Starting /dee2/code/volunteer_pipeline.sh SRR7169559 current disk space = 3057205071872 free memory = 1253468776 SRR7169559 SRAfilesize 7cc467e3eb264568addecd38d31af2f5 SRR7169559.sra SRR7169559.sra file validated SRR7169559 is paired end SRR7169559 is conventional basespace SRR7169559 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169559_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.08475 34.0 33.0 34.0 2.0 34.0 2 32.787 34.0 33.0 34.0 28.0 34.0 3 32.949 34.0 33.0 34.0 30.0 34.0 4 33.36825 34.0 33.0 34.0 33.0 34.0 5 33.359 34.0 33.0 34.0 33.0 34.0 6 36.9865 38.0 37.0 38.0 36.0 38.0 7 37.31125 38.0 38.0 38.0 37.0 38.0 8 37.43775 38.0 38.0 38.0 37.0 38.0 9 37.5595 38.0 38.0 38.0 38.0 38.0 10-14 37.491949999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.51975 38.0 38.0 38.0 37.8 38.0 20-24 37.495099999999994 38.0 38.0 38.0 38.0 38.0 25-29 37.4269 38.0 38.0 38.0 37.2 38.0 30-34 37.38355 38.0 38.0 38.0 37.0 38.0 35-39 37.3402 38.0 38.0 38.0 37.0 38.0 40-44 37.04835 38.0 38.0 38.0 36.0 38.0 45-49 36.90319999999999 38.0 38.0 38.0 35.4 38.0 50-54 36.781600000000005 38.0 38.0 38.0 35.0 38.0 55-59 36.743550000000006 38.0 38.0 38.0 35.0 38.0 60-64 36.561499999999995 38.0 38.0 38.0 34.0 38.0 65-69 36.5381 38.0 38.0 38.0 34.2 38.0 70-74 36.4425 38.0 38.0 38.0 34.0 38.0 75-79 36.30245 38.0 37.6 38.0 33.8 38.0 80-84 36.17935000000001 38.0 37.2 38.0 33.2 38.0 85-89 36.034749999999995 38.0 37.0 38.0 32.8 38.0 90-94 35.75185 38.0 36.8 38.0 31.8 38.0 95-99 35.47745 38.0 36.6 38.0 29.8 38.0 100-104 35.147549999999995 38.0 36.0 38.0 28.8 38.0 105-109 34.967699999999994 38.0 35.6 38.0 27.8 38.0 110-114 34.663700000000006 38.0 35.0 38.0 26.4 38.0 115-119 34.44315 38.0 34.8 38.0 25.2 38.0 120-124 33.8339 38.0 34.0 38.0 21.0 38.0 125-129 33.5047 38.0 34.0 38.0 18.6 38.0 130-134 33.434749999999994 38.0 34.0 38.0 18.6 38.0 135-139 33.0477 38.0 33.6 38.0 16.2 38.0 140-144 32.19975 37.6 32.8 38.0 14.0 38.0 145-149 30.72065 36.0 30.6 38.0 6.4 38.0 150-151 26.539 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 2.0 11 2.0 12 0.0 13 4.0 14 4.0 15 3.0 16 9.0 17 4.0 18 9.0 19 7.0 20 6.0 21 15.0 22 12.0 23 13.0 24 16.0 25 25.0 26 23.0 27 31.0 28 41.0 29 53.0 30 50.0 31 88.0 32 119.0 33 162.0 34 204.0 35 435.0 36 1059.0 37 1603.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.91305563321219 14.844842046407605 8.023483365949119 34.218618954431086 2 24.65 13.600000000000001 30.3 31.45 3 18.775 18.375 25.525 37.325 4 21.4 27.175 24.05 27.375 5 21.475 29.975 24.5 24.05 6 20.175 33.650000000000006 25.45 20.724999999999998 7 14.249999999999998 29.9 38.95 16.900000000000002 8 18.175 27.975 30.0 23.849999999999998 9 15.75 27.775 34.300000000000004 22.175 10-14 19.515 31.165 27.02 22.3 15-19 19.295 30.159999999999997 27.195000000000004 23.35 20-24 19.585 29.585 27.37 23.46 25-29 19.665 29.580000000000002 27.200000000000003 23.555 30-34 19.355 28.96 27.575 24.11 35-39 20.115 29.409999999999997 27.134999999999998 23.34 40-44 19.830000000000002 28.939999999999998 27.61 23.62 45-49 19.77 29.53 27.42 23.28 50-54 19.455 29.585 27.12 23.84 55-59 19.605 28.725 27.525 24.145 60-64 20.325 28.99 27.025 23.66 65-69 19.68 28.939999999999998 27.315 24.065 70-74 19.99 28.935 27.155 23.919999999999998 75-79 20.22 28.425 27.235 24.12 80-84 19.835 28.585 27.0 24.58 85-89 19.955000000000002 28.405 27.665 23.974999999999998 90-94 20.285 