Starting /dee2/code/volunteer_pipeline.sh SRR7169556 current disk space = 3057208459264 free memory = 1467004436 SRR7169556 SRAfilesize bd08cd604347a72f86960cbc02c5e5a9 SRR7169556.sra SRR7169556.sra file validated SRR7169556 is paired end SRR7169556 is conventional basespace SRR7169556 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169556_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.30675 34.0 33.0 34.0 32.0 34.0 2 33.2155 34.0 33.0 34.0 32.0 34.0 3 33.17675 34.0 33.0 34.0 31.0 34.0 4 33.298 34.0 33.0 34.0 33.0 34.0 5 33.2055 34.0 33.0 34.0 32.0 34.0 6 36.64425 38.0 37.0 38.0 34.0 38.0 7 36.95675 38.0 38.0 38.0 36.0 38.0 8 37.173 38.0 38.0 38.0 36.0 38.0 9 37.22375 38.0 38.0 38.0 37.0 38.0 10-14 37.30499999999999 38.0 38.0 38.0 37.0 38.0 15-19 37.27445 38.0 38.0 38.0 36.6 38.0 20-24 37.25515 38.0 38.0 38.0 37.0 38.0 25-29 37.25359999999999 38.0 38.0 38.0 36.6 38.0 30-34 37.14225 38.0 38.0 38.0 36.2 38.0 35-39 37.09415 38.0 38.0 38.0 36.0 38.0 40-44 36.85015 38.0 38.0 38.0 35.0 38.0 45-49 36.6422 38.0 38.0 38.0 34.2 38.0 50-54 36.57665 38.0 38.0 38.0 34.0 38.0 55-59 36.42675 38.0 37.8 38.0 34.0 38.0 60-64 36.3166 38.0 37.4 38.0 33.4 38.0 65-69 36.293549999999996 38.0 37.0 38.0 33.4 38.0 70-74 36.18345 38.0 37.0 38.0 33.0 38.0 75-79 35.9985 38.0 37.0 38.0 32.2 38.0 80-84 35.9643 38.0 37.0 38.0 32.4 38.0 85-89 35.766149999999996 38.0 37.0 38.0 30.6 38.0 90-94 35.58194999999999 38.0 36.2 38.0 29.8 38.0 95-99 35.41435 38.0 36.0 38.0 29.0 38.0 100-104 35.0105 38.0 36.0 38.0 28.2 38.0 105-109 34.8189 38.0 35.0 38.0 27.4 38.0 110-114 34.424600000000005 38.0 35.0 38.0 24.4 38.0 115-119 34.12135 38.0 34.2 38.0 23.6 38.0 120-124 33.84335 38.0 34.0 38.0 21.4 38.0 125-129 33.399899999999995 38.0 34.0 38.0 17.4 38.0 130-134 33.06355 38.0 33.4 38.0 15.0 38.0 135-139 32.58985 37.6 33.0 38.0 14.8 38.0 140-144 32.08514999999999 37.2 32.6 38.0 14.2 38.0 145-149 30.688800000000004 36.0 31.0 38.0 8.6 38.0 150-151 26.69875 34.5 15.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 2.0 11 3.0 12 2.0 13 1.0 14 2.0 15 3.0 16 6.0 17 7.0 18 8.0 19 13.0 20 10.0 21 13.0 22 11.0 23 24.0 24 11.0 25 27.0 26 24.0 27 41.0 28 63.0 29 57.0 30 74.0 31 95.0 32 95.0 33 189.0 34 253.0 35 425.0 36 973.0 37 1567.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.70157338148053 12.664431261284498 10.16249677585762 36.471498581377354 2 23.474999999999998 15.174999999999999 32.574999999999996 28.775000000000002 3 18.775 19.425 26.650000000000002 35.15 4 23.200000000000003 28.325 22.975 25.5 5 23.200000000000003 32.225 24.125 20.45 6 19.45 34.0 25.624999999999996 20.925 7 15.15 24.875 41.199999999999996 18.775 8 18.075 26.8 30.4 24.725 9 17.625 25.5 32.95 23.925 10-14 20.31 30.345 26.27 23.075000000000003 15-19 20.0 28.925 26.825 24.25 20-24 19.68 28.725 27.779999999999998 23.815 25-29 19.785 28.945 27.16 24.11 30-34 20.48 28.375 27.61 23.535 35-39 20.73 28.155 27.22 23.895 40-44 20.24 28.26 27.994999999999997 23.505000000000003 45-49 20.599999999999998 28.365000000000002 27.255000000000003 23.78 50-54 20.135 28.58 27.189999999999998 24.095 55-59 21.015 28.205000000000002 27.515 23.265 60-64 20.96 28.615000000000002 26.884999999999998 23.54 65-69 20.16 28.67 27.13 24.04 70-74 20.415 28.18 27.555000000000003 23.849999999999998 75-79 20.805 28.244999999999997 27.445000000000004 23.505000000000003 