Starting /dee2/code/volunteer_pipeline.sh SRR7169555 current disk space = 3057299632128 free memory = 1474460916 SRR7169555 SRAfilesize 13128b82ed5f78f5811dc48dbfbab4c8 SRR7169555.sra SRR7169555.sra file validated SRR7169555 is paired end SRR7169555 is conventional basespace SRR7169555 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169555_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.52075 34.0 33.0 34.0 32.0 34.0 2 33.19525 34.0 33.0 34.0 32.0 34.0 3 33.19175 34.0 33.0 34.0 31.0 34.0 4 33.32275 34.0 33.0 34.0 33.0 34.0 5 33.22125 34.0 33.0 34.0 33.0 34.0 6 36.68775 38.0 37.0 38.0 34.0 38.0 7 37.03975 38.0 38.0 38.0 36.0 38.0 8 37.19025 38.0 38.0 38.0 36.0 38.0 9 37.2125 38.0 38.0 38.0 37.0 38.0 10-14 37.32885 38.0 38.0 38.0 37.0 38.0 15-19 37.31175 38.0 38.0 38.0 37.0 38.0 20-24 37.24535 38.0 38.0 38.0 36.6 38.0 25-29 37.2116 38.0 38.0 38.0 36.4 38.0 30-34 37.18575 38.0 38.0 38.0 36.2 38.0 35-39 37.042 38.0 38.0 38.0 35.8 38.0 40-44 36.796749999999996 38.0 38.0 38.0 35.0 38.0 45-49 36.5919 38.0 38.0 38.0 34.0 38.0 50-54 36.5474 38.0 38.0 38.0 34.0 38.0 55-59 36.36885 38.0 37.6 38.0 33.8 38.0 60-64 36.27615 38.0 37.4 38.0 33.4 38.0 65-69 36.20215 38.0 37.0 38.0 33.0 38.0 70-74 36.12555 38.0 37.0 38.0 33.0 38.0 75-79 35.883799999999994 38.0 37.0 38.0 31.8 38.0 80-84 35.8732 38.0 37.0 38.0 31.8 38.0 85-89 35.7816 38.0 37.0 38.0 31.0 38.0 90-94 35.54975 38.0 37.0 38.0 30.2 38.0 95-99 35.375750000000004 38.0 36.2 38.0 29.8 38.0 100-104 35.0124 38.0 36.0 38.0 28.6 38.0 105-109 34.80945 38.0 36.0 38.0 27.4 38.0 110-114 34.408300000000004 38.0 35.0 38.0 24.8 38.0 115-119 34.09995000000001 38.0 34.2 38.0 23.8 38.0 120-124 33.8345 38.0 34.0 38.0 21.4 38.0 125-129 33.4372 38.0 34.0 38.0 17.4 38.0 130-134 33.088350000000005 38.0 33.8 38.0 15.0 38.0 135-139 32.66175 38.0 33.0 38.0 14.8 38.0 140-144 31.9567 37.0 32.6 38.0 13.8 38.0 145-149 30.45825 36.0 30.4 38.0 6.4 38.0 150-151 26.69225 34.5 15.0 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 2.0 12 3.0 13 4.0 14 9.0 15 7.0 16 7.0 17 10.0 18 8.0 19 7.0 20 7.0 21 16.0 22 17.0 23 19.0 24 20.0 25 25.0 26 21.0 27 47.0 28 42.0 29 62.0 30 77.0 31 98.0 32 101.0 33 166.0 34 221.0 35 453.0 36 939.0 37 1612.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.68753206772704 12.339661364802462 9.18419702411493 37.78860954335557 2 23.45 13.875000000000002 33.550000000000004 29.125 3 20.849999999999998 18.125 25.575 35.449999999999996 4 22.6 27.224999999999998 22.925 27.250000000000004 5 22.55 32.6 23.875 20.974999999999998 6 20.175 35.025 24.7 20.1 7 15.075 26.974999999999998 41.525 16.425 8 18.175 26.224999999999998 31.424999999999997 24.175 9 16.55 24.7 34.449999999999996 24.3 10-14 19.02 30.025000000000002 27.61 23.345 15-19 19.830000000000002 28.299999999999997 28.49 23.380000000000003 20-24 20.415 29.275000000000002 27.165 23.145 25-29 19.705000000000002 28.825 28.13 23.34 30-34 19.91 28.599999999999998 27.744999999999997 23.745 35-39 20.505000000000003 28.93 27.105 23.46 40-44 19.975 28.705000000000002 27.325 23.995 45-49 19.814999999999998 29.110000000000003 27.134999999999998 23.94 50-54 19.975 29.175 27.16 23.69 55-59 19.765 29.095 27.189999999999998 23.95 60-64 20.119999999999997 29.270000000000003 27.405 23.205000000000002 65-69 20.18 28.92 27.089999999999996 23.810000000000002 