Starting /dee2/code/volunteer_pipeline.sh SRR7169557 current disk space = 3057446957056 free memory = 1409200388 SRR7169557 SRAfilesize 6162417d3a324d28c21a717a4788f821 SRR7169557.sra SRR7169557.sra file validated SRR7169557 is paired end SRR7169557 is conventional basespace SRR7169557 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169557_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.90625 34.0 33.0 34.0 33.0 34.0 2 33.42025 34.0 34.0 34.0 33.0 34.0 3 33.5 34.0 34.0 34.0 33.0 34.0 4 33.5505 34.0 34.0 34.0 33.0 34.0 5 33.543 34.0 34.0 34.0 33.0 34.0 6 37.11475 38.0 37.0 38.0 36.0 38.0 7 37.442 38.0 38.0 38.0 37.0 38.0 8 37.45125 38.0 38.0 38.0 37.0 38.0 9 37.6215 38.0 38.0 38.0 38.0 38.0 10-14 37.51955 38.0 38.0 38.0 38.0 38.0 15-19 37.51545 38.0 38.0 38.0 38.0 38.0 20-24 37.4765 38.0 38.0 38.0 37.4 38.0 25-29 37.4623 38.0 38.0 38.0 37.6 38.0 30-34 37.43705 38.0 38.0 38.0 37.2 38.0 35-39 37.19045 38.0 38.0 38.0 36.4 38.0 40-44 37.2967 38.0 38.0 38.0 37.0 38.0 45-49 37.2161 38.0 38.0 38.0 36.4 38.0 50-54 37.17715 38.0 38.0 38.0 36.2 38.0 55-59 37.127700000000004 38.0 38.0 38.0 36.0 38.0 60-64 37.11935 38.0 38.0 38.0 36.0 38.0 65-69 37.047149999999995 38.0 38.0 38.0 36.0 38.0 70-74 37.00635 38.0 38.0 38.0 36.0 38.0 75-79 36.9618 38.0 38.0 38.0 36.0 38.0 80-84 36.89919999999999 38.0 38.0 38.0 35.4 38.0 85-89 36.835350000000005 38.0 38.0 38.0 35.0 38.0 90-94 36.800200000000004 38.0 38.0 38.0 35.0 38.0 95-99 36.634249999999994 38.0 38.0 38.0 34.4 38.0 100-104 36.49025 38.0 38.0 38.0 34.0 38.0 105-109 36.42915 38.0 37.8 38.0 34.0 38.0 110-114 36.204049999999995 38.0 37.0 38.0 33.6 38.0 115-119 36.0401 38.0 37.0 38.0 33.2 38.0 120-124 35.9251 38.0 37.0 38.0 33.0 38.0 125-129 35.78465 38.0 36.6 38.0 31.8 38.0 130-134 35.591100000000004 38.0 36.0 38.0 30.6 38.0 135-139 35.263400000000004 38.0 36.0 38.0 30.4 38.0 140-144 34.81635 38.0 35.0 38.0 27.8 38.0 145-149 34.19630000000001 38.0 35.0 38.0 25.4 38.0 150-151 31.17675 36.5 31.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 3.0 16 0.0 17 3.0 18 1.0 19 2.0 20 4.0 21 7.0 22 4.0 23 2.0 24 8.0 25 21.0 26 7.0 27 16.0 28 22.0 29 32.0 30 36.0 31 57.0 32 59.0 33 99.0 34 138.0 35 219.0 36 616.0 37 2641.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.954198473282446 12.46819338422392 7.811704834605599 33.76590330788804 2 23.7 13.775 33.175 29.349999999999998 3 19.475 18.55 26.375 35.6 4 22.825 27.275 23.724999999999998 26.174999999999997 5 23.225 32.35 23.1 21.325 6 18.575 35.375 24.825 21.224999999999998 7 13.625000000000002 25.6 43.65 17.125 8 17.424999999999997 24.2 31.974999999999998 26.400000000000002 9 17.325 23.5 34.35 24.825 10-14 19.55 29.7 27.715 23.035 15-19 19.945 28.134999999999998 27.889999999999997 24.03 20-24 19.685 28.815 27.74 23.76 25-29 20.175 28.46 27.96 23.405 30-34 20.115 28.470000000000002 27.515 23.9 35-39 19.79395879175835 28.470694138827767 27.855571114222844 23.879775955191036 40-44 20.11 28.7 27.195000000000004 23.995 