Starting /dee2/code/volunteer_pipeline.sh SRR7169554 current disk space = 3057386139648 free memory = 1211204156 SRR7169554 SRAfilesize 216f77e042c0a94c839e2689991c3817 SRR7169554.sra SRR7169554.sra file validated SRR7169554 is paired end SRR7169554 is conventional basespace SRR7169554 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169554_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.54325 34.0 33.0 34.0 32.0 34.0 2 33.259 34.0 33.0 34.0 32.0 34.0 3 33.24975 34.0 33.0 34.0 31.0 34.0 4 33.40475 34.0 33.0 34.0 33.0 34.0 5 33.20625 34.0 33.0 34.0 33.0 34.0 6 36.85275 38.0 37.0 38.0 35.0 38.0 7 37.14975 38.0 38.0 38.0 36.0 38.0 8 37.28775 38.0 38.0 38.0 37.0 38.0 9 37.3465 38.0 38.0 38.0 37.0 38.0 10-14 37.42215 38.0 38.0 38.0 37.0 38.0 15-19 37.4122 38.0 38.0 38.0 37.0 38.0 20-24 37.40725 38.0 38.0 38.0 37.0 38.0 25-29 37.320100000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.271550000000005 38.0 38.0 38.0 37.0 38.0 35-39 37.204150000000006 38.0 38.0 38.0 36.6 38.0 40-44 36.9624 38.0 38.0 38.0 35.8 38.0 45-49 36.85785 38.0 38.0 38.0 35.0 38.0 50-54 36.84655 38.0 38.0 38.0 35.0 38.0 55-59 36.677099999999996 38.0 38.0 38.0 34.4 38.0 60-64 36.570100000000004 38.0 38.0 38.0 34.0 38.0 65-69 36.52665 38.0 38.0 38.0 34.0 38.0 70-74 36.3821 38.0 38.0 38.0 34.0 38.0 75-79 36.197250000000004 38.0 37.4 38.0 33.2 38.0 80-84 36.1579 38.0 37.2 38.0 33.4 38.0 85-89 36.01255 38.0 37.0 38.0 32.8 38.0 90-94 35.829449999999994 38.0 37.0 38.0 32.0 38.0 95-99 35.6178 38.0 37.0 38.0 31.0 38.0 100-104 35.30309999999999 38.0 36.6 38.0 29.6 38.0 105-109 35.153499999999994 38.0 36.2 38.0 28.8 38.0 110-114 34.66265 38.0 36.0 38.0 26.2 38.0 115-119 34.45605 38.0 35.0 38.0 25.0 38.0 120-124 34.277950000000004 38.0 35.0 38.0 24.4 38.0 125-129 33.8449 38.0 34.4 38.0 22.2 38.0 130-134 33.592600000000004 38.0 34.0 38.0 20.2 38.0 135-139 33.17615 38.0 34.0 38.0 15.0 38.0 140-144 32.679700000000004 38.0 33.6 38.0 14.4 38.0 145-149 31.265249999999998 36.6 32.2 38.0 8.8 38.0 150-151 27.83475 35.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 1.0 12 3.0 13 3.0 14 3.0 15 5.0 16 6.0 17 11.0 18 18.0 19 7.0 20 9.0 21 11.0 22 10.0 23 14.0 24 14.0 25 29.0 26 33.0 27 40.0 28 36.0 29 49.0 30 53.0 31 85.0 32 105.0 33 126.0 34 195.0 35 382.0 36 758.0 37 1993.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.7844142527557 11.612407075108946 8.741348372212252 38.86183029992309 2 23.575 14.825 33.900000000000006 27.700000000000003 3 19.8 20.275000000000002 25.674999999999997 34.25 4 23.225 28.000000000000004 23.150000000000002 25.624999999999996 5 22.400000000000002 33.050000000000004 23.325000000000003 21.224999999999998 6 19.125 36.375 23.549999999999997 20.95 7 14.399999999999999 27.55 40.825 17.224999999999998 8 17.175 25.2 30.225 27.400000000000002 9 17.8 24.175 33.75 24.275 10-14 19.925 30.099999999999998 26.834999999999997 23.14 15-19 20.0 28.58 27.544999999999998 23.875 20-24 20.19 29.035 27.175 23.599999999999998 25-29 20.0 28.59 27.67 23.74 30-34 20.544999999999998 28.175 28.050000000000004 23.23 35-39 19.98 28.53 27.389999999999997 24.099999999999998 40-44 19.905 28.475 28.050000000000004 23.57 45-49 20.655 28.360000000000003 27.01 23.974999999999998 50-54 20.46 28.625 27.265 23.65 55-59 20.305 28.449999999999996 27.24 24.005000000000003 60-64 