70-74 20.015 29.49 26.619999999999997 23.875 75-79 19.84 28.73 27.61 23.82 80-84 19.875 28.925 27.665 23.535 85-89 20.225 28.345 27.925 23.505000000000003 90-94 19.805 28.435 27.36 24.4 95-99 20.04 28.575 27.750000000000004 23.635 100-104 20.159111377964575 28.930251175823074 27.299109376563596 23.611528069648756 105-109 20.135 28.52 27.750000000000004 23.595 110-114 20.80913278590026 28.4197877027839 27.528539955938314 23.24253955537753 115-119 20.29326393754379 28.635772194975477 26.80912821539386 24.261835652086877 120-124 20.584409086360452 28.800160112078455 27.46422495747023 23.151205844090864 125-129 20.233034955243287 28.479271890783618 27.46912036805521 23.818572785917887 130-134 20.830000000000002 28.7 27.189999999999998 23.28 135-139 20.755000000000003 28.585 26.93 23.73 140-144 20.705000000000002 28.57 26.805 23.919999999999998 145-149 21.0 28.64 26.525 23.835 150-151 20.7625 28.8375 26.6125 23.7875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 1.5 18 1.5 19 1.0 20 1.0 21 1.0 22 1.0 23 2.0 24 4.0 25 4.5 26 5.5 27 7.0 28 6.5 29 10.5 30 17.0 31 25.0 32 33.5 33 36.0 34 45.0 35 74.0 36 96.0 37 120.0 38 146.5 39 157.5 40 176.5 41 208.0 42 247.0 43 275.5 44 280.5 45 278.5 46 265.0 47 228.5 48 211.5 49 211.0 50 181.5 51 146.5 52 116.0 53 86.5 54 74.0 55 58.5 56 38.0 57 32.5 58 26.5 59 16.0 60 9.5 61 5.5 62 7.5 63 5.5 64 4.0 65 4.5 66 1.5 67 1.0 68 1.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.55 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.06999999999999999 105-109 0.0 110-114 0.13999999999999999 115-119 0.09 120-124 0.06999999999999999 125-129 0.015 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.07500000000000001 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.38749999999999996 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.6875 0.0 0.0 0.0 0.0 106-107 0.75 0.0 0.0 0.0 0.0 108-109 0.825 0.0 0.0 0.0 0.0 110-111 0.9625 0.0 0.0 0.0 0.0 112-113 1.1375000000000002 0.0 0.0 0.0 0.0 114-115 1.3125 0.0 0.0 0.0 0.0 116-117 1.4375 0.0 0.0 0.0 0.0 118-119 1.575 0.0 0.0 0.0 0.0 120-121 1.8125 0.0 0.0 0.0 0.0 122-123 1.9874999999999998 0.0 0.0 0.0 0.0 124-125 2.15 0.0 0.0 0.0 0.0 126-127 2.3 0.0 0.0 0.0 0.0 128-129 2.5125 0.0 0.0 0.0 0.0 130-131 2.75 0.0 0.0 0.0 0.0 132-133 3.075 0.0 0.0 0.0 0.0 134-135 3.4625000000000004 0.0 0.0 0.0 0.0 136-137 3.8375000000000004 0.0 0.0 0.0 0.0 138-139 4.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATTTAC 10 0.0068874825 144.6 5 TTTACAG 10 0.0068874825 144.6 7 >>END_MODULE SRR7169555 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169555_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.509 33.0 33.0 34.0 32.0 34.0 2 32.7625 33.0 33.0 34.0 32.0 34.0 3 32.81325 34.0 33.0 34.0 32.0 34.0 4 32.69725 34.0 33.0 34.0 32.0 34.0 5 32.754 34.0 33.0 34.0 32.0 34.0 6 36.8695 38.0 38.0 38.0 36.0 38.0 7 36.97925 38.0 38.0 38.0 36.0 38.0 8 36.9495 38.0 38.0 38.0 36.0 38.0 9 36.9835 38.0 38.0 38.0 36.0 38.0 10-14 36.87895 38.0 38.0 38.0 36.0 38.0 15-19 36.8694 38.0 38.0 38.0 36.0 38.0 20-24 36.88205 38.0 38.0 38.0 36.0 38.0 25-29 36.88295 38.0 38.0 38.0 36.0 38.0 30-34 36.7928 38.0 38.0 38.0 36.0 38.0 35-39 36.75695 38.0 38.0 38.0 35.8 38.0 40-44 36.705650000000006 38.0 38.0 38.0 35.4 38.0 45-49 36.624449999999996 38.0 38.0 38.0 35.2 38.0 50-54 36.44085 