Starting /dee2/code/volunteer_pipeline.sh SRR7169553 current disk space = 3057484718080 free memory = 1409894164 SRR7169553 SRAfilesize c72fabb8f10592eb0020ab05433f4290 SRR7169553.sra SRR7169553.sra file validated SRR7169553 is paired end SRR7169553 is conventional basespace SRR7169553 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169553_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9765 34.0 33.0 34.0 33.0 34.0 2 33.383 34.0 34.0 34.0 33.0 34.0 3 33.43775 34.0 34.0 34.0 33.0 34.0 4 33.44725 34.0 34.0 34.0 33.0 34.0 5 33.46125 34.0 34.0 34.0 33.0 34.0 6 37.1505 38.0 37.0 38.0 36.0 38.0 7 37.365 38.0 38.0 38.0 37.0 38.0 8 37.44175 38.0 38.0 38.0 37.0 38.0 9 37.48775 38.0 38.0 38.0 38.0 38.0 10-14 37.48245 38.0 38.0 38.0 37.2 38.0 15-19 37.4657 38.0 38.0 38.0 37.4 38.0 20-24 37.49400000000001 38.0 38.0 38.0 38.0 38.0 25-29 37.4422 38.0 38.0 38.0 37.4 38.0 30-34 37.4307 38.0 38.0 38.0 37.4 38.0 35-39 37.39635 38.0 38.0 38.0 37.2 38.0 40-44 37.3014 38.0 38.0 38.0 37.0 38.0 45-49 37.2723 38.0 38.0 38.0 37.0 38.0 50-54 37.199200000000005 38.0 38.0 38.0 36.4 38.0 55-59 37.175050000000006 38.0 38.0 38.0 36.6 38.0 60-64 37.138 38.0 38.0 38.0 36.4 38.0 65-69 37.06635 38.0 38.0 38.0 36.0 38.0 70-74 36.98735 38.0 38.0 38.0 36.0 38.0 75-79 36.9759 38.0 38.0 38.0 36.0 38.0 80-84 36.812149999999995 38.0 38.0 38.0 35.4 38.0 85-89 36.93704999999999 38.0 38.0 38.0 36.0 38.0 90-94 36.78035 38.0 38.0 38.0 35.2 38.0 95-99 36.67445 38.0 38.0 38.0 35.0 38.0 100-104 36.44145 38.0 38.0 38.0 34.0 38.0 105-109 36.3969 38.0 38.0 38.0 34.0 38.0 110-114 36.2966 38.0 38.0 38.0 34.0 38.0 115-119 36.064 38.0 37.6 38.0 33.4 38.0 120-124 35.909800000000004 38.0 37.2 38.0 32.6 38.0 125-129 35.8754 38.0 37.0 38.0 32.8 38.0 130-134 35.67785 38.0 36.8 38.0 31.6 38.0 135-139 35.52504999999999 38.0 36.4 38.0 31.8 38.0 140-144 35.02565 38.0 36.0 38.0 29.6 38.0 145-149 34.529399999999995 38.0 35.6 38.0 28.0 38.0 150-151 31.413125 36.5 31.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 3.0 15 4.0 16 2.0 17 2.0 18 6.0 19 1.0 20 4.0 21 5.0 22 7.0 23 6.0 24 12.0 25 8.0 26 21.0 27 18.0 28 26.0 29 32.0 30 34.0 31 46.0 32 61.0 33 78.0 34 125.0 35 197.0 36 478.0 37 2822.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.52727734077645 13.42298908906369 9.946714031971581 34.10301953818828 2 23.974999999999998 13.625000000000002 31.4 31.0 3 20.525 16.525000000000002 25.724999999999998 37.225 4 22.325 24.5 24.099999999999998 29.075 5 23.425 27.200000000000003 26.650000000000002 22.725 6 21.525 31.7 25.275 21.5 7 14.075 27.650000000000002 41.3 16.975 8 17.625 27.375 31.125000000000004 23.875 9 17.05 26.0 33.275 23.674999999999997 10-14 19.259999999999998 29.895 27.345000000000002 23.5 15-19 19.78 29.409999999999997 27.089999999999996 23.72 20-24 19.66 29.145 27.405 23.79 25-29 20.044999999999998 29.020000000000003 27.325 23.61 30-34 19.775000000000002 29.01 27.36 23.855 35-39 20.150000000000002 28.744999999999997 26.669999999999998 24.435000000000002 40-44 