20.3 28.53 27.405 23.765 65-69 20.599999999999998 28.315 27.450000000000003 23.635 70-74 20.055 28.660000000000004 27.825 23.46 75-79 20.57 28.599999999999998 26.889999999999997 23.94 80-84 20.705000000000002 28.43 26.965 23.9 85-89 20.565 28.275 27.425 23.735 90-94 20.325 28.825 27.200000000000003 23.65 95-99 20.86 27.83 27.245 24.065 100-104 20.56158966915261 27.85424695930727 27.608989438910857 23.97517393262926 105-109 20.64 28.194999999999997 27.71 23.455000000000002 110-114 20.865904990980155 28.272198837442374 27.18480657446382 23.67708959711365 115-119 20.771349862258955 28.13924367643376 27.292762334084646 23.796644127222642 120-124 20.92196806646979 28.504930176685523 26.537864757995894 24.03523699884879 125-129 20.554110822164436 28.440688137627525 27.420484096819365 23.584716943388678 130-134 20.945 28.255000000000003 27.29 23.51 135-139 21.195 28.74 26.52 23.544999999999998 140-144 21.47 28.16 27.150000000000002 23.22 145-149 21.584999999999997 28.82 26.75 22.845 150-151 20.825 29.575000000000003 25.924999999999997 23.674999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 2.0 24 3.0 25 2.0 26 2.5 27 6.5 28 10.0 29 9.5 30 12.0 31 20.0 32 29.0 33 41.0 34 45.5 35 54.5 36 80.0 37 94.0 38 117.5 39 161.0 40 194.0 41 214.5 42 231.0 43 265.5 44 286.0 45 274.0 46 269.0 47 259.5 48 239.0 49 211.5 50 187.5 51 149.5 52 123.0 53 110.5 54 78.0 55 57.5 56 45.5 57 30.0 58 19.0 59 15.5 60 9.5 61 5.5 62 6.0 63 5.5 64 3.0 65 4.5 66 4.5 67 2.5 68 2.0 69 2.5 70 2.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.475 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.105 105-109 0.0 110-114 0.22 115-119 0.17500000000000002 120-124 0.105 125-129 0.02 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.4875 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.6625 0.0 0.0 0.0 0.0 100-101 0.775 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.175 0.0 0.0 0.0 0.0 106-107 1.25 0.0 0.0 0.0 0.0 108-109 1.375 0.0 0.0 0.0 0.0 110-111 1.475 0.0 0.0 0.0 0.0 112-113 1.6125 0.0 0.0 0.0 0.0 114-115 1.8375 0.0 0.0 0.0 0.0 116-117 2.025 0.0 0.0 0.0 0.0 118-119 2.275 0.0 0.0 0.0 0.0 120-121 2.425 0.0 0.0 0.0 0.0 122-123 2.7 0.0 0.0 0.0 0.0 124-125 2.975 0.0 0.0 0.0 0.0 126-127 3.2875 0.0 0.0 0.0 0.0 128-129 3.5875 0.0 0.0 0.0 0.0 130-131 3.8625 0.0 0.0 0.0 0.0 132-133 4.0875 0.0 0.0 0.0 0.0 134-135 4.4 0.0 0.0 0.0 0.0 136-137 4.7875 0.0 0.0 0.0 0.0 138-139 5.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169554 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169554_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.39475 33.0 33.0 34.0 32.0 34.0 2 32.7615 33.0 33.0 34.0 32.0 34.0 3 32.798 34.0 33.0 34.0 32.0 34.0 4 32.69275 34.0 33.0 34.0 32.0 34.0 5 32.83325 34.0 33.0 34.0 32.0 34.0 6 36.95575 38.0 38.0 38.0 36.0 38.0 7 36.964 38.0 38.0 38.0 36.0 38.0 8 36.9345 38.0 38.0 38.0 36.0 38.0 9 36.9725 38.0 38.0 38.0 36.0 38.0 10-14 36.9679 38.0 38.0 38.0 36.2 38.0 15-19 36.919650000000004 38.0 38.0 38.0 36.0 38.0 20-24 36.87675 38.0 38.0 38.0 36.0 38.0 25-29 36.885450000000006 38.0 38.0 38.0 36.0 38.0 30-34 36.84400000000001 38.0 38.0 38.0 36.0 38.0 35-39 36.7735 38.0 38.0 38.0 35.8 38.0 40-44 36.68 38.0 38.0 38.0 35.6 38.0 45-49 36.6267 38.0 38.0 38.0 35.4 38.0 50-54 36.40295 38.0 38.0 38.0 34.6 38.0 55-59 36.108349999999994 38.0 