Starting /dee2/code/volunteer_pipeline.sh SRR7169558 current disk space = 3057361276928 free memory = 1114777600 SRR7169558 SRAfilesize db9606abcf3f2ae72398a1a4450f9e6e SRR7169558.sra SRR7169558.sra file validated SRR7169558 is paired end SRR7169558 is conventional basespace SRR7169558 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169558_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.91225 34.0 33.0 34.0 33.0 34.0 2 33.39725 34.0 33.0 34.0 33.0 34.0 3 33.44275 34.0 34.0 34.0 33.0 34.0 4 33.442 34.0 34.0 34.0 33.0 34.0 5 33.4875 34.0 34.0 34.0 33.0 34.0 6 37.00775 38.0 37.0 38.0 36.0 38.0 7 37.3085 38.0 38.0 38.0 37.0 38.0 8 37.39075 38.0 38.0 38.0 37.0 38.0 9 37.46325 38.0 38.0 38.0 37.0 38.0 10-14 37.542449999999995 38.0 38.0 38.0 37.2 38.0 15-19 37.46685 38.0 38.0 38.0 37.2 38.0 20-24 37.465700000000005 38.0 38.0 38.0 37.4 38.0 25-29 37.469350000000006 38.0 38.0 38.0 37.2 38.0 30-34 37.472300000000004 38.0 38.0 38.0 37.4 38.0 35-39 37.24695 38.0 38.0 38.0 36.8 38.0 40-44 37.2747 38.0 38.0 38.0 37.0 38.0 45-49 37.26514999999999 38.0 38.0 38.0 37.0 38.0 50-54 37.215250000000005 38.0 38.0 38.0 36.6 38.0 55-59 37.1876 38.0 38.0 38.0 36.0 38.0 60-64 37.135650000000005 38.0 38.0 38.0 36.0 38.0 65-69 37.09665 38.0 38.0 38.0 36.0 38.0 70-74 37.02215 38.0 38.0 38.0 36.0 38.0 75-79 36.9719 38.0 38.0 38.0 36.0 38.0 80-84 36.90525 38.0 38.0 38.0 35.8 38.0 85-89 36.9094 38.0 38.0 38.0 36.0 38.0 90-94 36.886449999999996 38.0 38.0 38.0 35.4 38.0 95-99 36.6734 38.0 38.0 38.0 34.6 38.0 100-104 36.526650000000004 38.0 38.0 38.0 34.2 38.0 105-109 36.50975 38.0 38.0 38.0 34.0 38.0 110-114 36.29025 38.0 38.0 38.0 33.8 38.0 115-119 36.16455 38.0 37.4 38.0 33.6 38.0 120-124 35.985800000000005 38.0 37.0 38.0 33.0 38.0 125-129 35.825900000000004 38.0 37.0 38.0 32.6 38.0 130-134 35.6101 38.0 36.2 38.0 31.2 38.0 135-139 35.33645 38.0 36.0 38.0 30.6 38.0 140-144 34.9409 38.0 35.8 38.0 28.0 38.0 145-149 34.26975 38.0 35.0 38.0 25.8 38.0 150-151 31.216375 36.5 31.5 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 2.0 14 0.0 15 2.0 16 2.0 17 0.0 18 2.0 19 3.0 20 4.0 21 1.0 22 10.0 23 5.0 24 13.0 25 7.0 26 18.0 27 22.0 28 18.0 29 31.0 30 44.0 31 45.0 32 49.0 33 106.0 34 128.0 35 257.0 36 523.0 37 2707.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.99288256227758 12.226741230299949 10.21860701576004 35.56176919166243 2 23.625 14.05 32.6 29.725 3 19.425 17.9 27.375 35.3 4 24.0 26.8 23.425 25.775 5 23.275000000000002 31.525 24.7 20.5 6 19.900000000000002 34.300000000000004 25.474999999999998 20.325 7 14.6 28.525 39.800000000000004 17.075000000000003 8 18.9 26.125 30.7 24.275 9 16.225 25.45 34.050000000000004 24.275 10-14 20.05 29.799999999999997 27.405 22.745 15-19 20.115 28.49 27.700000000000003 23.695 20-24 20.345 28.28 27.66 23.715 25-29 20.169999999999998 28.59 27.865000000000002 23.375 30-34 20.4 28.599999999999998 27.634999999999998 23.365 35-39 19.741909668383933 27.99479817936278 27.97979292752463 24.283499224728654 40-44 20.555 28.785 27.305 23.355 45-49 20.380000000000003 28.53 27.62 23.47 50-54 20.505000000000003 28.225 27.51 23.76 55-59 19.465 28.815 27.55 24.169999999999998 60-64 20.39 27.98 27.98 23.65 65-69 20.72 27.765 27.705000000000002 23.810000000000002 70-74 20.44 28.084999999999997 27.455000000000002 24.02 75-79 