80-84 20.285 28.285 27.310000000000002 24.12 85-89 20.4 28.610000000000003 27.555000000000003 23.435 90-94 19.825 28.705000000000002 27.339999999999996 24.13 95-99 20.495 28.03 27.37 24.104999999999997 100-104 20.663431230299693 28.22834842647721 26.827437834592484 24.28078250863061 105-109 20.73 28.16 27.33 23.78 110-114 20.94012815378454 28.083700440528638 27.49799759711654 23.478173808570286 115-119 21.373167192113296 28.178952109292897 27.438322574188064 23.009558124405746 120-124 20.88962273591514 27.619333533473434 27.77444210947663 23.716601621134796 125-129 20.96104805240262 27.83639181959098 27.2163608180409 23.986199309965496 130-134 20.685000000000002 28.03 27.33 23.955000000000002 135-139 20.985 28.449999999999996 26.974999999999998 23.59 140-144 21.285 28.044999999999998 27.04 23.630000000000003 145-149 21.099999999999998 28.794999999999998 26.669999999999998 23.435 150-151 21.3625 28.999999999999996 25.95 23.6875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 1.0 21 1.0 22 0.5 23 1.5 24 2.0 25 2.5 26 3.5 27 2.0 28 3.0 29 9.0 30 14.5 31 16.5 32 30.5 33 43.0 34 50.0 35 68.0 36 82.5 37 96.0 38 126.0 39 154.0 40 178.5 41 213.0 42 230.5 43 243.5 44 263.5 45 274.5 46 286.5 47 278.0 48 239.5 49 211.0 50 183.5 51 157.5 52 130.0 53 98.0 54 77.0 55 57.0 56 41.5 57 32.0 58 24.0 59 19.0 60 15.0 61 10.0 62 7.0 63 4.0 64 2.5 65 4.0 66 2.5 67 1.5 68 2.0 69 1.5 70 1.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.065 105-109 0.0 110-114 0.12 115-119 0.08499999999999999 120-124 0.06999999999999999 125-129 0.005 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67377666248431 99.3 2 0.301129234629862 0.6 3 0.0 0.0 4 0.02509410288582183 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.425 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.525 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.725 0.0 0.0 0.0 0.0 108-109 0.8125 0.0 0.0 0.0 0.0 110-111 0.9624999999999999 0.0 0.0 0.0 0.0 112-113 1.0875 0.0 0.0 0.0 0.0 114-115 1.225 0.0 0.0 0.0 0.0 116-117 1.3875 0.0 0.0 0.0 0.0 118-119 1.625 0.0 0.0 0.0 0.0 120-121 1.7999999999999998 0.0 0.0 0.0 0.0 122-123 2.0875 0.0 0.0 0.0 0.0 124-125 2.2625 0.0 0.0 0.0 0.0 126-127 2.4875 0.0 0.0 0.0 0.0 128-129 2.7125 0.0 0.0 0.0 0.0 130-131 2.9124999999999996 0.0 0.0 0.0 0.0 132-133 3.1875 0.0 0.0 0.0 0.0 134-135 3.5625 0.0 0.0 0.0 0.0 136-137 3.8875 0.0 0.0 0.0 0.0 138-139 4.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATTCT 10 0.006836113 144.9625 3 >>END_MODULE SRR7169556 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169556_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.35875 33.0 33.0 34.0 31.0 34.0 2 32.71575 33.0 33.0 34.0 32.0 34.0 3 32.7075 33.0 33.0 34.0 32.0 34.0 4 32.6465 33.0 33.0 34.0 32.0 34.0 5 32.6995 33.0 33.0 34.0 32.0 34.0 6 36.866 38.0 38.0 38.0 36.0 38.0 7 36.90975 38.0 38.0 38.0 36.0 38.0 8 36.7345 38.0 38.0 38.0 36.0 38.0 9 36.8125 38.0 38.0 38.0 36.0 38.0 10-14 36.73195 38.0 38.0 38.0 35.4 38.0 15-19 36.7197 38.0 38.0 38.0 35.8 38.0 20-24 36.75295 38.0 38.0 38.0 35.4 38.0 25-29 36.7408 38.0 38.0 38.0 35.6 38.0 30-34 36.6168 38.0 38.0 38.0 35.0 38.0 35-39 36.57785 38.0 38.0 38.0 34.6 38.0 40-44 36.509550000000004 38.0 38.0 38.0 34.6 38.0 45-49 36.486450000000005 38.0 38.0 38.0 34.4 38.0 50-54 36.28215 38.0 38.0 38.0 34.2 38.0 55-59 35.924099999999996 38.0 