38.0 38.0 38.0 34.6 38.0 55-59 36.074 38.0 38.0 38.0 34.0 38.0 60-64 35.838550000000005 38.0 38.0 38.0 33.4 38.0 65-69 35.790000000000006 38.0 38.0 38.0 33.4 38.0 70-74 35.56255 38.0 38.0 38.0 32.4 38.0 75-79 35.4509 38.0 38.0 38.0 31.0 38.0 80-84 35.537150000000004 38.0 38.0 38.0 30.8 38.0 85-89 35.56555 38.0 38.0 38.0 31.2 38.0 90-94 35.4458 38.0 38.0 38.0 30.6 38.0 95-99 35.3515 38.0 37.4 38.0 30.2 38.0 100-104 35.20890000000001 38.0 37.0 38.0 28.8 38.0 105-109 34.929700000000004 38.0 37.0 38.0 27.8 38.0 110-114 34.869 38.0 37.0 38.0 27.2 38.0 115-119 34.7173 38.0 36.6 38.0 26.6 38.0 120-124 34.354949999999995 38.0 36.0 38.0 23.6 38.0 125-129 34.15935 38.0 35.6 38.0 23.0 38.0 130-134 33.847300000000004 38.0 35.0 38.0 20.2 38.0 135-139 33.29765 38.0 35.0 38.0 14.8 38.0 140-144 32.71365 38.0 34.2 38.0 13.6 38.0 145-149 31.50625 38.0 32.8 38.0 4.2 38.0 150-151 27.710375 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 3.0 4 0.0 5 3.0 6 2.0 7 1.0 8 0.0 9 2.0 10 2.0 11 8.0 12 9.0 13 17.0 14 32.0 15 8.0 16 4.0 17 6.0 18 9.0 19 5.0 20 12.0 21 19.0 22 14.0 23 12.0 24 19.0 25 34.0 26 34.0 27 35.0 28 57.0 29 61.0 30 51.0 31 70.0 32 78.0 33 124.0 34 145.0 35 239.0 36 497.0 37 2379.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.001257229067136 23.510183555443803 14.759869248177019 26.728689967312043 2 29.375 25.8 27.85 16.975 3 19.400000000000002 29.525000000000002 30.599999999999998 20.474999999999998 4 22.025 34.599999999999994 24.75 18.625 5 25.45 35.85 21.575 17.125 6 21.3 38.7 22.45 17.549999999999997 7 19.725 21.775 38.65 19.85 8 21.625 25.6 27.625 25.15 9 20.775 24.975 30.599999999999998 23.65 10-14 22.97114855742787 28.831441572078603 26.651332566628334 21.546077303865193 15-19 23.385 28.345 27.224999999999998 21.044999999999998 20-24 22.84 27.955000000000002 28.15 21.055 25-29 23.189999999999998 28.04 28.02 20.75 30-34 23.135 27.834999999999997 27.98 21.05 35-39 22.84 28.82 27.584999999999997 20.755000000000003 40-44 23.72 28.335 27.439999999999998 20.505000000000003 45-49 23.225 28.449999999999996 28.025 20.3 50-54 23.216797267430177 27.94856339160137 27.75266224633313 21.081977094635324 55-59 23.8452188006483 27.051256077795788 28.074351701782817 21.029173419773095 60-64 22.520366598778004 28.421588594704684 27.932790224032587 21.125254582484725 65-69 23.242027800490597 28.316639411283727 27.989574816026163 20.45175797219951 70-74 23.651069929353945 27.07074843861984 28.340329681580833 20.937851950445378 75-79 23.630031752535082 28.116357676943558 27.952473624910372 20.30113694561098 80-84 23.577939603809135 28.390283648215103 28.01853643631919 20.013240311656567 85-89 23.380052813325207 28.02660979077798 27.798090595165547 20.795246800731263 90-94 24.108409321175277 27.487335359675786 28.267477203647417 20.13677811550152 95-99 23.753161355589278 28.077895801719777 28.06272129489125 20.106221547799695 100-104 24.356835986858734 27.268132423553197 28.086934546373516 20.288097043214556 105-109 23.956965350035357 27.87150217193656 27.81594100414183 20.35559147388625 110-114 23.758632857790996 27.65035035539648 27.947774361042498 20.643242425770026 115-119 23.960695389266817 28.50592088687327 27.573696145124714 19.959687578735196 120-124 23.65959159038326 28.25671461623579 27.914696710592494 20.16899708278845 125-129 