20.51 28.244999999999997 27.41 23.835 80-84 20.474999999999998 28.599999999999998 27.12 23.805 85-89 20.375 28.345 27.315 23.965 90-94 20.794999999999998 27.900000000000002 27.025 24.279999999999998 95-99 20.51 28.59 27.38 23.52 100-104 20.93 28.4 27.195000000000004 23.474999999999998 105-109 20.625 28.325 27.435 23.615 110-114 20.655 27.889999999999997 27.68 23.775 115-119 20.715 28.34 27.439999999999998 23.505000000000003 120-124 20.535 28.1 27.224999999999998 24.14 125-129 20.919999999999998 27.705000000000002 27.51 23.865 130-134 20.68 27.425 27.939999999999998 23.955000000000002 135-139 21.15 28.449999999999996 26.545 23.855 140-144 20.705000000000002 27.85 27.279999999999998 24.165 145-149 21.025 28.49 26.615 23.87 150-151 20.7875 28.050000000000004 26.7625 24.4 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 1.0 24 2.5 25 6.0 26 7.5 27 6.5 28 6.5 29 8.5 30 13.0 31 20.0 32 28.5 33 35.5 34 46.0 35 59.0 36 84.5 37 109.5 38 122.0 39 144.5 40 171.0 41 203.0 42 231.5 43 258.0 44 282.0 45 292.5 46 293.0 47 257.0 48 232.5 49 221.0 50 184.5 51 150.5 52 122.5 53 106.0 54 92.5 55 60.5 56 32.5 57 26.0 58 20.0 59 14.0 60 11.0 61 7.5 62 5.5 63 5.5 64 4.5 65 3.5 66 3.5 67 2.0 68 1.5 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.6500000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.034999999999999996 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.45 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.65 0.0 0.0 0.0 0.0 104-105 0.775 0.0 0.0 0.0 0.0 106-107 1.025 0.0 0.0 0.0 0.0 108-109 1.2125 0.0 0.0 0.0 0.0 110-111 1.35 0.0 0.0 0.0 0.0 112-113 1.55 0.0 0.0 0.0 0.0 114-115 1.775 0.0 0.0 0.0 0.0 116-117 2.075 0.0 0.0 0.0 0.0 118-119 2.3 0.0 0.0 0.0 0.0 120-121 2.675 0.0 0.0 0.0 0.0 122-123 2.9375 0.0 0.0 0.0 0.0 124-125 3.275 0.0 0.0 0.0 0.0 126-127 3.6125 0.0 0.0 0.0 0.0 128-129 4.025 0.0 0.0 0.0 0.0 130-131 4.362500000000001 0.0 0.0 0.0 0.0 132-133 4.8125 0.0 0.0 0.0 0.0 134-135 5.325 0.0 0.0 0.0 0.0 136-137 5.85 0.0 0.0 0.0 0.0 138-139 6.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCTTAA 10 0.006830828 145.0 3 ACATACC 10 0.006830828 145.0 145 GTCCATT 10 0.006830828 145.0 1 >>END_MODULE SRR7169558 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169558_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.914 33.0 33.0 34.0 32.0 34.0 2 32.9695 34.0 33.0 34.0 32.0 34.0 3 33.0135 34.0 33.0 34.0 32.0 34.0 4 32.99325 34.0 33.0 34.0 32.0 34.0 5 32.9815 34.0 33.0 34.0 32.0 34.0 6 37.12675 38.0 38.0 38.0 37.0 38.0 7 37.13525 38.0 38.0 38.0 37.0 38.0 8 37.08 38.0 38.0 38.0 37.0 38.0 9 37.13175 38.0 38.0 38.0 37.0 38.0 10-14 36.9972 38.0 38.0 38.0 36.8 38.0 15-19 36.951449999999994 38.0 38.0 38.0 36.6 38.0 20-24 36.93655 38.0 38.0 38.0 36.4 38.0 25-29 36.9251 38.0 38.0 38.0 36.4 38.0 30-34 36.846 38.0 38.0 38.0 36.2 38.0 35-39 36.843 38.0 38.0 38.0 36.0 38.0 40-44 36.85915 38.0 38.0 38.0 36.0 38.0 45-49 36.8829 38.0 38.0 38.0 36.0 38.0 50-54 36.8677 38.0 38.0 38.0 36.0 38.0 55-59 36.630900000000004 38.0 38.0 38.0 35.2 38.0 60-64 36.760149999999996 38.0 38.0 38.0 35.8 38.0 65-69 36.705349999999996 38.0 38.0 38.0 36.0 38.0 70-74 36.6542 38.0 38.0 38.0 35.4 38.0 75-79 36.622699999999995 38.0 38.0 38.0 35.2 38.0 80-84 36.425 38.0 38.0 38.0 34.6 38.0 85-89 36.300349999999995 38.0 38.0 38.0 34.0 38.0 90-94 