38.0 38.0 33.4 38.0 60-64 35.56635 38.0 38.0 38.0 32.6 38.0 65-69 35.354 38.0 38.0 38.0 30.6 38.0 70-74 35.216750000000005 38.0 38.0 38.0 29.4 38.0 75-79 35.179249999999996 38.0 38.0 38.0 29.0 38.0 80-84 35.26115 38.0 37.4 38.0 29.8 38.0 85-89 35.2735 38.0 37.4 38.0 29.0 38.0 90-94 35.24025 38.0 37.0 38.0 29.0 38.0 95-99 35.13755 38.0 37.0 38.0 29.2 38.0 100-104 34.9695 38.0 37.0 38.0 28.2 38.0 105-109 34.697950000000006 38.0 36.4 38.0 26.6 38.0 110-114 34.64085 38.0 36.4 38.0 26.4 38.0 115-119 34.49980000000001 38.0 36.0 38.0 25.4 38.0 120-124 34.2746 38.0 36.0 38.0 23.4 38.0 125-129 33.9608 38.0 35.0 38.0 21.0 38.0 130-134 33.53145 38.0 35.0 38.0 17.2 38.0 135-139 32.8495 38.0 34.0 38.0 14.0 38.0 140-144 32.35445 38.0 34.0 38.0 13.4 38.0 145-149 31.2688 38.0 32.4 38.0 2.0 38.0 150-151 27.679125 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 5.0 4 0.0 5 4.0 6 2.0 7 3.0 8 3.0 9 2.0 10 4.0 11 4.0 12 11.0 13 23.0 14 26.0 15 2.0 16 2.0 17 13.0 18 14.0 19 9.0 20 12.0 21 18.0 22 18.0 23 21.0 24 25.0 25 30.0 26 44.0 27 44.0 28 50.0 29 66.0 30 61.0 31 64.0 32 86.0 33 115.0 34 149.0 35 243.0 36 539.0 37 2280.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.11625566180171 21.389028686462 14.44388525415199 27.050830397584296 2 28.425 26.35 28.999999999999996 16.225 3 19.900000000000002 30.0 31.2 18.9 4 22.975 35.125 23.65 18.25 5 25.35 34.175 22.6 17.875 6 21.099999999999998 35.949999999999996 23.1 19.85 7 19.8 21.575 39.25 19.375 8 22.625 26.200000000000003 27.0 24.175 9 22.400000000000002 24.325 30.025000000000002 23.25 10-14 23.49352402860429 28.71430714607191 26.178926839025852 21.613241986297947 15-19 23.465 27.965 27.495000000000005 21.075 20-24 22.99 27.765 27.775 21.47 25-29 22.81 28.535 27.229999999999997 21.425 30-34 23.205000000000002 27.175 28.255000000000003 21.365000000000002 35-39 23.35 27.625 27.62 21.404999999999998 40-44 23.24 27.97 27.815 20.974999999999998 45-49 23.41 27.12 28.255000000000003 21.215 50-54 23.14959047284056 27.536304708306115 28.199587960404 21.114516858449324 55-59 24.32309096440523 27.852144812899297 27.31974444782476 20.505019774870703 60-64 22.89107289107289 28.296478296478295 27.917690417690416 20.894758394758394 65-69 23.7216712061257 26.578960892132176 28.480394675985405 21.218973225756717 70-74 23.40589779218774 27.502444547372757 27.914157789099892 21.177499871339613 75-79 23.66903511481825 27.855009782720625 27.468849758006385 21.007105344454743 80-84 23.72959418658206 27.3680978455555 28.504170717977583 20.398137249884858 85-89 24.346496815286624 27.561783439490444 27.796178343949045 20.295541401273887 90-94 24.11099274590372 27.606148227058284 27.545274691827725 20.73758433521027 95-99 23.691139240506327 28.20253164556962 27.625316455696204 20.481012658227847 100-104 24.209621123981993 27.538064646669024 27.608882593960242 20.64343163538874 105-109 23.982815264088956 27.161991407632048 27.601718473591102 21.253474854687894 110-114 23.55997175426208 27.66569151619086 27.917885604761423 20.856451124785636 115-119 24.16175061765744 28.30131598850401 27.066001109262338 20.47093228457621 120-124 24.622584541062803 27.65197262479871 27.04307568438003 20.682367149758456 125-129 24.44129841237739 28.597431489533825 26.509252705025787 20.452017393063 130-134 24.383923581118847 28.042274274681166 27.07179513236116 