28.555000000000003 27.389999999999997 23.77 95-99 20.04 27.994999999999997 27.42 24.545 100-104 20.625 28.205000000000002 27.284999999999997 23.885 105-109 20.75 28.199999999999996 26.840000000000003 24.21 110-114 20.09 28.720000000000002 26.96 24.23 115-119 20.244999999999997 28.810000000000002 27.025 23.919999999999998 120-124 20.65 27.634999999999998 27.525 24.19 125-129 20.855 28.425 26.284999999999997 24.435000000000002 130-134 20.64 28.37 26.36 24.63 135-139 20.66 28.365000000000002 26.97 24.005000000000003 140-144 20.855 27.455000000000002 26.834999999999997 24.855 145-149 20.515 28.349999999999998 26.86 24.275 150-151 21.65 27.8375 27.0 23.5125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 2.5 24 3.0 25 4.5 26 8.0 27 9.0 28 8.5 29 15.0 30 25.5 31 34.5 32 41.0 33 55.0 34 79.5 35 92.0 36 97.5 37 118.5 38 126.5 39 135.5 40 171.5 41 202.0 42 235.5 43 260.0 44 260.5 45 260.0 46 255.5 47 242.0 48 220.0 49 189.5 50 163.0 51 142.5 52 114.5 53 95.0 54 83.0 55 58.5 56 44.0 57 38.5 58 28.0 59 19.5 60 12.0 61 12.0 62 12.0 63 6.0 64 3.0 65 3.0 66 2.5 67 1.0 68 2.0 69 2.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 10.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.48750000000000004 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.6625000000000001 0.0 0.0 0.0 0.0 102-103 0.8125 0.0 0.0 0.0 0.0 104-105 0.8625 0.0 0.0 0.0 0.0 106-107 0.9875 0.0 0.0 0.0 0.0 108-109 1.1125 0.0 0.0 0.0 0.0 110-111 1.2125 0.0 0.0 0.0 0.0 112-113 1.4249999999999998 0.0 0.0 0.0 0.0 114-115 1.6124999999999998 0.0 0.0 0.0 0.0 116-117 1.75 0.0 0.0 0.0 0.0 118-119 2.0375 0.0 0.0 0.0 0.0 120-121 2.3375000000000004 0.0 0.0 0.0 0.0 122-123 2.7 0.0 0.0 0.0 0.0 124-125 3.0375 0.0 0.0 0.0 0.0 126-127 3.3875 0.0 0.0 0.0 0.0 128-129 3.8125 0.0 0.0 0.0 0.0 130-131 4.25 0.0 0.0 0.0 0.0 132-133 4.4125 0.0 0.0 0.0 0.0 134-135 4.8125 0.0 0.0 0.0 0.0 136-137 5.25 0.0 0.0 0.0 0.0 138-139 5.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCTTCT 10 0.0068449317 144.90001 145 CCACAGC 10 0.0068449317 144.90001 8 >>END_MODULE SRR7169559 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169559_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.69575 33.0 33.0 34.0 32.0 34.0 2 32.70575 34.0 33.0 34.0 32.0 34.0 3 32.842 34.0 33.0 34.0 32.0 34.0 4 32.853 34.0 33.0 34.0 32.0 34.0 5 32.86875 34.0 33.0 34.0 32.0 34.0 6 37.005 38.0 38.0 38.0 37.0 38.0 7 36.935 38.0 38.0 38.0 37.0 38.0 8 37.01925 38.0 38.0 38.0 37.0 38.0 9 37.02475 38.0 38.0 38.0 37.0 38.0 10-14 36.98885 38.0 38.0 38.0 37.0 38.0 15-19 36.991550000000004 38.0 38.0 38.0 37.0 38.0 20-24 36.915150000000004 38.0 38.0 38.0 37.0 38.0 25-29 36.8159 38.0 38.0 38.0 36.6 38.0 30-34 36.71885 38.0 38.0 38.0 36.2 38.0 35-39 36.78035 38.0 38.0 38.0 36.8 38.0 40-44 36.77305 38.0 38.0 38.0 36.8 38.0 45-49 36.59845 38.0 38.0 38.0 35.8 38.0 50-54 36.76435 38.0 38.0 38.0 36.0 38.0 55-59 36.646699999999996 38.0 38.0 38.0 36.0 38.0 60-64 36.52145 38.0 38.0 38.0 35.6 38.0 65-69 36.35755 38.0 38.0 38.0 35.0 38.0 70-74 36.402699999999996 38.0 38.0 38.0 35.0 38.0 75-79 36.34 38.0 38.0 38.0 34.8 38.0 80-84 36.2314 38.0 38.0 38.0 34.6 38.0 85-89 36.2274 38.0 38.0 38.0 34.2 38.0 90-94 35.959199999999996 38.0 38.0 38.0 34.0 38.0 95-99 35.9607 38.0 38.0 38.0 34.0 38.0 100-104 35.84205 38.0 38.0 38.0 33.6 38.0 105-109 35.71485 38.0 38.0 38.0 33.0 38.0 110-114 35.466449999999995 38.0 38.0 38.0 31.8 