38.0 38.0 34.2 38.0 60-64 35.82175 38.0 38.0 38.0 33.6 38.0 65-69 35.79165 38.0 38.0 38.0 33.8 38.0 70-74 35.5667 38.0 38.0 38.0 32.6 38.0 75-79 35.47325 38.0 38.0 38.0 32.0 38.0 80-84 35.5777 38.0 38.0 38.0 31.8 38.0 85-89 35.6005 38.0 38.0 38.0 32.6 38.0 90-94 35.5271 38.0 38.0 38.0 31.4 38.0 95-99 35.419349999999994 38.0 37.8 38.0 30.2 38.0 100-104 35.2442 38.0 37.4 38.0 29.6 38.0 105-109 35.04685 38.0 37.0 38.0 28.4 38.0 110-114 34.930899999999994 38.0 37.0 38.0 27.8 38.0 115-119 34.7806 38.0 36.8 38.0 27.0 38.0 120-124 34.459649999999996 38.0 36.2 38.0 24.8 38.0 125-129 34.21085 38.0 36.0 38.0 23.2 38.0 130-134 33.8678 38.0 35.2 38.0 19.0 38.0 135-139 33.310050000000004 38.0 35.0 38.0 14.6 38.0 140-144 32.7907 38.0 34.6 38.0 13.8 38.0 145-149 31.874699999999997 38.0 33.6 38.0 6.4 38.0 150-151 28.027250000000002 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 4.0 4 2.0 5 1.0 6 1.0 7 7.0 8 4.0 9 1.0 10 4.0 11 8.0 12 7.0 13 24.0 14 21.0 15 4.0 16 7.0 17 8.0 18 10.0 19 8.0 20 11.0 21 12.0 22 16.0 23 21.0 24 31.0 25 28.0 26 33.0 27 40.0 28 37.0 29 42.0 30 54.0 31 67.0 32 89.0 33 89.0 34 138.0 35 234.0 36 473.0 37 2458.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.031265758951086 21.810388300554713 13.111447302067575 29.046898638426626 2 26.974999999999998 27.200000000000003 30.325000000000003 15.5 3 19.900000000000002 29.7 30.875000000000004 19.525000000000002 4 23.75 33.525 24.625 18.099999999999998 5 23.5 36.025 21.8 18.675 6 20.474999999999998 36.55 23.849999999999998 19.125 7 20.65 21.4 37.974999999999994 19.975 8 22.25 24.625 26.75 26.375 9 21.099999999999998 24.975 30.25 23.674999999999997 10-14 23.409681936387276 28.510702140428084 26.5253050610122 21.554310862172436 15-19 22.96 27.295 28.125 21.62 20-24 22.805 27.91 28.005000000000003 21.279999999999998 25-29 23.465 27.595 27.655 21.285 30-34 22.345000000000002 28.125 28.015 21.515 35-39 22.97 27.939999999999998 28.225 20.865000000000002 40-44 22.945 27.62 28.035 21.4 45-49 23.330000000000002 27.905 27.77 20.995 50-54 23.164722445695897 28.142598551890586 27.735317779565566 20.957361222847947 55-59 23.346342946930914 27.89801814587663 27.908155507121496 20.847483400070963 60-64 23.387877861038895 27.45068053219147 28.14395677218739 21.017484834582252 65-69 23.411439680753094 27.862478256420754 27.821549166069786 20.90453289675637 70-74 23.38593974175036 27.618364418938306 28.37671654027465 20.61897929903669 75-79 23.90033835742848 27.760689018763458 27.832461806623606 20.506510817184456 80-84 23.621806313427506 27.80355958998419 28.0789433423428 20.495690754245498 85-89 23.24552481692433 27.807160292921075 28.259764035801467 20.68755085435313 90-94 23.559837728194726 27.38336713995943 28.417849898580123 20.63894523326572 95-99 23.74563313249962 27.320135689332187 27.95301503721331 20.98121614095489 100-104 23.436234817813766 28.491902834008098 27.530364372469634 20.541497975708502 105-109 23.827828637904 27.307672854180364 28.55191947802337 20.312579029892266 110-114 24.36868686868687 27.580808080808083 27.904040404040405 20.146464646464647 115-119 24.541828646438127 27.278234967435754 27.727571060736107 20.452365325390012 120-124 24.58041429363439 27.67501638022277 27.624615694773446 20.119953631369388 125-129 24.21223003388802 28.192807647564617 27.287441201760153 