20.50200701183883 135-139 24.33123625390006 27.56892230576441 27.46151092015754 20.638330520178 140-144 24.648067571026363 27.919119529050423 26.82364985922703 20.609163040696185 145-149 24.95111659977359 28.316352783781003 27.271791705258824 19.46073891118658 150-151 24.902975420439844 27.697283311772313 27.89133247089263 19.508408796895214 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 2.0 18 1.5 19 2.5 20 2.5 21 3.0 22 4.0 23 7.0 24 10.0 25 8.5 26 9.0 27 9.0 28 9.0 29 13.0 30 14.5 31 17.5 32 22.0 33 28.5 34 37.0 35 54.0 36 73.0 37 94.0 38 123.5 39 151.0 40 184.0 41 215.0 42 246.5 43 268.0 44 280.0 45 291.5 46 286.0 47 274.0 48 254.5 49 218.5 50 180.5 51 146.0 52 110.5 53 98.0 54 78.0 55 47.5 56 37.0 57 24.0 58 16.5 59 11.5 60 7.5 61 6.5 62 4.5 63 4.0 64 3.0 65 2.0 66 3.0 67 3.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.65 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.015 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.49500000000000005 55-59 1.39 60-64 2.32 65-69 2.705 70-74 2.8449999999999998 75-79 2.8899999999999997 80-84 2.2950000000000004 85-89 1.875 90-94 1.435 95-99 1.25 100-104 1.155 105-109 1.075 110-114 0.8699999999999999 115-119 0.835 120-124 0.64 125-129 1.11 130-134 1.595 135-139 2.245 140-144 2.325 145-149 2.83 150-151 3.375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.425 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.5375 0.0 0.0 0.0 0.0 102-103 0.5874999999999999 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.725 0.0 0.0 0.0 0.0 108-109 0.8125 0.0 0.0 0.0 0.0 110-111 0.9624999999999999 0.0 0.0 0.0 0.0 112-113 1.0875 0.0 0.0 0.0 0.0 114-115 1.225 0.0 0.0 0.0 0.0 116-117 1.4125 0.0 0.0 0.0 0.0 118-119 1.6 0.0 0.0 0.0 0.0 120-121 1.775 0.0 0.0 0.0 0.0 122-123 2.0625 0.0 0.0 0.0 0.0 124-125 2.2625 0.0 0.0 0.0 0.0 126-127 2.4875 0.0 0.0 0.0 0.0 128-129 2.675 0.0 0.0 0.0 0.0 130-131 2.85 0.0 0.0 0.0 0.0 132-133 3.1125 0.0 0.0 0.0 0.0 134-135 3.4375 0.0 0.0 0.0 0.0 136-137 3.725 0.0 0.0 0.0 0.0 138-139 4.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAGAGA 10 0.0070833815 143.25 6 TACAGGA 10 0.0070833815 143.25 7 AAGACCT 10 0.0070833815 143.25 3 AGACCTA 10 0.0070833815 143.25 4 CAGGAAA 10 0.0070833815 143.25 9 >>END_MODULE Read 924956 spots for SRR7169556.sra Written 924956 spots for SRR7169556.sra Read 924956 spots for SRR7169556.sra Written 924956 spots for SRR7169556.sra Read 924956 spots for SRR7169556.sra Written 924956 spots for SRR7169556.sra Read 924956 spots for SRR7169556.sra Written 924956 spots for SRR7169556.sra Read 924956 spots for SRR7169556.sra Written 924956 spots for SRR7169556.sra Read 924956 spots for SRR7169556.sra Written 924956 spots for SRR7169556.sra Read 924956 spots for SRR7169556.sra Written 924956 spots for SRR7169556.sra Read 924956 spots for SRR7169556.sra Written 924956 spots for SRR7169556.sra Read 924956 spots for SRR7169556.sra Written 924956 spots for SRR7169556.sra Read 924956 spots for SRR7169556.sra Written 924956 spots for SRR7169556.sra Read 924956 spots for SRR7169556.sra Written 924956 spots for SRR7169556.sra Read 924956 spots for SRR7169556.sra Written 924956 spots for SRR7169556.sra Read 924956 spots for SRR7169556.sra Written 924956 spots for SRR7169556.sra Read 924956 spots for SRR7169556.sra Written 924956 spots for SRR7169556.sra Read 924962 spots for SRR7169556.sra Written 924962 spots for SRR7169556.sra Read 924956 spots for SRR7169556.sra Written 924956 spots for SRR7169556.sra Read 924956 spots for SRR7169556.sra Written 924956 spots for SRR7169556.sra Read 924956 spots for SRR7169556.sra Written 924956 spots for SRR7169556.sra Read 924956 spots for SRR7169556.sra Written 924956 spots for SRR7169556.sra Read 924956 spots for SRR7169556.sra Written 924956 spots for SRR7169556.sra SRR ids: ['SRR7169556.