19.705000000000002 28.84 27.295 24.16 45-49 20.515 28.144999999999996 27.095000000000002 24.245 50-54 19.939999999999998 28.465 27.685 23.91 55-59 19.77 28.62 26.985 24.625 60-64 19.945 28.53 26.700000000000003 24.825 65-69 20.015 28.134999999999998 27.584999999999997 24.265 70-74 19.535 28.33 26.939999999999998 25.195 75-79 19.965 28.560000000000002 27.634999999999998 23.84 80-84 19.89 27.66 27.82 24.63 85-89 20.505000000000003 28.310000000000002 27.07 24.115000000000002 90-94 20.585 28.560000000000002 26.58 24.275 95-99 20.275000000000002 27.744999999999997 27.29 24.69 100-104 20.645 28.29 26.695 24.37 105-109 20.635 28.449999999999996 26.715 24.2 110-114 20.635 28.425 27.04 23.9 115-119 20.46 27.97 27.185 24.385 120-124 20.810000000000002 27.79 27.075 24.325 125-129 20.755000000000003 27.485 27.384999999999998 24.375 130-134 20.68 28.185 26.57 24.565 135-139 20.46 28.189999999999998 27.46 23.89 140-144 20.845 27.389999999999997 27.365000000000002 24.4 145-149 20.575 28.07 27.060000000000002 24.295 150-151 20.8125 28.237499999999997 26.700000000000003 24.25 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 1.0 22 1.0 23 2.5 24 4.0 25 4.5 26 7.0 27 7.5 28 8.5 29 12.5 30 21.0 31 26.5 32 31.5 33 45.0 34 57.5 35 72.0 36 82.0 37 92.5 38 110.5 39 127.5 40 162.5 41 189.5 42 215.5 43 246.5 44 248.5 45 258.0 46 281.0 47 285.0 48 247.5 49 206.5 50 190.0 51 150.0 52 123.0 53 107.5 54 88.5 55 77.5 56 52.5 57 36.0 58 22.5 59 18.5 60 25.5 61 18.0 62 5.5 63 3.0 64 4.0 65 4.5 66 2.5 67 2.0 68 3.5 69 2.5 70 2.0 71 1.5 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4749999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67369477911646 99.275 2 0.2761044176706827 0.5499999999999999 3 0.0251004016064257 0.075 4 0.0251004016064257 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.025 0.0 0.0 0.0 44-45 0.025 0.025 0.0 0.0 0.0 46-47 0.025 0.025 0.0 0.0 0.0 48-49 0.025 0.025 0.0 0.0 0.0 50-51 0.025 0.025 0.0 0.0 0.0 52-53 0.037500000000000006 0.025 0.0 0.0 0.0 54-55 0.05 0.025 0.0 0.0 0.0 56-57 0.05 0.025 0.0 0.0 0.0 58-59 0.05 0.025 0.0 0.0 0.0 60-61 0.05 0.025 0.0 0.0 0.0 62-63 0.05 0.025 0.0 0.0 0.0 64-65 0.05 0.025 0.0 0.0 0.0 66-67 0.05 0.025 0.0 0.0 0.0 68-69 0.05 0.025 0.0 0.0 0.0 70-71 0.0625 0.025 0.0 0.0 0.0 72-73 0.075 0.025 0.0 0.0 0.0 74-75 0.075 0.025 0.0 0.0 0.0 76-77 0.075 0.025 0.0 0.0 0.0 78-79 0.075 0.025 0.0 0.0 0.0 80-81 0.0875 0.025 0.0 0.0 0.0 82-83 0.1125 0.025 0.0 0.0 0.0 84-85 0.16249999999999998 0.025 0.0 0.0 0.0 86-87 0.21250000000000002 0.025 0.0 0.0 0.0 88-89 0.225 0.025 0.0 0.0 0.0 90-91 0.2625 0.025 0.0 0.0 0.0 92-93 0.3625 0.025 0.0 0.0 0.0 94-95 0.5375 0.025 0.0 0.0 0.0 96-97 0.625 0.025 0.0 0.0 0.0 98-99 0.8 0.025 0.0 0.0 0.0 100-101 0.925 0.025 0.0 0.0 0.0 102-103 1.0875 0.025 0.0 0.0 0.0 104-105 1.2125 0.025 0.0 0.0 0.0 106-107 1.2625 0.05 0.0 0.0 0.0 108-109 1.45 0.05 0.0 0.0 0.0 110-111 1.6875 0.05 0.0 0.0 0.0 112-113 1.7999999999999998 0.05 0.0 0.0 0.0 114-115 1.9125 0.05 0.0 0.0 0.0 116-117 2.075 0.05 