38.0 115-119 35.289049999999996 38.0 37.6 38.0 31.0 38.0 120-124 35.080600000000004 38.0 37.4 38.0 30.0 38.0 125-129 34.6995 38.0 36.0 38.0 27.4 38.0 130-134 34.3639 38.0 36.0 38.0 24.2 38.0 135-139 34.004400000000004 38.0 35.2 38.0 21.0 38.0 140-144 33.81245 38.0 35.2 38.0 22.0 38.0 145-149 33.05985 38.0 33.2 38.0 14.6 38.0 150-151 28.88375 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 27.0 3 2.0 4 3.0 5 4.0 6 2.0 7 4.0 8 3.0 9 3.0 10 2.0 11 2.0 12 2.0 13 5.0 14 5.0 15 9.0 16 3.0 17 7.0 18 7.0 19 11.0 20 11.0 21 14.0 22 14.0 23 11.0 24 19.0 25 24.0 26 29.0 27 20.0 28 29.0 29 38.0 30 32.0 31 46.0 32 55.0 33 71.0 34 123.0 35 203.0 36 410.0 37 2750.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.08247681123089 22.887941840060165 13.913261469039858 24.116319879669092 2 30.368328739664246 26.860435980957153 25.60761713856176 17.163618140816837 3 20.99724379854673 29.666750187922826 29.716862941618643 19.6191430719118 4 23.903783512904035 35.27937860185417 23.227261338010525 17.58957654723127 5 25.206715108995237 35.3545477323979 22.049611626158857 17.38912553244801 6 21.9438877755511 35.99699398797595 23.597194388777556 18.46192384769539 7 21.367735470941884 23.04609218436874 36.122244488977955 19.46392785571142 8 24.19839679358717 25.025050100200403 25.200400801603205 25.576152304609217 9 21.64328657314629 26.50300601202405 29.183366733466933 22.670340681362724 10-14 24.768298181453837 28.53063473773859 25.63999799609238 21.061069084715196 15-19 23.885158833550456 28.685239001904 26.550756588836556 20.87884557570899 20-24 23.7699168253332 28.319470888866622 26.86140895881351 21.04920332698667 25-29 24.174392382861438 28.263593084439993 26.404409922325232 21.15760461037334 30-34 23.283896181982165 28.063934261950095 27.287303337007717 21.364866219060026 35-39 23.94408537501879 28.212836314444612 27.02540207425222 20.81767623628438 40-44 24.663025504835396 28.4160946033973 26.356666833692437 20.564213058074863 45-49 24.204460035078927 28.799799548985217 26.389376096216488 20.60636431971937 50-54 24.467605351505735 28.09540512101017 26.957959613168313 20.47902991431578 55-59 24.393666065343755 28.48767288033674 26.483263178993788 20.63539787532572 60-64 24.715610122776248 27.366574793284894 27.276371836632425 20.64144324730644 65-69 24.30590357822993 27.88413350706625 27.64859176105042 20.161371153653405 70-74 24.64915797914996 27.541098636728144 27.485966319166 20.323777064955895 75-79 24.273255813953487 27.947072975140337 27.67141138732959 20.10825982357658 80-84 24.468724939855655 27.65637530072173 27.285485164394547 20.589414595028067 85-89 24.543905372894947 27.69647153167602 27.455894145950282 20.30372894947875 90-94 23.784461152882205 27.398496240601506 28.080200501253135 20.736842105263158 95-99 23.941049676675522 28.00641636172239 27.429946363226225 20.62258759837586 100-104 24.98621622976292 27.2116685880407 27.226705428299336 20.57540975389705 105-109 24.760663625883414 27.868277279334368 27.49235627286853 19.878702821913688 110-114 24.705528544935092 27.983559721317224 26.71545285950579 20.595458874241892 115-119 24.271893327986366 27.58032984109479 27.790866710110784 20.35691012080806 120-124 24.379605955782825 27.743520328871508 27.512909209404924 20.363964505940743 125-129 25.03509123721676 27.93262482454381 26.965109284138762 20.06717465410066 130-134 25.16420155427425 27.405364753070945 27.490599147656052 19.939834544998746 135-139 25.076452599388375 27.633228054344013 27.377550508848447 19.91276883741916 140-144 24.72800200551517 28.037102030584105 27.81649536224618 19.41840060165455 145-149 25.259463524692904 28.45826021559288 26.914013537227376 19.36826272248684 150-151 26.19852296908249 26.886969583176867 26.361246714232067 20.553260733508573 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 8.0 1 4.