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rq1c3gb3 SRR7169556.sra spots: 18499126 blocks: [[1, 924956], [924957, 1849912], [1849913, 2774868], [2774869, 3699824], [3699825, 4624780], [4624781, 5549736], [5549737, 6474692], [6474693, 7399648], [7399649, 8324604], [8324605, 9249560], [9249561, 10174516], [10174517, 11099472], [11099473, 12024428], [12024429, 12949384], [12949385, 13874340], [13874341, 14799296], [14799297, 15724252], [15724253, 16649208], [16649209, 17574164], [17574165, 18499126]] SRR7169556 file size 6247046 SRR7169556 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169556 SRR7169556_1.fastq SRR7169556_2.fastq Input file: SRR7169556_1.fastq Paired file: SRR7169556_2.fastq trimmed: SRR7169556-trimmed-pair1.fastq, SRR7169556-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 00:39:29 2025 >> started Tue Feb 11 00:39:50 2025 >> done (20.911s) 18499126 read pairs processed; of these: 20839 ( 0.11%) short read pairs filtered out after trimming by size control 16725 ( 0.09%) empty read pairs filtered out after trimming by size control 18461562 (99.80%) read pairs available; of these: 9865551 (53.44%) trimmed read pairs available after processing 8596011 (46.56%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 8 0.00% 20 2 0.00% 21 3 0.00% 22 6 0.00% 23 5 0.00% 24 6 0.00% 25 3 0.00% 26 8 0.00% 27 16 0.00% 28 8 0.00% 29 7 0.00% 30 17 0.00% 31 7 0.00% 32 15 0.00% 33 13 0.00% 34 21 0.00% 35 25 0.00% 36 22 0.00% 37 33 0.00% 38 27 0.00% 39 32 0.00% 40 32 0.00% 41 43 0.00% 42 32 0.00% 43 52 0.00% 44 55 0.00% 45 63 0.00% 46 63 0.00% 47 71 0.00% 48 74 0.00% 49 82 0.00% 50 96 0.00% 51 128 0.00% 52 123 0.00% 53 173 0.00% 54 170 0.00% 55 154 0.00% 56 161 0.00% 57 207 0.00% 58 208 0.00% 59 289 0.00% 60 298 0.00% 61 353 0.00% 62 369 0.00% 63 406 0.00% 64 456 0.00% 65 491 0.00% 66 604 0.00% 67 669 0.00% 68 817 0.00% 69 1073 0.01% 70 1101 0.01% 71 1171 0.01% 72 1360 0.01% 73 1480 0.01% 74 1741 0.01% 75 2253 0.01% 76 1925 0.01% 77 1518 0.01% 78 2114 0.01% 79 3443 0.02% 80 5610 0.03% 81 2491 0.01% 82 2710 0.01% 83 3145 0.02% 84 4059 0.02% 85 5039 0.03% 86 5344 0.03% 87 5730 0.03% 88 5872 0.03% 89 6119 0.03% 90 6656 0.04% 91 7390 0.04% 92 7917 0.04% 93 8785 0.05% 94 9514 0.05% 95 10364 0.06% 96 11230 0.06% 97 12601 0.07% 98 14467 0.08% 99 18617 0.10% 100 22105 0.12% 101 16285 0.09% 102 14819 0.08% 103 15119 0.08% 104 16308 0.09% 105 17071 0.09% 106 17967 0.10% 107 18439 0.10% 108 19368 0.10% 109 20122 0.11% 110 21126 0.11% 111 22544 0.12% 112 24240 0.13% 113 25514 0.14% 114 27387 0.15% 115 28573 0.15% 116 29837 0.16% 117 31234 0.17% 118 32632 0.18% 119 33211 0.18% 120 34896 0.19% 121 36231 0.20% 122 38303 0.21% 123 40853 0.22% 124 43442 0.24% 125 45957 0.25% 126 48284 0.26% 127 50316 0.27% 128 52506 0.28% 129 55214 0.30% 130 58525 0.32% 131 61106 0.33% 132 65390 0.35% 133 69885 0.38% 134 75210 