0.0 0.0 0.0 118-119 2.3125 0.05 0.0 0.0 0.0 120-121 2.625 0.05 0.0 0.0 0.0 122-123 2.825 0.05 0.0 0.0 0.0 124-125 3.125 0.05 0.0 0.0 0.0 126-127 3.325 0.05 0.0 0.0 0.0 128-129 3.6625 0.05 0.0 0.0 0.0 130-131 4.0875 0.05 0.0 0.0 0.0 132-133 4.475 0.05 0.0 0.0 0.0 134-135 4.8375 0.05 0.0 0.0 0.0 136-137 5.1375 0.05 0.0 0.0 0.0 138-139 5.5625 0.05 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169553 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169553_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.72975 33.0 33.0 34.0 32.0 34.0 2 32.877 33.0 33.0 34.0 32.0 34.0 3 32.84925 34.0 33.0 34.0 32.0 34.0 4 32.80875 34.0 33.0 34.0 32.0 34.0 5 32.87125 34.0 33.0 34.0 32.0 34.0 6 37.03925 38.0 38.0 38.0 37.0 38.0 7 37.039 38.0 38.0 38.0 37.0 38.0 8 36.99825 38.0 38.0 38.0 37.0 38.0 9 36.9975 38.0 38.0 38.0 37.0 38.0 10-14 36.97835 38.0 38.0 38.0 36.4 38.0 15-19 36.92285 38.0 38.0 38.0 36.2 38.0 20-24 36.8718 38.0 38.0 38.0 36.2 38.0 25-29 36.84155 38.0 38.0 38.0 36.0 38.0 30-34 36.695750000000004 38.0 38.0 38.0 36.0 38.0 35-39 36.7387 38.0 38.0 38.0 35.8 38.0 40-44 36.822500000000005 38.0 38.0 38.0 36.0 38.0 45-49 36.749 38.0 38.0 38.0 36.0 38.0 50-54 36.77745 38.0 38.0 38.0 36.0 38.0 55-59 36.80175 38.0 38.0 38.0 36.0 38.0 60-64 36.710899999999995 38.0 38.0 38.0 35.8 38.0 65-69 36.64985 38.0 38.0 38.0 35.6 38.0 70-74 36.589 38.0 38.0 38.0 35.6 38.0 75-79 36.5232 38.0 38.0 38.0 35.0 38.0 80-84 36.32405000000001 38.0 38.0 38.0 34.0 38.0 85-89 36.3195 38.0 38.0 38.0 34.0 38.0 90-94 36.289049999999996 38.0 38.0 38.0 34.0 38.0 95-99 36.19175 38.0 38.0 38.0 34.2 38.0 100-104 36.109899999999996 38.0 38.0 38.0 34.0 38.0 105-109 36.03005 38.0 38.0 38.0 33.8 38.0 110-114 35.891200000000005 38.0 38.0 38.0 33.2 38.0 115-119 35.7181 38.0 37.6 38.0 32.2 38.0 120-124 35.4337 38.0 37.0 38.0 31.0 38.0 125-129 35.131150000000005 38.0 36.2 38.0 28.8 38.0 130-134 34.888400000000004 38.0 36.0 38.0 28.0 38.0 135-139 34.64275 38.0 36.0 38.0 27.4 38.0 140-144 34.2265 38.0 35.2 38.0 24.6 38.0 145-149 33.7065 38.0 35.0 38.0 20.8 38.0 150-151 30.15875 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 3.0 4 0.0 5 0.0 6 2.0 7 1.0 8 2.0 9 2.0 10 0.0 11 1.0 12 2.0 13 4.0 14 3.0 15 3.0 16 4.0 17 10.0 18 1.0 19 4.0 20 11.0 21 7.0 22 12.0 23 19.0 24 11.0 25 18.0 26 23.0 27 40.0 28 40.0 29 43.0 30 36.0 31 43.0 32 59.0 33 95.0 34 131.0 35 193.0 36 471.0 37 2690.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.07133917396746 21.952440550688358 15.494367959949937 25.481852315394242 2 29.218828242363543 27.99198798197296 26.339509263895845 16.44967451176765 3 21.557336004006007 29.218828242363543 29.56935403104657 19.654481722583874 4 24.536805207811717 33.12468703054582 23.059589384076116 19.278918377566352 5 25.38808212318478 33.85077616424637 23.360040060090135 17.40110165247872 6 21.98297446169254 35.57836755132699 23.73560340510766 18.70305458187281 7 20.941883767535067 22.044088176352705 37.3496993987976 19.664328657314627 8 22.49498997995992 