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 1.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 0.5 24 1.0 25 1.5 26 1.5 27 1.0 28 2.5 29 4.5 30 6.0 31 8.5 32 15.5 33 22.0 34 30.0 35 33.5 36 48.5 37 82.5 38 102.0 39 123.0 40 174.5 41 229.0 42 255.5 43 284.0 44 310.0 45 314.5 46 307.5 47 269.5 48 250.5 49 227.5 50 182.5 51 153.0 52 130.0 53 111.0 54 81.0 55 63.5 56 51.0 57 32.5 58 19.5 59 15.0 60 10.5 61 7.0 62 7.5 63 6.5 64 3.0 65 1.5 66 1.5 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.22499999999999998 3 0.22499999999999998 4 0.22499999999999998 5 0.22499999999999998 6 0.2 7 0.2 8 0.2 9 0.2 10-14 0.19499999999999998 15-19 0.21 20-24 0.21 25-29 0.22499999999999998 30-34 0.21 35-39 0.20500000000000002 40-44 0.215 45-49 0.22499999999999998 50-54 0.215 55-59 0.22 60-64 0.22499999999999998 65-69 0.22999999999999998 70-74 0.24 75-79 0.24 80-84 0.24 85-89 0.24 90-94 0.25 95-99 0.255 100-104 0.245 105-109 0.245 110-114 0.245 115-119 0.255 120-124 0.265 125-129 0.26 130-134 0.27499999999999997 135-139 0.265 140-144 0.27499999999999997 145-149 0.27499999999999997 150-151 0.13749999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34475806451613 98.55000000000001 2 0.6048387096774194 1.2 3 0.025201612903225805 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025201612903225805 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.4625 0.0 0.0 0.0 0.0 98-99 0.5875 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 0.7875000000000001 0.0 0.0 0.0 0.0 106-107 0.9125 0.0 0.0 0.0 0.0 108-109 1.0375 0.0 0.0 0.0 0.0 110-111 1.1625 0.0 0.0 0.0 0.0 112-113 1.375 0.0 0.0 0.0 0.0 114-115 1.5625 0.0 0.0 0.0 0.0 116-117 1.7 0.0 0.0 0.0 0.0 118-119 2.0 0.0 0.0 0.0 0.0 120-121 2.3 0.0 0.0 0.0 0.0 122-123 2.6500000000000004 0.0 0.0 0.0 0.0 124-125 3.0125 0.0 0.0 0.0 0.0 126-127 3.4124999999999996 0.0 0.0 0.0 0.0 128-129 3.8375000000000004 0.0 0.0 0.0 0.0 130-131 4.25 0.0 0.0 0.0 0.0 132-133 4.4 0.0 0.0 0.0 0.0 134-135 4.8125 0.0 0.0 0.0 0.0 136-137 5.275 0.0 0.0 0.0 0.0 138-139 5.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAAGCC 10 0.006830828 145.0 6 >>END_MODULE Read 997362 spots for SRR7169559.sra Written 997362 spots for SRR7169559.sra Read 997362 spots for SRR7169559.sra Written 997362 spots for SRR7169559.sra Read 997362 spots for SRR7169559.sra Written 997362 spots for SRR7169559.sra Read 997362 spots for SRR7169559.sra Written 997362 spots for SRR7169559.sra Read 997362 spots for SRR7169559.sra Written 997362 spots for SRR7169559.sra Read 997362 spots for SRR7169559.sra Written 997362 spots for SRR7169559.sra Read 997362 spots for SRR7169559.sra Written 997362 spots for SRR7169559.sra Read 997362 spots for SRR7169559.sra Written 997362 spots for SRR7169559.sra Read 997362 spots for SRR7169559.sra Written 997362 spots for SRR7169559.sra Read 997362 spots for SRR7169559.sra Read 997362 spots for SRR7169559.sra Written 997362 spots for SRR7169559.sra Written 