24.14472686846228 28.237909949972206 27.84375157916014 19.773611602405378 130-134 25.12677484787018 27.47971602434077 27.647058823529413 19.746450304259636 135-139 24.49872773536896 27.638676844783717 27.445292620865143 20.41730279898219 140-144 24.359431511385054 28.465182619326573 27.25790841016759 19.91747745912078 145-149 25.464503250243126 27.885550493934584 27.276449813175002 19.373496442647284 150-151 25.215489514987777 26.399073716711698 27.981474334233887 20.403962434066642 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 1.5 17 2.5 18 2.0 19 4.5 20 5.5 21 4.5 22 7.0 23 7.0 24 7.0 25 7.5 26 5.5 27 6.0 28 8.5 29 11.0 30 11.0 31 15.0 32 19.5 33 32.0 34 45.5 35 57.0 36 81.5 37 119.5 38 138.5 39 155.5 40 206.0 41 252.0 42 264.5 43 275.5 44 286.0 45 278.0 46 274.5 47 257.0 48 233.5 49 195.5 50 155.5 51 134.0 52 108.5 53 85.0 54 66.5 55 42.0 56 31.5 57 30.0 58 19.5 59 14.0 60 10.0 61 6.0 62 4.0 63 4.0 64 3.5 65 2.5 66 1.5 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.45999999999999996 55-59 1.28 60-64 1.7999999999999998 65-69 2.16 70-74 2.33 75-79 2.37 80-84 1.815 85-89 1.54 90-94 1.3 95-99 1.15 100-104 1.075 105-109 1.01 110-114 0.815 115-119 0.775 120-124 0.59 125-129 1.055 130-134 1.4000000000000001 135-139 1.7500000000000002 140-144 1.8450000000000002 145-149 2.315 150-151 2.8375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.07500000000000001 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.36250000000000004 0.0 0.0 0.0 0.0 98-99 0.44999999999999996 0.0 0.0 0.0 0.0 100-101 0.475 0.0 0.0 0.0 0.0 102-103 0.55 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.75 0.0 0.0 0.0 0.0 108-109 0.8375 0.0 0.0 0.0 0.0 110-111 0.9874999999999999 0.0 0.0 0.0 0.0 112-113 1.1625 0.0 0.0 0.0 0.0 114-115 1.3125 0.0 0.0 0.0 0.0 116-117 1.4375 0.0 0.0 0.0 0.0 118-119 1.575 0.0 0.0 0.0 0.0 120-121 1.7875 0.0 0.0 0.0 0.0 122-123 1.9874999999999998 0.0 0.0 0.0 0.0 124-125 2.15 0.0 0.0 0.0 0.0 126-127 2.3 0.0 0.0 0.0 0.0 128-129 2.525 0.0 0.0 0.0 0.0 130-131 2.8125 0.0 0.0 0.0 0.0 132-133 3.175 0.0 0.0 0.0 0.0 134-135 3.525 0.0 0.0 0.0 0.0 136-137 3.9124999999999996 0.0 0.0 0.0 0.0 138-139 4.262499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTTAG 10 0.0066661066 146.14102 1 TTTTAGA 10 0.0071973195 142.4875 2 AGAGAGT 10 0.0071973195 142.4875 7 ATTCCGA 10 0.0071973195 142.4875 6 >>END_MODULE Read 776337 spots for SRR7169555.sra Written 776337 spots for SRR7169555.sra Read 776337 spots for SRR7169555.sra Written 776337 spots for SRR7169555.sra Read 776337 spots for SRR7169555.sra Written 776337 spots for SRR7169555.sra Read 776337 spots for SRR7169555.sra Written 776337 spots for SRR7169555.sra Read 776337 spots for SRR7169555.sra Written 776337 spots for SRR7169555.sra Read 776337 spots for SRR7169555.sra Written 776337 spots for SRR7169555.sra Read 776337 spots for SRR7169555.sra Written 776337 spots for SRR7169555.sra Read 776337 spots for SRR7169555.sra Written 776337 spots for SRR7169555.sra Read 776337 spots for SRR7169555.sra Written 776337 spots for SRR7169555.sra Read 776337 spots for SRR7169555.sra Written 776337 spots for SRR7169555.sra Read 776337 spots for SRR7169555.sra Written 776337 spots for SRR7169555.sra Read 776337 spots for SRR7169555.sra Written 776337 spots for SRR7169555.sra Read 776337 spots for