26.753507014028056 26.152304609218437 24.599198396793586 9 22.369739478957914 25.551102204408814 29.358717434869742 22.720440881763526 10-14 23.642828525641026 28.74599358974359 26.036658653846157 21.574519230769234 15-19 23.913478870418587 27.828960544762666 26.692369317043863 21.565191267774885 20-24 24.1234221598878 28.341013824884794 26.522740933680627 21.012823081546784 25-29 23.789009667885587 27.886590191854932 27.05505184591494 21.269348294344535 30-34 23.87200160248385 28.373979668486154 27.337372928038462 20.416645800991535 35-39 23.966528035275843 28.02525429673799 27.008067344791304 21.00015032319487 40-44 24.234681096247307 27.351069692870382 27.28593616914675 21.12831304173556 45-49 24.44767296227644 27.35834878012124 27.563749311156755 20.63022894644557 50-54 23.92545837090472 27.717663560765455 27.026350065123733 21.33052800320609 55-59 24.864783653846153 27.318709935897434 27.128405448717945 20.68810096153846 60-64 23.616051300035068 28.174941135213665 27.363358549170886 20.84564901558038 65-69 23.51850924209788 27.96172919901818 27.771377047537943 20.74838451134599 70-74 25.12399178397876 27.71404238264616 26.64195180602174 20.52001402735334 75-79 24.234681096247307 28.207826043388945 27.55649080615261 20.001002054211135 80-84 24.97995991983968 27.22444889779559 27.289579158316634 20.506012024048097 85-89 24.136894322794006 27.64944630956557 27.454026156235905 20.75963321140452 90-94 24.010620178338844 28.408977056407174 27.0564071736299 20.523995591624086 95-99 24.437766090658652 27.528174305033808 27.618332081142 20.41572752316554 100-104 24.542950162784873 28.219383921863262 26.95717505634861 20.280490859003255 105-109 24.51289757074881 28.01402454295016 27.27272727272727 20.200350613573754 110-114 24.65684801122132 27.33193066826971 27.387035367197676 20.62418595331129 115-119 24.80965738328992 27.644760569024246 26.823281907433383 20.722300140252454 120-124 24.9749498997996 27.715430861723444 27.069138276553105 20.240480961923847 125-129 24.708122463296085 27.278649095555448 27.62439244375407 20.3888359973944 130-134 25.293233082706767 27.98997493734336 26.94736842105263 19.76942355889724 135-139 24.868467204489654 27.62940321691637 27.44901538307361 20.05311419552037 140-144 25.20418900636368 28.34093300596282 26.58716239915819 19.86771558851531 145-149 25.340681362725455 27.745490981963925 26.89879759519038 20.01503006012024 150-151 25.012512512512515 27.18968968968969 27.615115115115113 20.18268268268268 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 4.0 1 2.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 1.0 25 2.0 26 2.0 27 1.5 28 2.0 29 4.5 30 8.0 31 12.0 32 14.0 33 17.5 34 28.5 35 45.5 36 70.0 37 89.0 38 120.5 39 145.0 40 170.5 41 209.5 42 247.5 43 271.5 44 278.5 45 289.0 46 285.5 47 268.5 48 248.0 49 231.5 50 200.0 51 161.0 52 127.5 53 103.5 54 84.0 55 61.0 56 46.0 57 37.0 58 27.5 59 21.5 60 18.0 61 13.0 62 7.5 63 5.0 64 4.0 65 3.5 66 2.5 67 1.5 68 2.0 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.15 