36.2633 38.0 38.0 38.0 34.0 38.0 95-99 36.21005 38.0 38.0 38.0 34.0 38.0 100-104 36.11065000000001 38.0 38.0 38.0 33.8 38.0 105-109 36.017399999999995 38.0 38.0 38.0 33.8 38.0 110-114 35.89815 38.0 38.0 38.0 33.0 38.0 115-119 35.6995 38.0 37.2 38.0 32.4 38.0 120-124 35.462149999999994 38.0 37.2 38.0 31.0 38.0 125-129 35.237449999999995 38.0 36.4 38.0 30.2 38.0 130-134 34.97185 38.0 36.0 38.0 28.2 38.0 135-139 34.554449999999996 38.0 35.8 38.0 27.0 38.0 140-144 33.96785000000001 38.0 35.0 38.0 23.0 38.0 145-149 33.508599999999994 38.0 35.0 38.0 19.0 38.0 150-151 29.847875000000002 36.5 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 10.0 4 1.0 5 1.0 6 1.0 7 1.0 8 0.0 9 1.0 10 0.0 11 2.0 12 2.0 13 3.0 14 3.0 15 5.0 16 2.0 17 4.0 18 4.0 19 8.0 20 10.0 21 12.0 22 22.0 23 11.0 24 11.0 25 17.0 26 25.0 27 21.0 28 23.0 29 31.0 30 39.0 31 65.0 32 77.0 33 85.0 34 114.0 35 200.0 36 479.0 37 2699.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.45 23.599999999999998 13.25 24.7 2 27.175 27.0 28.825 17.0 3 20.7 28.875 30.925000000000004 19.5 4 23.400000000000002 33.5 23.65 19.45 5 23.549999999999997 36.825 22.675 16.950000000000003 6 20.741482965931866 37.92585170340681 23.196392785571142 18.13627254509018 7 19.368579303432725 22.174893510398398 38.586820345778 19.86970684039088 8 21.743486973947896 26.027054108216436 27.980961923847698 24.248496993987974 9 21.59318637274549 24.799599198396795 30.761523046092183 22.84569138276553 10-14 23.058422687644054 28.575007515783145 26.590840765607776 21.775729030965028 15-19 22.7416203216594 28.623678541009067 27.7118092088782 20.92289192845333 20-24 22.86802284798076 28.575007515783145 27.327387513778934 21.22958212245716 25-29 23.128569996993686 28.70528109028961 27.51778735344223 20.648361559274477 30-34 23.283896181982165 27.878544944383204 27.948692253732837 20.888866619901794 35-39 22.8117641164387 28.658750438398716 27.92725086427176 20.602234580890826 40-44 23.2025652587805 28.41324715667118 27.571521619319604 20.812665965228717 45-49 23.445719152347078 27.483593006362405 28.174941135213665 20.89574670607685 50-54 23.437186936485674 27.895211380484874 27.965337607693847 20.702264075335606 55-59 23.529706442240254 28.313796212804327 27.552349463981564 20.60414788097385 60-64 23.716246681028004 28.505585892490355 27.44852462301488 20.32964280346676 65-69 23.2591924656848 28.163510670273517 27.787796813946496 20.78950005009518 70-74 23.488150708953352 27.877148153715115 28.277969838168243 20.356731299163286 75-79 23.517034068136272 27.219438877755508 28.251503006012022 21.012024048096194 80-84 23.25884357150015 28.038881651468085 27.76831345826235 20.933961318769416 85-89 23.873715860686545 27.782510648960162 27.491856677524428 20.851916812828865 90-94 23.48165965123271 27.435357787131693 28.31729805572259 20.76568450591301 95-99 23.31546515705626 27.663944692149695 27.944491758929914 21.076098391864136 100-104 23.806422523921647 28.074745754220732 27.573768849256048 20.545062872601573 105-109 24.10839511120016 28.055499899819676 27.52454417952314 20.31156080945702 110-114 23.718879927866553 28.051896007614086 27.440765416019637 20.788458648499724 115-119 24.165915238954014 27.60244464482517 27.842901512874462 20.388738603346358 120-124 23.996793747808226 27.678973999298634 