45-49 20.78 28.560000000000002 27.185 23.474999999999998 50-54 19.895 29.325000000000003 27.169999999999998 23.61 55-59 20.685000000000002 28.425 27.474999999999998 23.415 60-64 19.86 28.305000000000003 27.66 24.175 65-69 20.69 28.694999999999997 27.185 23.43 70-74 20.23 28.165000000000003 27.534999999999997 24.07 75-79 20.365 28.305000000000003 27.49 23.84 80-84 20.495 28.084999999999997 27.465 23.955000000000002 85-89 20.305 28.51 27.384999999999998 23.799999999999997 90-94 20.685000000000002 27.884999999999998 27.860000000000003 23.57 95-99 19.985 27.925 27.99 24.099999999999998 100-104 20.87 28.615000000000002 27.150000000000002 23.365 105-109 20.815 28.084999999999997 27.229999999999997 23.87 110-114 20.169999999999998 28.12 27.435 24.275 115-119 20.845 28.410000000000004 27.155 23.59 120-124 20.715 28.03 27.615000000000002 23.64 125-129 20.955 27.355 27.625 24.065 130-134 20.880000000000003 27.68 27.245 24.195 135-139 21.37 28.044999999999998 26.919999999999998 23.665 140-144 20.985 27.61 27.325 24.08 145-149 20.355 27.955000000000002 26.784999999999997 24.905 150-151 20.5875 27.8625 26.525 25.025 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 1.5 24 2.0 25 1.5 26 2.0 27 4.5 28 8.5 29 13.0 30 14.5 31 21.0 32 30.5 33 36.5 34 53.5 35 70.5 36 83.0 37 110.0 38 122.5 39 150.5 40 190.5 41 208.5 42 225.5 43 247.5 44 268.5 45 280.5 46 280.5 47 248.5 48 236.5 49 228.0 50 191.5 51 155.5 52 117.5 53 106.0 54 90.5 55 53.5 56 31.0 57 26.5 58 24.5 59 15.5 60 6.5 61 6.5 62 8.5 63 5.5 64 4.5 65 2.5 66 2.0 67 2.5 68 2.0 69 2.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.02 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0125 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0125 0.0 0.0 0.025 0.0 64-65 0.025 0.0 0.0 0.025 0.0 66-67 0.025 0.0 0.0 0.025 0.0 68-69 0.025 0.0 0.0 0.025 0.0 70-71 0.037500000000000006 0.0 0.0 0.025 0.0 72-73 0.05 0.0 0.0 0.025 0.0 74-75 0.05 0.0 0.0 0.025 0.0 76-77 0.1 0.0 0.0 0.025 0.0 78-79 0.1 0.0 0.0 0.025 0.0 80-81 0.1125 0.0 0.0 0.025 0.0 82-83 0.1875 0.0 0.0 0.025 0.0 84-85 0.21250000000000002 0.0 0.0 0.025 0.0 86-87 0.225 0.0 0.0 0.025 0.0 88-89 0.25 0.0 0.0 0.025 0.0 90-91 0.3125 0.0 0.0 0.025 0.0 92-93 0.375 0.0 0.0 0.025 0.0 94-95 0.5125 0.0 0.0 0.025 0.0 96-97 0.625 0.0 0.0 0.025 0.0 98-99 0.7625 0.0 0.0 0.025 0.0 100-101 0.85 0.0 0.0 0.025 0.0 102-103 0.9125000000000001 0.0 0.0 0.025 0.0 104-105 0.9624999999999999 0.0 0.0 0.025 0.0 106-107 1.2375 0.0 0.0 0.025 0.0 108-109 1.5499999999999998 0.0 0.0 0.025 0.0 110-111 1.9125 0.0 0.0 0.025 0.0 112-113 2.175 0.0 0.0 0.025 0.0 114-115 2.4000000000000004 0.0 0.0 0.025 0.0 116-117 2.6500000000000004 0.0 0.0 0.025 0.0 118-119 2.925 0.0 0.0 0.025 0.0 120-121 3.2 0.0 0.0 0.025 0.0 122-123 3.55 0.0 0.0 0.025 0.0 124-125 3.8625 0.0 0.0 0.025 0.0 126-127 4.3625 0.0 0.0 0.025 0.0 128-129 4.8375 0.0 0.0 0.025 0.0 130-131 5.3375 0.0 0.0 0.025 0.0 132-133 5.75 0.0 0.0 0.025 0.0 134-135 6.4 0.0 0.0 0.025 0.0 136-137 6.8125 0.0 