3 0.15 4 0.15 5 0.15 6 0.15 7 0.2 8 0.2 9 0.2 10-14 0.16 15-19 0.13999999999999999 20-24 0.18 25-29 0.185 30-34 0.155 35-39 0.215 40-44 0.20500000000000002 45-49 0.19499999999999998 50-54 0.19 55-59 0.16 60-64 0.19499999999999998 65-69 0.185 70-74 0.19499999999999998 75-79 0.20500000000000002 80-84 0.2 85-89 0.215 90-94 0.19 95-99 0.17500000000000002 100-104 0.17500000000000002 105-109 0.17500000000000002 110-114 0.19 115-119 0.18 120-124 0.2 125-129 0.215 130-134 0.25 135-139 0.215 140-144 0.215 145-149 0.2 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64850615114236 99.225 2 0.3012804418779814 0.6 3 0.025106703489831784 0.075 4 0.025106703489831784 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.7125 0.0 0.0 0.0 0.0 100-101 0.825 0.0 0.0 0.0 0.0 102-103 0.9874999999999999 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.1625 0.0 0.0 0.0 0.0 108-109 1.35 0.0 0.0 0.0 0.0 110-111 1.5875 0.0 0.0 0.0 0.0 112-113 1.725 0.0 0.0 0.0 0.0 114-115 1.8375 0.0 0.0 0.0 0.0 116-117 2.0125 0.0 0.0 0.0 0.0 118-119 2.2375 0.0 0.0 0.0 0.0 120-121 2.55 0.0 0.0 0.0 0.0 122-123 2.75 0.0 0.0 0.0 0.0 124-125 3.05 0.0 0.0 0.0 0.0 126-127 3.25 0.0 0.0 0.0 0.0 128-129 3.5875 0.0 0.0 0.0 0.0 130-131 4.0375 0.0 0.0 0.0 0.0 132-133 4.4375 0.0 0.0 0.0 0.0 134-135 4.7625 0.0 0.0 0.0 0.0 136-137 5.075 0.0 0.0 0.0 0.0 138-139 5.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGGAAG 10 0.006830828 145.0 2 AAAAAAA 20 0.00593511 29.0 70-74 >>END_MODULE Read 980394 spots for SRR7169553.sra Written 980394 spots for SRR7169553.sra Read 980394 spots for SRR7169553.sra Written 980394 spots for SRR7169553.sra Read 980394 spots for SRR7169553.sra Written 980394 spots for SRR7169553.sra Read 980394 spots for SRR7169553.sra Written 980394 spots for SRR7169553.sra Read 980394 spots for SRR7169553.sra Written 980394 spots for SRR7169553.sra Read 980394 spots for SRR7169553.sra Written 980394 spots for SRR7169553.sra Read 980394 spots for SRR7169553.sra Written 980394 spots for SRR7169553.sra Read 980394 spots for SRR7169553.sra Written 980394 spots for SRR7169553.sra Read 980394 spots for SRR7169553.sra Written 980394 spots for SRR7169553.sra Read 980394 spots for SRR7169553.sra Written 980394 spots for SRR7169553.sra Read 980394 spots for SRR7169553.sra Written 980394 spots for SRR7169553.sra Read 980394 spots for SRR7169553.sra Written 980394 spots for SRR7169553.sra Read 980394 spots for SRR7169553.sra Written 980394 spots for SRR7169553.sra Read 980394 spots for SRR7169553.sra Written 980394 spots for SRR7169553.sra Read 980394 spots for SRR7169553.sra Written 980394 spots for SRR7169553.sra Read 980394 spots for SRR7169553.sra Written 980394 spots for SRR7169553.sra Read 980394 spots for SRR7169553.sra Written 980394 spots for SRR7169553.sra Read 980404 spots for SRR7169553.sra Written 980404 spots for SRR7169553.sra Read 980394 spots for SRR7169553.sra Written 980394 spots for SRR7169553.sra Read 980394 spots for SRR7169553.sra Written 980394 spots for SRR7169553.sra SRR ids: ['SRR7169553.