20.307521116787214 130-134 25.00888279782752 28.15593117100655 27.353941424293183 19.481244606872746 135-139 25.022933442054835 27.5048415044338 27.5048415044338 19.967383549077567 140-144 25.13003569607343 27.42988271290158 27.27180010198878 20.168281489036204 145-149 24.79122905886572 28.19304267636662 26.93785542292126 20.077872841846407 150-151 25.49626192317608 28.344934261407577 26.617684970353185 19.54111884506316 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.5 14 0.5 15 0.0 16 0.5 17 1.0 18 1.0 19 2.0 20 5.0 21 6.0 22 6.5 23 7.0 24 5.0 25 5.0 26 6.0 27 7.0 28 8.5 29 10.0 30 16.5 31 22.5 32 23.5 33 31.0 34 44.0 35 59.0 36 85.5 37 99.0 38 114.0 39 154.5 40 198.0 41 234.5 42 265.0 43 283.5 44 290.0 45 283.5 46 265.0 47 258.5 48 239.0 49 193.5 50 156.5 51 142.0 52 120.5 53 86.5 54 63.0 55 44.5 56 37.0 57 33.0 58 22.0 59 16.0 60 12.0 61 8.5 62 7.5 63 6.5 64 5.0 65 3.5 66 1.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8500000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.02 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.5599999999999999 55-59 1.355 60-64 1.915 65-69 2.27 70-74 2.42 75-79 2.4699999999999998 80-84 1.955 85-89 1.68 90-94 1.4000000000000001 95-99 1.2449999999999999 100-104 1.2 105-109 1.145 110-114 1.0 115-119 0.9650000000000001 120-124 0.795 125-129 1.145 130-134 1.4949999999999999 135-139 1.8900000000000001 140-144 1.95 145-149 2.405 150-151 3.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67377666248431 99.3 2 0.27603513174404015 0.5499999999999999 3 0.05018820577164366 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.1625 0.0 0.0 0.0 0.0 106-107 1.25 0.0 0.0 0.0 0.0 108-109 1.375 0.0 0.0 0.0 0.0 110-111 1.5375 0.0 0.0 0.0 0.0 112-113 1.7125 0.0 0.0 0.0 0.0 114-115 1.8875000000000002 0.0 0.0 0.0 0.0 116-117 2.075 0.0 0.0 0.0 0.0 118-119 2.3625 0.0 0.0 0.0 0.0 120-121 2.475 0.0 0.0 0.0 0.0 122-123 2.7375 0.0 0.0 0.0 0.0 124-125 3.025 0.0 0.0 0.0 0.0 126-127 3.35 0.0 0.0 0.0 0.0 128-129 3.6625 0.0 0.0 0.0 0.0 130-131 3.9250000000000003 0.0 0.0 0.0 0.0 132-133 4.125 0.0 0.0 0.0 0.0 134-135 4.425 0.0 0.0 0.0 0.0 136-137 4.825 0.0 0.0 0.0 0.0 138-139 5.324999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTGCTA 10 0.006822205 145.03798 1 >>END_MODULE Read 811882 spots for SRR7169554.sra Written 811882 spots for SRR7169554.sra Read 811882 spots for SRR7169554.sra Written 811882 spots for SRR7169554.sra Read 811882 spots for SRR7169554.sra Written 811882 spots for SRR7169554.sra Read 811882 spots for SRR7169554.sra Written 811882 spots for SRR7169554.sra Read 811882 spots for SRR7169554.sra Written 811882 spots for SRR7169554.sra Read 811882 spots for SRR7169554.sra Written 811882 spots for SRR7169554.sra Read 811882 spots for SRR7169554.sra Written 811882 spots for SRR7169554.sra Read 811882 spots for SRR7169554.sra Written 811882 spots for SRR7169554.sra Read 811882 spots for SRR7169554.sra Written 811882 spots for SRR7169554.sra Read 811882 spots for SRR7169554.sra Written 811882 spots for SRR7169554.sra Read 811882 spots for SRR7169554.sra Written 811882 spots for SRR7169554.sra Read 811882 spots for SRR7169554.sra Written 811882 spots for SRR7169554.sra Read 811882 spots for SRR7169554.sra Written 811882 spots for SRR7169554.sra Read 811885 spots for SRR7169554.sra