0.0 0.025 0.0 138-139 7.275 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCATGA 10 0.006577216 146.82278 1 >>END_MODULE SRR7169557 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169557_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.03925 33.0 33.0 34.0 32.0 34.0 2 33.14425 34.0 33.0 34.0 33.0 34.0 3 33.14975 34.0 33.0 34.0 33.0 34.0 4 33.14275 34.0 33.0 34.0 33.0 34.0 5 33.11875 34.0 33.0 34.0 33.0 34.0 6 37.24575 38.0 38.0 38.0 37.0 38.0 7 37.31225 38.0 38.0 38.0 37.0 38.0 8 37.28175 38.0 38.0 38.0 37.0 38.0 9 37.27325 38.0 38.0 38.0 37.0 38.0 10-14 37.2752 38.0 38.0 38.0 37.0 38.0 15-19 37.1751 38.0 38.0 38.0 37.0 38.0 20-24 37.18535 38.0 38.0 38.0 37.0 38.0 25-29 37.180949999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.118950000000005 38.0 38.0 38.0 37.0 38.0 35-39 37.084649999999996 38.0 38.0 38.0 36.8 38.0 40-44 37.115449999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.1458 38.0 38.0 38.0 37.0 38.0 50-54 37.09675 38.0 38.0 38.0 37.0 38.0 55-59 36.856550000000006 38.0 38.0 38.0 36.0 38.0 60-64 36.98755 38.0 38.0 38.0 36.0 38.0 65-69 36.986650000000004 38.0 38.0 38.0 36.4 38.0 70-74 36.9227 38.0 38.0 38.0 36.0 38.0 75-79 36.821999999999996 38.0 38.0 38.0 36.0 38.0 80-84 36.686249999999994 38.0 38.0 38.0 35.2 38.0 85-89 36.6454 38.0 38.0 38.0 35.4 38.0 90-94 36.59675 38.0 38.0 38.0 35.0 38.0 95-99 36.581900000000005 38.0 38.0 38.0 35.0 38.0 100-104 36.5172 38.0 38.0 38.0 34.4 38.0 105-109 36.446749999999994 38.0 38.0 38.0 34.2 38.0 110-114 36.22655 38.0 38.0 38.0 34.0 38.0 115-119 36.09185 38.0 38.0 38.0 33.8 38.0 120-124 35.8381 38.0 37.2 38.0 33.0 38.0 125-129 35.584050000000005 38.0 37.0 38.0 31.2 38.0 130-134 35.42229999999999 38.0 36.2 38.0 31.0 38.0 135-139 35.040150000000004 38.0 36.0 38.0 29.4 38.0 140-144 34.45615 38.0 35.0 38.0 26.6 38.0 145-149 33.91539999999999 38.0 35.0 38.0 22.0 38.0 150-151 30.1785 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 4.0 4 2.0 5 0.0 6 0.0 7 1.0 8 0.0 9 2.0 10 1.0 11 1.0 12 3.0 13 5.0 14 0.0 15 1.0 16 1.0 17 2.0 18 4.0 19 6.0 20 5.0 21 7.0 22 9.0 23 9.0 24 7.0 25 10.0 26 27.0 27 26.0 28 23.0 29 33.0 30 32.0 31 52.0 32 64.0 33 84.0 34 113.0 35 180.0 36 494.0 37 2786.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.2 22.6 11.575000000000001 26.625 2 27.6 27.875 28.1 16.425 3 19.55 29.925 31.275 19.25 4 22.075 35.699999999999996 24.45 17.775 5 24.775 35.35 22.05 17.825 6 21.056584877315974 38.70806209313971 21.28192288432649 18.953430145217826 7 20.38057085628443 21.807711567351028 38.50776164246369 19.303955933900852 8 20.255383074611917 24.76214321482223 28.743114672008012 26.239359038557836 9 20.230345518277414 25.913870806209317 30.42063094641963 23.43515272909364 10-14 23.25988983475213 28.938407611417126 26.214321482223333 21.58738107160741 15-19 23.324987481221832 27.84176264396595 27.88683024536805 20.946419629444165 20-24 22.72909364046069 27.681522283425135 27.76164246369554 21.827741612418627 25-29 