SRR7169555.sra Written 776337 spots for SRR7169555.sra Read 776337 spots for SRR7169555.sra Written 776337 spots for SRR7169555.sra Read 776337 spots for SRR7169555.sra Written 776337 spots for SRR7169555.sra Read 776337 spots for SRR7169555.sra Written 776337 spots for SRR7169555.sra Read 776353 spots for SRR7169555.sra Written 776353 spots for SRR7169555.sra Read 776337 spots for SRR7169555.sra Written 776337 spots for SRR7169555.sra Read 776337 spots for SRR7169555.sra Written 776337 spots for SRR7169555.sra Read 776337 spots for SRR7169555.sra Written 776337 spots for SRR7169555.sra SRR ids: ['SRR7169555.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_z2e3agui SRR7169555.sra spots: 15526756 blocks: [[1, 776337], [776338, 1552674], [1552675, 2329011], [2329012, 3105348], [3105349, 3881685], [3881686, 4658022], [4658023, 5434359], [5434360, 6210696], [6210697, 6987033], [6987034, 7763370], [7763371, 8539707], [8539708, 9316044], [9316045, 10092381], [10092382, 10868718], [10868719, 11645055], [11645056, 12421392], [12421393, 13197729], [13197730, 13974066], [13974067, 14750403], [14750404, 15526756]] SRR7169555 file size 5239807 SRR7169555 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169555 SRR7169555_1.fastq SRR7169555_2.fastq Input file: SRR7169555_1.fastq Paired file: SRR7169555_2.fastq trimmed: SRR7169555-trimmed-pair1.fastq, SRR7169555-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 00:31:46 2025 >> started Tue Feb 11 00:32:06 2025 >> done (19.790s) 15526756 read pairs processed; of these: 17069 ( 0.11%) short read pairs filtered out after trimming by size control 18145 ( 0.12%) empty read pairs filtered out after trimming by size control 15491542 (99.77%) read pairs available; of these: 8126737 (52.46%) trimmed read pairs available after processing 7364805 (47.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 6 0.00% 20 2 0.00% 21 2 0.00% 22 6 0.00% 23 8 0.00% 24 10 0.00% 25 3 0.00% 26 4 0.00% 27 8 0.00% 28 8 0.00% 29 11 0.00% 30 19 0.00% 31 9 0.00% 32 15 0.00% 33 7 0.00% 34 14 0.00% 35 21 0.00% 36 18 0.00% 37 18 0.00% 38 19 0.00% 39 26 0.00% 40 19 0.00% 41 26 0.00% 42 32 0.00% 43 54 0.00% 44 48 0.00% 45 62 0.00% 46 41 0.00% 47 66 0.00% 48 66 0.00% 49 66 0.00% 50 77 0.00% 51 103 0.00% 52 86 0.00% 53 102 0.00% 54 127 0.00% 55 139 0.00% 56 146 0.00% 57 157 0.00% 58 182 0.00% 59 199 0.00% 60 221 0.00% 61 276 0.00% 62 331 0.00% 63 362 0.00% 64 355 0.00% 65 426 0.00% 66 502 0.00% 67 539 0.00% 68 598 0.00% 69 794 0.01% 70 871 0.01% 71 906 0.01% 72 1044 0.01% 73 1202 0.01% 74 1453 0.01% 75 1865 0.01% 76 1552 0.01% 77 1333 0.01% 78 1644 0.01% 79 2893 0.02% 80 4694 0.03% 81 1923 0.01% 82 2257 0.01% 83 2546 0.02% 84 3386 0.02% 85 3863 0.02% 86 4403 0.03% 87 4661 0.03% 88 4857 0.03% 89 5109 0.03% 90 5444 0.04% 91 5988 0.04% 92 6451 0.04% 93 6931 0.04% 94 7695 0.05% 95 8369 0.05% 96 8962 0.06% 97 9959 0.06% 98 11462 0.07% 99 15433 0.10% 100 18162 0.12% 101 13419 0.09% 102 11674 0.08% 103 11764 0.08% 104 12788 0.08% 105 13369 0.09% 106 14150 0.09% 107 14847 0.10% 108 15537 0.10% 109 16060 0.10% 110 16926 0.11% 111 17846 0.12% 112 18821 0.12% 113 20200 0.13% 114 21405 0.14% 115 22669 0.15% 116 23792 0.15% 117 24632 0.16% 118 25738 0.17% 119 26586 0.17% 120 27991 0.18% 121 28951 0.19% 122 30837 0.20% 123 32589 0.21% 