Written 811885 spots for SRR7169554.sra Read 811882 spots for SRR7169554.sra Written 811882 spots for SRR7169554.sra Read 811882 spots for SRR7169554.sra Written 811882 spots for SRR7169554.sra Read 811882 spots for SRR7169554.sra Written 811882 spots for SRR7169554.sra Read 811882 spots for SRR7169554.sra Written 811882 spots for SRR7169554.sra Read 811882 spots for SRR7169554.sra Written 811882 spots for SRR7169554.sra Read 811882 spots for SRR7169554.sra Written 811882 spots for SRR7169554.sra SRR ids: ['SRR7169554.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ufx_d5y9 SRR7169554.sra spots: 16237643 blocks: [[1, 811882], [811883, 1623764], [1623765, 2435646], [2435647, 3247528], [3247529, 4059410], [4059411, 4871292], [4871293, 5683174], [5683175, 6495056], [6495057, 7306938], [7306939, 8118820], [8118821, 8930702], [8930703, 9742584], [9742585, 10554466], [10554467, 11366348], [11366349, 12178230], [12178231, 12990112], [12990113, 13801994], [13801995, 14613876], [14613877, 15425758], [15425759, 16237643]] SRR7169554 file size 5480704 SRR7169554 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169554 SRR7169554_1.fastq SRR7169554_2.fastq Input file: SRR7169554_1.fastq Paired file: SRR7169554_2.fastq trimmed: SRR7169554-trimmed-pair1.fastq, SRR7169554-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Feb 10 23:56:45 2025 >> started Mon Feb 10 23:57:02 2025 >> done (17.104s) 16237643 read pairs processed; of these: 14338 ( 0.09%) short read pairs filtered out after trimming by size control 10008 ( 0.06%) empty read pairs filtered out after trimming by size control 16213297 (99.85%) read pairs available; of these: 8045969 (49.63%) trimmed read pairs available after processing 8167328 (50.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 4 0.00% 20 6 0.00% 21 4 0.00% 22 5 0.00% 23 7 0.00% 24 8 0.00% 25 10 0.00% 26 9 0.00% 27 13 0.00% 28 8 0.00% 29 5 0.00% 30 16 0.00% 31 11 0.00% 32 7 0.00% 33 16 0.00% 34 9 0.00% 35 15 0.00% 36 25 0.00% 37 19 0.00% 38 27 0.00% 39 21 0.00% 40 39 0.00% 41 30 0.00% 42 42 0.00% 43 41 0.00% 44 36 0.00% 45 50 0.00% 46 58 0.00% 47 60 0.00% 48 55 0.00% 49 74 0.00% 50 95 0.00% 51 92 0.00% 52 128 0.00% 53 113 0.00% 54 130 0.00% 55 141 0.00% 56 167 0.00% 57 173 0.00% 58 208 0.00% 59 224 0.00% 60 279 0.00% 61 331 0.00% 62 369 0.00% 63 454 0.00% 64 476 0.00% 65 522 0.00% 66 583 0.00% 67 639 0.00% 68 693 0.00% 69 891 0.01% 70 1032 0.01% 71 1197 0.01% 72 1350 0.01% 73 1666 0.01% 74 1881 0.01% 75 2309 0.01% 76 2100 0.01% 77 1734 0.01% 78 2304 0.01% 79 3713 0.02% 80 5937 0.04% 81 2667 0.02% 82 3071 0.02% 83 3409 0.02% 84 4482 0.03% 85 5193 0.03% 86 5663 0.03% 87 6003 0.04% 88 6162 0.04% 89 6519 0.04% 90 7025 0.04% 91 7742 0.05% 92 8516 0.05% 93 9432 0.06% 94 10305 0.06% 95 11072 0.07% 96 11739 0.07% 97 12814 0.08% 98 14577 0.09% 99 18394 0.11% 100 22066 0.14% 101 17842 0.11% 102 15323 0.09% 103 15662 0.10% 104 16541 0.10% 105 17531 0.11% 106 18450 0.11% 107 19087 0.12% 108 19747 0.12% 109 20497 0.13% 110 21417 0.13% 111 22355 0.14% 112 23904 0.15% 113 25212 0.16% 114 26562 0.16% 115 28000 0.17% 116 29095 0.18% 117 29896 0.18% 118 31125 0.19% 119 31812 0.20% 120 32961 0.20% 121 34292 0.21% 122 35910 0.22% 123 38304 0.24% 124 40217 0.25% 125 41979 0.26% 126 43884 0.27% 127 45521 0.28% 128 47633 0.29% 