23.144717075613418 28.70806209313971 26.99048572859289 21.156735102653982 30-34 22.794191286930396 27.99699549323986 28.192288432648972 21.01652478718077 35-39 22.799198798197295 28.49774661992989 27.1206810215323 21.58237356034051 40-44 23.353023628354023 28.81457749299159 26.867240688826595 20.965158189827793 45-49 22.902482979575492 28.879655586704047 27.68822587104525 20.52963556267521 50-54 23.32832832832833 28.14814814814815 27.732732732732735 20.79079079079079 55-59 23.333333333333332 27.68268268268268 27.932932932932935 21.05105105105105 60-64 23.503503503503502 28.28828828828829 28.083083083083082 20.125125125125127 65-69 23.393393393393396 27.54254254254254 28.14814814814815 20.915915915915917 70-74 23.830980274356666 27.74106338239712 27.971362771603086 20.456593571643136 75-79 23.62598858744619 28.180999099008908 27.965762338572432 20.22724997497247 80-84 23.204807210816224 28.037055583375064 27.651477215823732 21.106659989984976 85-89 23.610415623435152 27.69654481722584 27.84176264396595 20.85127691537306 90-94 23.685528292438658 27.871807711567353 27.911867801702556 20.530796194291437 95-99 24.339074704586423 27.41337873022231 27.36831564189866 20.87923092329261 100-104 24.30673741115227 27.66042646911603 27.51526679347282 20.517569326258887 105-109 24.05905905905906 28.143143143143146 27.51251251251251 20.285285285285283 110-114 23.75112623886275 28.29112023225548 27.43517869656622 20.522574832315545 115-119 24.10392470965158 28.55927112535042 27.20264317180617 20.13416099319183 120-124 24.24667133847232 27.94073480828912 27.28000800880969 20.532585844428873 125-129 24.29172089298228 28.130944038442284 27.23495845429973 20.342376614275704 130-134 24.48683288274757 28.251727245419044 27.210373485531193 20.051066386302193 135-139 25.19775708420947 27.966356263142085 26.72474216481426 20.111144487834185 140-144 24.792271498648514 28.170988086895587 26.924617078786667 20.112123335669235 145-149 24.684684684684687 27.802802802802802 27.04204204204204 20.47047047047047 150-151 25.76288144072036 27.826413206603302 26.93846923461731 19.47223611805903 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 1.0 3 1.5 4 1.0 5 0.5 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.5 22 2.0 23 1.0 24 1.0 25 2.5 26 3.5 27 4.5 28 6.0 29 7.5 30 10.0 31 15.0 32 22.5 33 32.0 34 41.0 35 50.5 36 68.0 37 93.0 38 119.5 39 157.0 40 203.5 41 239.0 42 267.0 43 295.5 44 311.5 45 305.0 46 294.0 47 274.0 48 221.0 49 181.5 50 162.0 51 137.5 52 116.5 53 91.0 54 66.0 55 44.5 56 35.5 57 32.0 58 21.0 59 15.0 60 12.0 61 6.5 62 5.0 63 5.0 64 3.5 65 2.0 66 2.0 67 2.0 68 1.5 69 1.0 70 1.5 71 1.