7169552.sra Written 948139 spots for SRR7169552.sra Read 948139 spots for SRR7169552.sra Written 948139 spots for SRR7169552.sra Read 948139 spots for SRR7169552.sra Written 948139 spots for SRR7169552.sra Read 948139 spots for SRR7169552.sra Written 948139 spots for SRR7169552.sra Read 948139 spots for SRR7169552.sra Written 948139 spots for SRR7169552.sra Read 948139 spots for SRR7169552.sra Written 948139 spots for SRR7169552.sra Read 948139 spots for SRR7169552.sra Written 948139 spots for SRR7169552.sra Read 948139 spots for SRR7169552.sra Written 948139 spots for SRR7169552.sra Read 948139 spots for SRR7169552.sra Written 948139 spots for SRR7169552.sra Read 948139 spots for SRR7169552.sra Written 948139 spots for SRR7169552.sra Read 948139 spots for SRR7169552.sra Written 948139 spots for SRR7169552.sra Read 948139 spots for SRR7169552.sra Written 948139 spots for SRR7169552.sra Read 948139 spots for SRR7169552.sra Written 948139 spots for SRR7169552.sra Read 948139 spots for SRR7169552.sra Written 948139 spots for SRR7169552.sra Read 948152 spots for SRR7169552.sra Written 948152 spots for SRR7169552.sra Read 948139 spots for SRR7169552.sra Written 948139 spots for SRR7169552.sra Read 948139 spots for SRR7169552.sra Written 948139 spots for SRR7169552.sra Read 948139 spots for SRR7169552.sra Written 948139 spots for SRR7169552.sra SRR ids: ['SRR7169552.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_a8d6vq9r SRR7169552.sra spots: 18962793 blocks: [[1, 948139], [948140, 1896278], [1896279, 2844417], [2844418, 3792556], [3792557, 4740695], [4740696, 5688834], [5688835, 6636973], [6636974, 7585112], [7585113, 8533251], [8533252, 9481390], [9481391, 10429529], [10429530, 11377668], [11377669, 12325807], [12325808, 13273946], [13273947, 14222085], [14222086, 15170224], [15170225, 16118363], [16118364, 17066502], [17066503, 18014641], [18014642, 18962793]] SRR7169552 file size 6404167 SRR7169552 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169552 SRR7169552_1.fastq SRR7169552_2.fastq Input file: SRR7169552_1.fastq Paired file: SRR7169552_2.fastq trimmed: SRR7169552-trimmed-pair1.fastq, SRR7169552-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 23:57:33 2025 >> started Mon Feb 10 23:57:53 2025 >> done (20.930s) 18962793 read pairs processed; of these: 23107 ( 0.12%) short read pairs filtered out after trimming by size control 64986 ( 0.34%) empty read pairs filtered out after trimming by size control 18874700 (99.54%) read pairs available; of these: 7814401 (41.40%) trimmed read pairs available after processing 11060299 (58.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 6 0.00% 21 5 0.00% 22 11 0.00% 23 5 0.00% 24 8 0.00% 25 9 0.00% 26 3 0.00% 27 11 0.00% 28 13 0.00% 29 12 0.00% 30 5 0.00% 31 12 0.00% 32 18 0.00% 33 11 0.00% 34 20 0.00% 35 20 0.00% 36 14 0.00% 37 22 0.00% 38 16 0.00% 39 15 0.00% 40 29 0.00% 41 28 0.00% 42 33 0.00% 43 21 0.00% 44 20 0.00% 45 34 0.00% 46 50 0.00% 47 43 0.00% 48 48 0.00% 49 60 0.00% 50 68 0.00% 51 79 0.00% 52 74 0.00% 53 89 0.00% 54 127 0.00% 55 123 0.00% 56 125 0.00% 57 149 0.00% 58 136 0.00% 59 169 0.00% 60 222 0.00% 61 230 0.00% 62 269 0.00% 63 268 0.00% 64 333 0.00% 65 355 0.00% 66 437 0.00% 67 485 0.00% 68 653 0.00% 69 915 0.00% 70 1120 0.01% 71 927 0.00% 72 957 0.01% 73 1007 0.01% 74 1140 0.01% 75 1226 0.01% 76 1357 0.01% 77 1489 0.01% 78 1635 0.01% 79 1773 0.01% 80 2141 0.01% 81 2536 0.01% 82 2930 0.02% 83 3334 0.02% 84 4425 0.02% 85 5389 0.03% 86 5613 0.03% 87 5965 0.03% 88 6318 0.03% 89 6728 0.04% 90 7189 0.04% 91 7844 0.04% 92 8277 0.04% 93 9190 0.05% 94 9856 0.05% 95 10451 0.06% 96 10978 0.06% 97 11310 0.06% 98 11842 0.06% 99 12569 0.07% 100 13341 0.07% 101 14342 0.08% 102 15263 0.08% 103 