129 49623 0.31% 130 52086 0.32% 131 53813 0.33% 132 57293 0.35% 133 61108 0.38% 134 64847 0.40% 135 69320 0.43% 136 73983 0.46% 137 78732 0.49% 138 84797 0.52% 139 92416 0.57% 140 99352 0.61% 141 107438 0.66% 142 119676 0.74% 143 133023 0.82% 144 153078 0.94% 145 183271 1.13% 146 222924 1.37% 147 302159 1.86% 148 448083 2.76% 149 845457 5.21% 150 3693213 22.78% 151 8167328 50.37% 16213297 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=40 prefix-density=0.19 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAAC criterion=fanout-score sequence-density=0.16 sequence-density-rank=4 fanout-score=71.42 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=17.0 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.62 fanout-score-rank=32 prefix-density=0.35 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.14 sequence-density-rank=15 fanout-score=47.17 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=13.2 sequence=TGTTGGTGGTGG SRR7169554 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 10 23:57:54 Started mapping on | Feb 10 23:57:54 Finished on | Feb 10 23:59:42 Mapping speed, Million of reads per hour | 540.44 Number of input reads | 16213297 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 15300449 Uniquely mapped reads % | 94.37% Average mapped length | 293.33 Number of splices: Total | 14611378 Number of splices: Annotated (sjdb) | 14370812 Number of splices: GT/AG | 14399016 Number of splices: GC/AG | 167175 Number of splices: AT/AC | 12350 Number of splices: Non-canonical | 32837 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.02% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 267485 % of reads mapped to multiple loci | 1.65% Number of reads mapped to too many loci | 78544 % of reads mapped to too many loci | 0.48% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.41% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 660314 660314 660314 N_multimapping 267485 267485 267485 N_noFeature 327929 15135226 403469 N_ambiguous 152257 856 61964 UnstrandedReadsAssigned:14820263 PositiveStrandReadsAssigned:164367 NegativeStrandReadsAssigned:14835016 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169554 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169554-trimmed-pair1.fastq SRR7169554-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,213,297 reads, 14,798,645 reads pseudoaligned [quant] estimated average fragment length: 247.801 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,178 rounds 52401 SRR7169554.ke.tsv 34699 SRR7169554.se.tsv 87100 total ==> SRR7169554.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1771.2 324 13.2325 Potri.005G024800.1.v4.1 1035 788.199 18 1.65196 Potri.004G059700.1.v4.1 961 714.236 7 0.708957 Potri.007G009000.2.v4.1 1416 1169.2 0 0 Potri.003G141000.2.v4.1 2943 2696.2 301.03 8.07648 Potri.016G087400.1.v4.1 270 78.8313 1095 1004.8 Potri.015G069301.1.v4.1 564 323.154 0 0 Potri.010G195200.1.v4.1 1773 1526.2 25 1.18493 Potri.012G127500.1.v4.1 977 730.22 5715 566.143 ==> SRR7169554.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1353 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 221 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 18 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169554 completed mapping pipeline successfully