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rys_v5rx SRR7169553.sra spots: 19607890 blocks: [[1, 980394], [980395, 1960788], [1960789, 2941182], [2941183, 3921576], [3921577, 4901970], [4901971, 5882364], [5882365, 6862758], [6862759, 7843152], [7843153, 8823546], [8823547, 9803940], [9803941, 10784334], [10784335, 11764728], [11764729, 12745122], [12745123, 13725516], [13725517, 14705910], [14705911, 15686304], [15686305, 16666698], [16666699, 17647092], [17647093, 18627486], [18627487, 19607890]] SRR7169553 file size 6622770 SRR7169553 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169553 SRR7169553_1.fastq SRR7169553_2.fastq Input file: SRR7169553_1.fastq Paired file: SRR7169553_2.fastq trimmed: SRR7169553-trimmed-pair1.fastq, SRR7169553-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 23:44:28 2025 >> started Mon Feb 10 23:45:00 2025 >> done (32.170s) 19607890 read pairs processed; of these: 33150 ( 0.17%) short read pairs filtered out after trimming by size control 85197 ( 0.43%) empty read pairs filtered out after trimming by size control 19489543 (99.40%) read pairs available; of these: 9468910 (48.58%) trimmed read pairs available after processing 10020633 (51.42%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 3 0.00% 20 6 0.00% 21 7 0.00% 22 6 0.00% 23 11 0.00% 24 8 0.00% 25 4 0.00% 26 8 0.00% 27 11 0.00% 28 9 0.00% 29 10 0.00% 30 10 0.00% 31 24 0.00% 32 10 0.00% 33 18 0.00% 34 13 0.00% 35 19 0.00% 36 12 0.00% 37 19 0.00% 38 29 0.00% 39 24 0.00% 40 24 0.00% 41 22 0.00% 42 35 0.00% 43 33 0.00% 44 37 0.00% 45 42 0.00% 46 59 0.00% 47 52 0.00% 48 86 0.00% 49 69 0.00% 50 66 0.00% 51 100 0.00% 52 105 0.00% 53 116 0.00% 54 112 0.00% 55 154 0.00% 56 143 0.00% 57 181 0.00% 58 196 0.00% 59 199 0.00% 60 257 0.00% 61 251 0.00% 62 328 0.00% 63 371 0.00% 64 398 0.00% 65 446 0.00% 66 544 0.00% 67 655 0.00% 68 1009 0.01% 69 3329 0.02% 70 4919 0.03% 71 2115 0.01% 72 1432 0.01% 73 1353 0.01% 74 1515 0.01% 75 1541 0.01% 76 1878 0.01% 77 1926 0.01% 78 2103 0.01% 79 2499 0.01% 80 2665 0.01% 81 2966 0.02% 82 3514 0.02% 83 3951 0.02% 84 5737 0.03% 85 6584 0.03% 86 6942 0.04% 87 7424 0.04% 88 7973 0.04% 89 8362 0.04% 90 8943 0.05% 91 9561 0.05% 92 10100 0.05% 93 10284 0.05% 94 11091 0.06% 95 11780 0.06% 96 12526 0.06% 97 13351 0.07% 98 13860 0.07% 99 14165 0.07% 100 15316 0.08% 101 15974 0.08% 102 17206 0.09% 103 17946 0.09% 104 19289 0.10% 105 20310 0.10% 106 21507 0.11% 107 22132 0.11% 108 22749 0.12% 109 24012 0.12% 110 25283 0.13% 111 26281 0.13% 112 27432 0.14% 113 28687 0.15% 114 30465 0.16% 115 32158 0.17% 116 33127 0.17% 117 34669 0.18% 118 35912 0.18% 119 36920 0.19% 120 38398 0.20% 121 39457 0.20% 122 41420 0.21% 123 43491 0.22% 124 46436 0.24% 125 48487 0.25% 126 50856 0.26% 127 53423 0.27% 128 55799 0.29% 129 57872 0.30% 130 61677 0.32% 131 63573 0.33% 132 67706 0.35% 133 71105 0.36% 134 74894 0.38% 135 79894 0.41% 136 85349 0.44% 137 90223 0.46% 138 96595 