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.15 7 0.15 8 0.15 9 0.15 10-14 0.15 15-19 0.15 20-24 0.15 25-29 0.15 30-34 0.15 35-39 0.15 40-44 0.12 45-49 0.12 50-54 0.1 55-59 0.1 60-64 0.1 65-69 0.1 70-74 0.13 75-79 0.11 80-84 0.15 85-89 0.15 90-94 0.15 95-99 0.13999999999999999 100-104 0.11 105-109 0.1 110-114 0.11 115-119 0.12 120-124 0.11 125-129 0.11 130-134 0.13 135-139 0.13 140-144 0.11 145-149 0.1 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59819186338524 99.15 2 0.3766951280763436 0.75 3 0.0 0.0 4 0.025113008538422906 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.5375 0.0 0.0 0.0 0.0 96-97 0.65 0.0 0.0 0.0 0.0 98-99 0.7875 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 0.9125000000000001 0.0 0.0 0.0 0.0 104-105 0.9624999999999999 0.0 0.0 0.0 0.0 106-107 1.2375 0.0 0.0 0.0 0.0 108-109 1.5499999999999998 0.0 0.0 0.0 0.0 110-111 1.9125 0.0 0.0 0.0 0.0 112-113 2.1500000000000004 0.0 0.0 0.0 0.0 114-115 2.3875 0.0 0.0 0.0 0.0 116-117 2.6500000000000004 0.0 0.0 0.0 0.0 118-119 2.9000000000000004 0.0 0.0 0.0 0.0 120-121 3.1500000000000004 0.0 0.0 0.0 0.0 122-123 3.4749999999999996 0.0 0.0 0.0 0.0 124-125 3.7875 0.0 0.0 0.0 0.0 126-127 4.275 0.0 0.0 0.0 0.0 128-129 4.7375 0.0 0.0 0.0 0.0 130-131 5.225 0.0 0.0 0.0 0.0 132-133 5.675000000000001 0.0 0.0 0.0 0.0 134-135 6.2875 0.0 0.0 0.0 0.0 136-137 6.7 0.0 0.0 0.0 0.0 138-139 7.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 904472 spots for SRR7169557.sra Written 904472 spots for SRR7169557.sra Read 904472 spots for SRR7169557.sra Written 904472 spots for SRR7169557.sra Read 904472 spots for SRR7169557.sra Written 904472 spots for SRR7169557.sra Read 904472 spots for SRR7169557.sra Written 904472 spots for SRR7169557.sra Read 904472 spots for SRR7169557.sra Written 904472 spots for SRR7169557.sra Read 904472 spots for SRR7169557.sra Written 904472 spots for SRR7169557.sra Read 904472 spots for SRR7169557.sra Written 904472 spots for SRR7169557.sra Read 904472 spots for SRR7169557.sra Written 904472 spots for SRR7169557.sra Read 904472 spots for SRR7169557.sra Written 904472 spots for SRR7169557.sra Read 904472 spots for SRR7169557.sra Written 904472 spots for SRR7169557.sra Read 904472 spots for SRR7169557.sra Written 904472 spots for SRR7169557.sra Read 904472 spots for SRR7169557.sra Written 904472 spots for SRR7169557.sra Read 904472 spots for SRR7169557.sra Written 904472 spots for SRR7169557.sra Read 904472 spots for SRR7169557.sra Written 904472 spots for SRR7169557.sra Read 904472 spots for SRR7169557.sra Written 904472 spots for SRR7169557.sra Read 904472 spots for SRR7169557.sra Written 904472 spots for SRR7169557.sra Read 904491 spots for SRR7169557.sra Written 904491 spots for SRR7169557.sra Read 904472 spots for SRR7169557.sra Written 904472 spots for SRR7169557.sra Read 904472 spots for SRR7169557.sra Written 904472 spots for SRR7169557.sra Read 904472 spots for SRR7169557.sra Written 904472 spots for SRR7169557.sra SRR ids: ['SRR7169557.