27.638895846901455 20.685336405991684 125-129 24.65931863727455 27.805611222444888 27.07915831663327 20.455911823647295 130-134 24.252291969340213 28.26010720905766 27.333299934873 20.15430088672912 135-139 24.493987975951903 28.111222444889776 27.289579158316634 20.105210420841683 140-144 25.46966584840439 27.969540604178146 26.401482891638693 20.15931065577877 145-149 25.699974956173303 27.95892812421738 26.666666666666668 19.67443025294265 150-151 24.97185036907294 27.82434630301514 27.27386463155261 19.929938696359315 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 2.0 3 2.5 4 1.0 5 0.5 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.0 25 2.0 26 4.5 27 4.0 28 4.5 29 6.5 30 9.5 31 14.0 32 23.0 33 28.5 34 38.5 35 64.5 36 80.5 37 101.0 38 141.0 39 174.0 40 201.5 41 240.5 42 270.5 43 263.5 44 264.0 45 287.5 46 281.5 47 266.5 48 249.0 49 211.5 50 179.5 51 156.5 52 115.5 53 89.5 54 66.5 55 39.0 56 26.5 57 17.0 58 19.0 59 16.5 60 11.5 61 5.5 62 2.0 63 2.5 64 2.5 65 0.5 66 3.0 67 3.0 68 0.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.2 7 0.22499999999999998 8 0.2 9 0.2 10-14 0.21 15-19 0.20500000000000002 20-24 0.21 25-29 0.21 30-34 0.21 35-39 0.20500000000000002 40-44 0.20500000000000002 45-49 0.19499999999999998 50-54 0.18 55-59 0.19 60-64 0.19499999999999998 65-69 0.19 70-74 0.20500000000000002 75-79 0.2 80-84 0.21 85-89 0.22499999999999998 90-94 0.22 95-99 0.19499999999999998 100-104 0.19499999999999998 105-109 0.18 110-114 0.185 115-119 0.19 120-124 0.19499999999999998 125-129 0.2 130-134 0.19499999999999998 135-139 0.2 140-144 0.19499999999999998 145-149 0.17500000000000002 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.45 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.6625000000000001 0.0 0.0 0.0 0.0 104-105 0.8 0.0 0.0 0.0 0.0 106-107 1.0499999999999998 0.0 0.0 0.0 0.0 108-109 1.2375 0.0 0.0 0.0 0.0 110-111 1.375 0.0 0.0 0.0 0.0 112-113 1.575 0.0 0.0 0.0 0.0 114-115 1.7875 0.0 0.0 0.0 0.0 116-117 2.075 0.0 0.0 0.0 0.0 118-119 2.3125 0.0 0.0 0.0 0.0 120-121 2.6625 0.0 0.0 0.0 0.0 122-123 2.9000000000000004 0.0 0.0 0.0 0.0 124-125 3.3125 0.0 0.0 0.0 0.0 126-127 3.6624999999999996 0.0 0.0 0.0 0.0 128-129 4.075 0.0 0.0 0.0 0.0 130-131 4.4125 0.0 0.0 0.0 0.0 132-133 4.8625 0.0 0.0 0.0 0.0 134-135 5.3625 0.0 0.0 0.0 0.0 136-137 5.9 0.0 0.0 0.0 0.0 138-139 6.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTGAGA 10 0.006830828 145.0 145 >>END_MODULE Read 862981 spots for SRR7169558.sra Written 862981 spots for SRR7169558.sra Read 862981 spots for SRR7169558.sra Written 862981 spots for SRR7169558.sra Read 862981 spots for SRR7169558.sra Written 862981 spots for SRR7169558.sra Read 862981 spots for SRR7169558.sra Written 862981 spots for SRR7169558.sra Read 862981 spots for SRR7169558.sra Written 862981 spots for SRR7169558.sra Read 862981 spots for SRR7169558.sra Written 862981 spots for SRR7169558.sra Read 862981 spots for SRR7169558.sra Written 862981 spots for SRR7169558.sra Read 862981 spots for SRR7169558.sra Written 862981 spots for SRR7169558.sra Read 862981 spots for SRR7169558.sra Written 862981 spots for SRR7169558.sra Read 862981 spots for SRR7169558.sra Written 862981 spots for SRR7169558.sra Read 862981 spots for SRR7169558.sra Written 862981 spots for SRR7169558.sra Read 862981 spots for