16391 0.09% 104 17395 0.09% 105 18544 0.10% 106 19543 0.10% 107 19775 0.10% 108 20117 0.11% 109 21121 0.11% 110 21912 0.12% 111 23154 0.12% 112 24778 0.13% 113 26388 0.14% 114 27717 0.15% 115 28906 0.15% 116 29962 0.16% 117 31320 0.17% 118 32190 0.17% 119 32452 0.17% 120 33989 0.18% 121 35186 0.19% 122 37211 0.20% 123 39593 0.21% 124 41410 0.22% 125 43411 0.23% 126 45716 0.24% 127 47165 0.25% 128 48604 0.26% 129 50311 0.27% 130 51752 0.27% 131 54184 0.29% 132 57274 0.30% 133 61056 0.32% 134 64065 0.34% 135 68325 0.36% 136 72370 0.38% 137 75969 0.40% 138 79688 0.42% 139 84963 0.45% 140 89448 0.47% 141 96738 0.51% 142 106038 0.56% 143 117552 0.62% 144 132898 0.70% 145 156511 0.83% 146 188449 1.00% 147 247675 1.31% 148 366334 1.94% 149 717257 3.80% 150 3885220 20.58% 151 11060299 58.60% 18874700 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=40 prefix-density=0.21 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=41 fanout-score=105.08 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=16.2 sequence=TTCTTCAAGAATTTTAAGCAGTGTGCGTCGCTCCAATCATGGCATATCCACTTCATGAAAACGGCATCTGCTTTGGGCACGCTAACAAACATGTCCCCACCAACATGCTCCACACCGGGATAAGATGGGGCATCCTCAATGACGTGGGGCAGATCAAAGTTAATGCCCTTAATTGAAGGGTATTTAGAGACGATGGTGTTAACGACAGCTCCAGTCCCACCACCAACA criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=44 prefix-density=0.20 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=29 fanout-score=210.08 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=23.9 sequence=GAAGAAGAAGAAA SRR7169552 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 23:58:40 Started mapping on | Feb 10 23:58:40 Finished on | Feb 11 00:00:45 Mapping speed, Million of reads per hour | 543.59 Number of input reads | 18874700 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 17759082 Uniquely mapped reads % | 94.09% Average mapped length | 294.64 Number of splices: Total | 16437609 Number of splices: Annotated (sjdb) | 16156565 Number of splices: GT/AG | 16194335 Number of splices: GC/AG | 191735 Number of splices: AT/AC | 14317 Number of splices: Non-canonical | 37222 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 362215 % of reads mapped to multiple loci | 1.92% Number of reads mapped to too many loci | 20488 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.85% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 774610 774610 774610 N_multimapping 362215 362215 362215 N_noFeature 390627 17535645 491442 N_ambiguous 197271 1064 73965 UnstrandedReadsAssigned:17171184 PositiveStrandReadsAssigned:222373 NegativeStrandReadsAssigned:17193675 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169552 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169552-trimmed-pair1.fastq SRR7169552-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,874,700 reads, 17,074,179 reads pseudoaligned [quant] estimated average fragment length: 243.404 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,177 rounds 52401 SRR7169552.ke.tsv 34699 SRR7169552.se.tsv 87100 total ==> SRR7169552.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1775.6 304 9.057 Potri.005G024800.1.v4.1 1035 792.596 50 3.33713 Potri.004G059700.1.v4.1 961 718.612 4 0.294456 Potri.007G009000.2.v4.1 1416 1173.6 0 0 Potri.003G141000.2.v4.1 2943 2700.6 311.034 6.0926 Potri.016G087400.1.v4.1 270 77.9761 1543 1046.79 Potri.015G069301.1.v4.1 564 326.052 0 0 Potri.010G195200.1.v4.1 1773 1530.6 36 1.24422 Potri.012G127500.1.v4.1 977 734.596 8748 629.963 ==> SRR7169552.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1618 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 351 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 17 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169552 completed mapping pipeline successfully