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8ff_9dpd SRR7169557.sra spots: 18089459 blocks: [[1, 904472], [904473, 1808944], [1808945, 2713416], [2713417, 3617888], [3617889, 4522360], [4522361, 5426832], [5426833, 6331304], [6331305, 7235776], [7235777, 8140248], [8140249, 9044720], [9044721, 9949192], [9949193, 10853664], [10853665, 11758136], [11758137, 12662608], [12662609, 13567080], [13567081, 14471552], [14471553, 15376024], [15376025, 16280496], [16280497, 17184968], [17184969, 18089459]] SRR7169557 file size 6108223 SRR7169557 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169557 SRR7169557_1.fastq SRR7169557_2.fastq Input file: SRR7169557_1.fastq Paired file: SRR7169557_2.fastq trimmed: SRR7169557-trimmed-pair1.fastq, SRR7169557-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 00:02:58 2025 >> started Tue Feb 11 00:03:30 2025 >> done (31.586s) 18089459 read pairs processed; of these: 37050 ( 0.20%) short read pairs filtered out after trimming by size control 36415 ( 0.20%) empty read pairs filtered out after trimming by size control 18015994 (99.59%) read pairs available; of these: 8786485 (48.77%) trimmed read pairs available after processing 9229509 (51.23%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 5 0.00% 20 3 0.00% 21 5 0.00% 22 5 0.00% 23 6 0.00% 24 7 0.00% 25 2 0.00% 26 7 0.00% 27 6 0.00% 28 8 0.00% 29 9 0.00% 30 7 0.00% 31 11 0.00% 32 6 0.00% 33 7 0.00% 34 14 0.00% 35 13 0.00% 36 10 0.00% 37 13 0.00% 38 16 0.00% 39 20 0.00% 40 23 0.00% 41 28 0.00% 42 36 0.00% 43 20 0.00% 44 26 0.00% 45 30 0.00% 46 41 0.00% 47 43 0.00% 48 45 0.00% 49 59 0.00% 50 86 0.00% 51 74 0.00% 52 102 0.00% 53 91 0.00% 54 91 0.00% 55 109 0.00% 56 134 0.00% 57 160 0.00% 58 141 0.00% 59 181 0.00% 60 204 0.00% 61 232 0.00% 62 318 0.00% 63 301 0.00% 64 359 0.00% 65 411 0.00% 66 473 0.00% 67 544 0.00% 68 582 0.00% 69 866 0.00% 70 925 0.01% 71 903 0.01% 72 1022 0.01% 73 1159 0.01% 74 1218 0.01% 75 1361 0.01% 76 1592 0.01% 77 1614 0.01% 78 1824 0.01% 79 2128 0.01% 80 2376 0.01% 81 2757 0.02% 82 3199 0.02% 83 3718 0.02% 84 4831 0.03% 85 5454 0.03% 86 5867 0.03% 87 6225 0.03% 88 6697 0.04% 89 7088 0.04% 90 7756 0.04% 91 8545 0.05% 92 9154 0.05% 93 10009 0.06% 94 10943 0.06% 95 11421 0.06% 96 12075 0.07% 97 12640 0.07% 98 13654 0.08% 99 14360 0.08% 100 15113 0.08% 101 16425 0.09% 102 17491 0.10% 103 18702 0.10% 104 20000 0.11% 105 20910 0.12% 106 22286 0.12% 107 22663 0.13% 108 23926 0.13% 109 24711 0.14% 110 25842 0.14% 111 27132 0.15% 112 28909 0.16% 113 29963 0.17% 114 32094 0.18% 115 33918 0.19% 116 34701 0.19% 117 36503 0.20% 118 37274 0.21% 119 38039 0.21% 120 39953 0.22% 121 41696 0.23% 122 44016 0.24% 123 45287 0.25% 124 48759 0.27% 125 50893 0.28% 126 52740 0.29% 127 54696 0.30% 128 56639 0.31% 129 58881 0.33% 130 61591 0.34% 131 63199 0.35% 132 67083 0.37% 133 71169 0.40% 134 74897 0.42% 135 79296 0.44% 136 84617 0.47% 137 89716 0.50% 138 94504 0.52% 139 100531 0.56% 140 106746 0.59% 141 115177 0.64% 142 126071 0.70% 143 140183 0.78% 144 160854 0.89% 145 188020 1.04% 146 227855 1.26% 147 305777 1.70% 148 462979 2.57% 149 907256 5.04% 150 4060291 22.54% 151 9229509 51.23% 18015994 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.79 fanout-score-rank=33 prefix-density=0.22 prefix-fanout=2.5 