SRR7169558.sra Written 862981 spots for SRR7169558.sra Read 862981 spots for SRR7169558.sra Written 862981 spots for SRR7169558.sra Read 862996 spots for SRR7169558.sra Written 862996 spots for SRR7169558.sra Read 862981 spots for SRR7169558.sra Written 862981 spots for SRR7169558.sra Read 862981 spots for SRR7169558.sra Written 862981 spots for SRR7169558.sra Read 862981 spots for SRR7169558.sra Written 862981 spots for SRR7169558.sra Read 862981 spots for SRR7169558.sra Written 862981 spots for SRR7169558.sra Read 862981 spots for SRR7169558.sra Written 862981 spots for SRR7169558.sra Read 862981 spots for SRR7169558.sra Written 862981 spots for SRR7169558.sra SRR ids: ['SRR7169558.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dun0lo6f SRR7169558.sra spots: 17259635 blocks: [[1, 862981], [862982, 1725962], [1725963, 2588943], [2588944, 3451924], [3451925, 4314905], [4314906, 5177886], [5177887, 6040867], [6040868, 6903848], [6903849, 7766829], [7766830, 8629810], [8629811, 9492791], [9492792, 10355772], [10355773, 11218753], [11218754, 12081734], [12081735, 12944715], [12944716, 13807696], [13807697, 14670677], [14670678, 15533658], [15533659, 16396639], [16396640, 17259635]] SRR7169558 file size 5827023 SRR7169558 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169558 SRR7169558_1.fastq SRR7169558_2.fastq Input file: SRR7169558_1.fastq Paired file: SRR7169558_2.fastq trimmed: SRR7169558-trimmed-pair1.fastq, SRR7169558-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 00:26:06 2025 >> started Tue Feb 11 00:26:26 2025 >> done (19.324s) 17259635 read pairs processed; of these: 38721 ( 0.22%) short read pairs filtered out after trimming by size control 37024 ( 0.21%) empty read pairs filtered out after trimming by size control 17183890 (99.56%) read pairs available; of these: 8106058 (47.17%) trimmed read pairs available after processing 9077832 (52.83%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 6 0.00% 20 1 0.00% 21 3 0.00% 22 3 0.00% 23 5 0.00% 24 9 0.00% 25 6 0.00% 26 5 0.00% 27 6 0.00% 28 5 0.00% 29 5 0.00% 30 9 0.00% 31 5 0.00% 32 8 0.00% 33 12 0.00% 34 12 0.00% 35 14 0.00% 36 11 0.00% 37 20 0.00% 38 22 0.00% 39 23 0.00% 40 26 0.00% 41 25 0.00% 42 29 0.00% 43 26 0.00% 44 24 0.00% 45 32 0.00% 46 47 0.00% 47 64 0.00% 48 36 0.00% 49 75 0.00% 50 81 0.00% 51 77 0.00% 52 108 0.00% 53 114 0.00% 54 112 0.00% 55 106 0.00% 56 123 0.00% 57 152 0.00% 58 180 0.00% 59 188 0.00% 60 240 0.00% 61 244 0.00% 62 253 0.00% 63 345 0.00% 64 383 0.00% 65 395 0.00% 66 467 0.00% 67 522 0.00% 68 616 0.00% 69 1163 0.01% 70 1324 0.01% 71 992 0.01% 72 1043 0.01% 73 1156 0.01% 74 1178 0.01% 75 1414 0.01% 76 1459 0.01% 77 1640 0.01% 78 1884 0.01% 79 2042 0.01% 80 2281 0.01% 81 2623 0.02% 82 3164 0.02% 83 3509 0.02% 84 4763 0.03% 85 5399 0.03% 86 5512 0.03% 87 5975 0.03% 88 6362 0.04% 89 6752 0.04% 90 7390 0.04% 91 8064 0.05% 92 8866 0.05% 93 9305 0.05% 94 10049 0.06% 95 10590 0.06% 96 11192 0.07% 97 11983 0.07% 98 12153 0.07% 99 12940 0.08% 100 13952 0.08% 101 14583 0.08% 102 15928 0.09% 103 16697 0.10% 104 17503 0.10% 105 18674 0.11% 106 19613 0.11% 107 20041 0.12% 108 20728 0.12% 109 22112 0.13% 110 22508 0.13% 111 23488 0.14% 112 24994 0.15% 113 26093 0.15% 114 27302 0.16% 115 28755 0.17% 116 29912 0.17% 117 31010 0.18% 118 