997362 spots for SRR7169559.sra Read 997362 spots for SRR7169559.sra Written 997362 spots for SRR7169559.sra Read 997362 spots for SRR7169559.sra Written 997362 spots for SRR7169559.sra Read 997362 spots for SRR7169559.sra Written 997362 spots for SRR7169559.sra Read 997362 spots for SRR7169559.sra Written 997362 spots for SRR7169559.sra Read 997372 spots for SRR7169559.sra Written 997372 spots for SRR7169559.sra Read 997362 spots for SRR7169559.sra Written 997362 spots for SRR7169559.sra Read 997362 spots for SRR7169559.sra Written 997362 spots for SRR7169559.sra Read 997362 spots for SRR7169559.sra Written 997362 spots for SRR7169559.sra Read 997362 spots for SRR7169559.sra Written 997362 spots for SRR7169559.sra SRR ids: ['SRR7169559.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7myx08sv SRR7169559.sra spots: 19947250 blocks: [[1, 997362], [997363, 1994724], [1994725, 2992086], [2992087, 3989448], [3989449, 4986810], [4986811, 5984172], [5984173, 6981534], [6981535, 7978896], [7978897, 8976258], [8976259, 9973620], [9973621, 10970982], [10970983, 11968344], [11968345, 12965706], [12965707, 13963068], [13963069, 14960430], [14960431, 15957792], [15957793, 16955154], [16955155, 17952516], [17952517, 18949878], [18949879, 19947250]] SRR7169559 file size 6737768 SRR7169559 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169559 SRR7169559_1.fastq SRR7169559_2.fastq Input file: SRR7169559_1.fastq Paired file: SRR7169559_2.fastq trimmed: SRR7169559-trimmed-pair1.fastq, SRR7169559-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 00:39:58 2025 >> started Tue Feb 11 00:40:22 2025 >> done (23.709s) 19947250 read pairs processed; of these: 41954 ( 0.21%) short read pairs filtered out after trimming by size control 149459 ( 0.75%) empty read pairs filtered out after trimming by size control 19755837 (99.04%) read pairs available; of these: 10076258 (51.00%) trimmed read pairs available after processing 9679579 (49.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 8 0.00% 20 15 0.00% 21 7 0.00% 22 8 0.00% 23 14 0.00% 24 13 0.00% 25 17 0.00% 26 16 0.00% 27 17 0.00% 28 26 0.00% 29 26 0.00% 30 19 0.00% 31 15 0.00% 32 17 0.00% 33 27 0.00% 34 30 0.00% 35 17 0.00% 36 24 0.00% 37 25 0.00% 38 34 0.00% 39 37 0.00% 40 51 0.00% 41 44 0.00% 42 36 0.00% 43 73 0.00% 44 58 0.00% 45 91 0.00% 46 88 0.00% 47 102 0.00% 48 122 0.00% 49 123 0.00% 50 159 0.00% 51 150 0.00% 52 168 0.00% 53 194 0.00% 54 174 0.00% 55 198 0.00% 56 226 0.00% 57 252 0.00% 58 295 0.00% 59 323 0.00% 60 345 0.00% 61 407 0.00% 62 452 0.00% 63 477 0.00% 64 523 0.00% 65 668 0.00% 66 773 0.00% 67 1043 0.01% 68 1138 0.01% 69 1515 0.01% 70 2379 0.01% 71 1768 0.01% 72 1483 0.01% 73 1479 0.01% 74 1636 0.01% 75 1780 0.01% 76 1932 0.01% 77 2131 0.01% 78 2445 0.01% 79 2744 0.01% 80 3026 0.02% 81 3460 0.02% 82 3998 0.02% 83 4601 0.02% 84 6447 0.03% 85 7338 0.04% 86 7880 0.04% 87 8390 0.04% 88 8987 0.05% 89 9525 0.05% 90 9860 0.05% 91 10352 0.05% 92 11183 0.06% 93 12042 0.06% 94 12782 0.06% 95 13420 0.07% 96 14111 0.07% 97 15161 0.08% 98 15638 0.08% 99 15743 0.08% 100 16862 0.09% 101 17546 0.09% 102 18993 0.10% 103 19876 0.10% 104 21296 0.11% 105 23020 0.12% 106 23645 0.12% 107 24627 0.12% 108 25791 0.13% 109 26825 0.14% 110 27801 0.14% 111 28783 0.15% 112 30397 0.15% 113 32504 0.16% 114 33644 0.17% 115 35602 0.18% 116 36862 0.19% 117 38261 0.19% 118 