0.50% 139 103226 0.53% 140 110546 0.57% 141 121375 0.62% 142 134393 0.69% 143 150471 0.77% 144 172626 0.89% 145 206936 1.06% 146 255944 1.31% 147 345213 1.77% 148 532424 2.73% 149 981123 5.03% 150 4477854 22.98% 151 10020633 51.42% 19489543 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=37 prefix-density=0.24 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=349.11 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=17.8 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=48 prefix-density=0.24 prefix-fanout=1.9 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=46 fanout-score=113.65 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=8.6 sequence=AAAGCAATTTCTTCATCCTCTTCTGTGATAATCACTCCTACCTTTTTGCTTCTTACAGTTTTCTTTTGTATCCCAGCTGTGCTTTATTTTCCTTCTAGTTCCAATGGCCACTGTTGAGGTTG SRR7169553 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 23:45:57 Started mapping on | Feb 10 23:45:57 Finished on | Feb 10 23:48:56 Mapping speed, Million of reads per hour | 391.97 Number of input reads | 19489543 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 18241487 Uniquely mapped reads % | 93.60% Average mapped length | 293.79 Number of splices: Total | 16616218 Number of splices: Annotated (sjdb) | 16324567 Number of splices: GT/AG | 16372256 Number of splices: GC/AG | 191635 Number of splices: AT/AC | 15603 Number of splices: Non-canonical | 36724 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 353130 % of reads mapped to multiple loci | 1.81% Number of reads mapped to too many loci | 25667 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.41% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 923691 923691 923691 N_multimapping 353130 353130 353130 N_noFeature 367884 18017831 466346 N_ambiguous 199564 1036 73740 UnstrandedReadsAssigned:17674039 PositiveStrandReadsAssigned:222620 NegativeStrandReadsAssigned:17701401 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169553 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169553-trimmed-pair1.fastq SRR7169553-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,489,543 reads, 17,582,008 reads pseudoaligned [quant] estimated average fragment length: 245.088 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,053 rounds 52401 SRR7169553.ke.tsv 34699 SRR7169553.se.tsv 87100 total ==> SRR7169553.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.91 315 8.70212 Potri.005G024800.1.v4.1 1035 790.912 42 2.60236 Potri.004G059700.1.v4.1 961 716.918 4 0.273424 Potri.007G009000.2.v4.1 1416 1171.91 0 0 Potri.003G141000.2.v4.1 2943 2698.91 266 4.82992 Potri.016G087400.1.v4.1 270 77.8365 2016.55 1269.62 Potri.015G069301.1.v4.1 564 324.18 0 0 Potri.010G195200.1.v4.1 1773 1528.91 41 1.31416 Potri.012G127500.1.v4.1 977 732.912 6304 421.513 ==> SRR7169553.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1277 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 375 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 4 SRR7169553 completed mapping pipeline successfully