32121 0.19% 119 33102 0.19% 120 34013 0.20% 121 35607 0.21% 122 37094 0.22% 123 38906 0.23% 124 40785 0.24% 125 42722 0.25% 126 44697 0.26% 127 46778 0.27% 128 48249 0.28% 129 50204 0.29% 130 52421 0.31% 131 55236 0.32% 132 58220 0.34% 133 61274 0.36% 134 65003 0.38% 135 69489 0.40% 136 73607 0.43% 137 78523 0.46% 138 83916 0.49% 139 89609 0.52% 140 96207 0.56% 141 103830 0.60% 142 113962 0.66% 143 126841 0.74% 144 146133 0.85% 145 171120 1.00% 146 208650 1.21% 147 281880 1.64% 148 427567 2.49% 149 843146 4.91% 150 3851802 22.42% 151 9077832 52.83% 17183890 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=3.01 fanout-score-rank=33 prefix-density=0.22 prefix-fanout=2.6 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.10 sequence-density-rank=20 fanout-score=245.31 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=28.0 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.83 fanout-score-rank=37 prefix-density=0.32 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=26 fanout-score=223.18 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=24.8 sequence=GAAGAAGAAGAAA SRR7169558 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 00:27:08 Started mapping on | Feb 11 00:27:09 Finished on | Feb 11 00:28:37 Mapping speed, Million of reads per hour | 702.98 Number of input reads | 17183890 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 16454013 Uniquely mapped reads % | 95.75% Average mapped length | 293.87 Number of splices: Total | 15557706 Number of splices: Annotated (sjdb) | 15301139 Number of splices: GT/AG | 15328722 Number of splices: GC/AG | 182836 Number of splices: AT/AC | 12743 Number of splices: Non-canonical | 33405 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 312908 % of reads mapped to multiple loci | 1.82% Number of reads mapped to too many loci | 31354 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.20% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 435773 435773 435773 N_multimapping 312908 312908 312908 N_noFeature 397819 16266975 489083 N_ambiguous 162747 950 66424 UnstrandedReadsAssigned:15893447 PositiveStrandReadsAssigned:186088 NegativeStrandReadsAssigned:15898506 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169558 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169558-trimmed-pair1.fastq SRR7169558-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,183,890 reads, 15,842,716 reads pseudoaligned [quant] estimated average fragment length: 244.112 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,165 rounds 52401 SRR7169558.ke.tsv 34699 SRR7169558.se.tsv 87100 total ==> SRR7169558.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1774.89 333 12.4484 Potri.005G024800.1.v4.1 1035 791.888 52 4.35693 Potri.004G059700.1.v4.1 961 717.9 10 0.924223 Potri.007G009000.2.v4.1 1416 1172.89 0 0 Potri.003G141000.2.v4.1 2943 2699.89 353.039 8.67597 Potri.016G087400.1.v4.1 270 79.5707 1058 882.212 Potri.015G069301.1.v4.1 564 326.35 0 0 Potri.010G195200.1.v4.1 1773 1529.89 32 1.38781 Potri.012G127500.1.v4.1 977 733.888 6328 572.107 ==> SRR7169558.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1719 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 258 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169558 completed mapping pipeline successfully