124 33992 0.22% 125 35997 0.23% 126 38013 0.25% 127 40344 0.26% 128 42186 0.27% 129 44410 0.29% 130 47027 0.30% 131 48721 0.31% 132 52458 0.34% 133 56348 0.36% 134 59494 0.38% 135 65082 0.42% 136 69569 0.45% 137 75481 0.49% 138 83006 0.54% 139 90905 0.59% 140 99941 0.65% 141 109545 0.71% 142 123706 0.80% 143 139092 0.90% 144 164634 1.06% 145 200280 1.29% 146 250351 1.62% 147 342573 2.21% 148 515660 3.33% 149 957647 6.18% 150 3713926 23.97% 151 7364805 47.54% 15491542 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.78 fanout-score-rank=38 prefix-density=0.20 prefix-fanout=2.5 sequence=CTGGCCATTCAATGTGACATCCTCTTGAGTGGCTTTCAAAAGCCTGATAAAAACGCTGAACTGACCACCTTTTTCTAGGACTTTGGTGACATTGGTTGGACC criterion=fanout-score sequence-density=0.10 sequence-density-rank=23 fanout-score=239.47 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=27.7 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.66 fanout-score-rank=35 prefix-density=0.33 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=24 fanout-score=206.55 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=24.0 sequence=GAAGAAGAAGAAA SRR7169555 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 00:32:57 Started mapping on | Feb 11 00:32:57 Finished on | Feb 11 00:34:41 Mapping speed, Million of reads per hour | 536.25 Number of input reads | 15491542 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 14759046 Uniquely mapped reads % | 95.27% Average mapped length | 293.87 Number of splices: Total | 13775607 Number of splices: Annotated (sjdb) | 13520602 Number of splices: GT/AG | 13567495 Number of splices: GC/AG | 162966 Number of splices: AT/AC | 11818 Number of splices: Non-canonical | 33328 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 270977 % of reads mapped to multiple loci | 1.75% Number of reads mapped to too many loci | 14479 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.85% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 477762 477762 477762 N_multimapping 270977 270977 270977 N_noFeature 398898 14579623 486053 N_ambiguous 157035 1220 63804 UnstrandedReadsAssigned:14203113 PositiveStrandReadsAssigned:178203 NegativeStrandReadsAssigned:14209189 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169555 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169555-trimmed-pair1.fastq SRR7169555-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,491,542 reads, 14,118,841 reads pseudoaligned [quant] estimated average fragment length: 257.834 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,162 rounds 52401 SRR7169555.ke.tsv 34699 SRR7169555.se.tsv 87100 total ==> SRR7169555.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1761.17 333 13.2922 Potri.005G024800.1.v4.1 1035 778.166 26 2.34885 Potri.004G059700.1.v4.1 961 704.227 2 0.199651 Potri.007G009000.2.v4.1 1416 1159.17 0 0 Potri.003G141000.2.v4.1 2943 2686.17 246.032 6.43891 Potri.016G087400.1.v4.1 270 73.7045 1347 1284.78 Potri.015G069301.1.v4.1 564 313.809 0 0 Potri.010G195200.1.v4.1 1773 1516.17 69 3.19931 Potri.012G127500.1.v4.1 977 720.197 5908 576.691 ==> SRR7169555.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1606 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 272 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169555 completed mapping pipeline successfully