39454 0.20% 119 40554 0.21% 120 42246 0.21% 121 43569 0.22% 122 45498 0.23% 123 48537 0.25% 124 51402 0.26% 125 53337 0.27% 126 56469 0.29% 127 58232 0.29% 128 61394 0.31% 129 63510 0.32% 130 66056 0.33% 131 68703 0.35% 132 72080 0.36% 133 76283 0.39% 134 80819 0.41% 135 86405 0.44% 136 90888 0.46% 137 96407 0.49% 138 102259 0.52% 139 109169 0.55% 140 117153 0.59% 141 126404 0.64% 142 140213 0.71% 143 159110 0.81% 144 181194 0.92% 145 213429 1.08% 146 264009 1.34% 147 360135 1.82% 148 547681 2.77% 149 1095758 5.55% 150 4711157 23.85% 151 9679579 49.00% 19755837 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.58 fanout-score-rank=38 prefix-density=0.18 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.10 sequence-density-rank=12 fanout-score=291.15 fanout-score-rank=1 prefix-density=1.04 prefix-fanout=28.9 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=5.11 fanout-score-rank=27 prefix-density=0.41 prefix-fanout=3.2 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.12 sequence-density-rank=9 fanout-score=288.24 fanout-score-rank=1 prefix-density=1.24 prefix-fanout=27.4 sequence=AAGAAGAAGAAG SRR7169559 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 00:41:11 Started mapping on | Feb 11 00:41:11 Finished on | Feb 11 00:43:39 Mapping speed, Million of reads per hour | 480.55 Number of input reads | 19755837 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 18478156 Uniquely mapped reads % | 93.53% Average mapped length | 293.36 Number of splices: Total | 16943151 Number of splices: Annotated (sjdb) | 16643741 Number of splices: GT/AG | 16686261 Number of splices: GC/AG | 206805 Number of splices: AT/AC | 14191 Number of splices: Non-canonical | 35894 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 385576 % of reads mapped to multiple loci | 1.95% Number of reads mapped to too many loci | 34430 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.28% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 920571 920571 920571 N_multimapping 385576 385576 385576 N_noFeature 383239 18267415 478982 N_ambiguous 190382 908 74894 UnstrandedReadsAssigned:17904535 PositiveStrandReadsAssigned:209833 NegativeStrandReadsAssigned:17924280 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169559 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169559-trimmed-pair1.fastq SRR7169559-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,755,837 reads, 17,842,256 reads pseudoaligned [quant] estimated average fragment length: 234.179 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,093 rounds 52401 SRR7169559.ke.tsv 34699 SRR7169559.se.tsv 87100 total ==> SRR7169559.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1784.82 304 7.75116 Potri.005G024800.1.v4.1 1035 801.821 58 3.29184 Potri.004G059700.1.v4.1 961 727.821 1 0.0625264 Potri.007G009000.2.v4.1 1416 1182.82 0 0 Potri.003G141000.2.v4.1 2943 2709.82 300 5.03812 Potri.016G087400.1.v4.1 270 79.0549 2103 1210.59 Potri.015G069301.1.v4.1 564 333.352 0 0 Potri.010G195200.1.v4.1 1773 1539.82 23 0.679744 Potri.012G127500.1.v4.1 977 743.821 8871 542.74 ==> SRR7169559.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1028 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 239 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 17 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169559 completed mapping pipeline successfully