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.06 sequence-density-rank=30 fanout-score=117.18 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=20.5 sequence=CAAAATCATAGCCCACTTAAAAAAACGAGAGCAATCCATGCAATAACCTCATCAAAACCTTCTGTGTCACAAAGAATATATTGCTGCAACCATGCAAACTCCAAAGAACACAACATTGTTCAGAACAGTAAAGCTTACTGCCCCAGAAGTATCCGCAGGAGATTCTGGACTCGCTGCAGCTTTGGATCTCTTCTTTGGCTTTTCAGGTGCTGGTGCTGGAGTAGGAGGTTTAGGTGTAAAGATATCAAGAGGAAGAAGCACCTTGTCAACCTGATAAACAGCTAACTGG criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.80 fanout-score-rank=33 prefix-density=0.31 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=22 fanout-score=265.00 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=30.1 sequence=AAGAAGAAGAAA SRR7169557 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 00:04:26 Started mapping on | Feb 11 00:04:26 Finished on | Feb 11 00:06:47 Mapping speed, Million of reads per hour | 459.98 Number of input reads | 18015994 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 17168768 Uniquely mapped reads % | 95.30% Average mapped length | 293.33 Number of splices: Total | 16313263 Number of splices: Annotated (sjdb) | 16032614 Number of splices: GT/AG | 16076715 Number of splices: GC/AG | 190412 Number of splices: AT/AC | 13984 Number of splices: Non-canonical | 32152 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.84 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 309209 % of reads mapped to multiple loci | 1.72% Number of reads mapped to too many loci | 54453 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.63% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 554763 554763 554763 N_multimapping 309209 309209 309209 N_noFeature 429984 16972671 524454 N_ambiguous 169022 893 66752 UnstrandedReadsAssigned:16569762 PositiveStrandReadsAssigned:195204 NegativeStrandReadsAssigned:16577562 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169557 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169557-trimmed-pair1.fastq SRR7169557-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,015,994 reads, 16,510,369 reads pseudoaligned [quant] estimated average fragment length: 235.336 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,183 rounds 52401 SRR7169557.ke.tsv 34699 SRR7169557.se.tsv 87100 total ==> SRR7169557.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1783.66 344 12.4075 Potri.005G024800.1.v4.1 1035 800.664 36 2.89263 Potri.004G059700.1.v4.1 961 726.719 5 0.442633 Potri.007G009000.2.v4.1 1416 1181.66 0 0 Potri.003G141000.2.v4.1 2943 2708.66 302.106 7.17536 Potri.016G087400.1.v4.1 270 83.4414 1152 888.202 Potri.015G069301.1.v4.1 564 335.194 0 0 Potri.010G195200.1.v4.1 1773 1538.66 57 2.38326 Potri.012G127500.1.v4.1 977 742.705 6137 531.594 ==> SRR7169557.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1245 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 324 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169557 completed mapping pipeline successfully