0.41% 135 81257 0.44% 136 87357 0.47% 137 94266 0.51% 138 101999 0.55% 139 111693 0.61% 140 122606 0.66% 141 134552 0.73% 142 150381 0.81% 143 170486 0.92% 144 200367 1.09% 145 244679 1.33% 146 304603 1.65% 147 417166 2.26% 148 627258 3.40% 149 1164534 6.31% 150 4442459 24.06% 151 8596011 46.56% 18461562 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=39 prefix-density=0.21 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=239.92 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=17.7 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCGCAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGAAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTAACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.65 fanout-score-rank=33 prefix-density=0.27 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=33 fanout-score=36.76 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=10.8 sequence=GAGAAGGCATACCATGAGCAGCTCTCTGTGGCTGAGATAACCAACAGTGCTTTTGAGCCATCATCCATGATGGCCAAGTGTGACCCACGTCATGGCAAGTACATGGCTTGCTGCCTGATGTATAGAGGTGATGTTGTGCCCAAGGATGTGAATGCAGCTGTGGCTACCATCAAGACCAAGCG SRR7169556 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 00:40:38 Started mapping on | Feb 11 00:40:39 Finished on | Feb 11 00:42:44 Mapping speed, Million of reads per hour | 531.69 Number of input reads | 18461562 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 17332740 Uniquely mapped reads % | 93.89% Average mapped length | 293.61 Number of splices: Total | 16292463 Number of splices: Annotated (sjdb) | 16010044 Number of splices: GT/AG | 16057962 Number of splices: GC/AG | 182352 Number of splices: AT/AC | 13914 Number of splices: Non-canonical | 38235 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 322153 % of reads mapped to multiple loci | 1.74% Number of reads mapped to too many loci | 154678 % of reads mapped to too many loci | 0.84% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.39% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 826488 826488 826488 N_multimapping 322153 322153 322153 N_noFeature 388648 17126772 479427 N_ambiguous 187369 1103 71341 UnstrandedReadsAssigned:16756723 PositiveStrandReadsAssigned:204865 NegativeStrandReadsAssigned:16781972 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169556 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169556-trimmed-pair1.fastq SRR7169556-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,461,562 reads, 16,770,244 reads pseudoaligned [quant] estimated average fragment length: 252.169 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,108 rounds 52401 SRR7169556.ke.tsv 34699 SRR7169556.se.tsv 87100 total ==> SRR7169556.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.83 325 10.8867 Potri.005G024800.1.v4.1 1035 783.831 58 4.37938 Potri.004G059700.1.v4.1 961 709.925 16 1.33387 Potri.007G009000.2.v4.1 1416 1164.83 0 0 Potri.003G141000.2.v4.1 2943 2691.83 269.055 5.91563 Potri.016G087400.1.v4.1 270 75.1233 1494 1177.02 Potri.015G069301.1.v4.1 564 318.594 0 0 Potri.010G195200.1.v4.1 1773 1521.83 46 1.78895 Potri.012G127500.1.v4.1 977 725.875 6017 490.598 ==> SRR7169556.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1692 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 275 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169556 completed mapping pipeline successfully