Starting /dee2/code/volunteer_pipeline.sh SRR7169560 current disk space = 3057104805888 free memory = 1580033516 SRR7169560 SRAfilesize a41af6740d91477dc28389cd019e507d SRR7169560.sra SRR7169560.sra file validated SRR7169560 is paired end SRR7169560 is conventional basespace SRR7169560 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169560_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.10825 34.0 33.0 34.0 33.0 34.0 2 33.431 34.0 34.0 34.0 33.0 34.0 3 33.4625 34.0 34.0 34.0 33.0 34.0 4 33.451 34.0 34.0 34.0 33.0 34.0 5 33.54175 34.0 34.0 34.0 33.0 34.0 6 37.11725 38.0 37.0 38.0 36.0 38.0 7 37.40425 38.0 38.0 38.0 37.0 38.0 8 37.397 38.0 38.0 38.0 37.0 38.0 9 37.50225 38.0 38.0 38.0 37.0 38.0 10-14 37.4805 38.0 38.0 38.0 37.0 38.0 15-19 37.4287 38.0 38.0 38.0 37.0 38.0 20-24 37.426050000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.453 38.0 38.0 38.0 37.0 38.0 30-34 37.42355 38.0 38.0 38.0 37.0 38.0 35-39 37.32715 38.0 38.0 38.0 37.0 38.0 40-44 37.2542 38.0 38.0 38.0 36.6 38.0 45-49 37.203250000000004 38.0 38.0 38.0 36.0 38.0 50-54 37.11235 38.0 38.0 38.0 36.0 38.0 55-59 37.0796 38.0 38.0 38.0 36.0 38.0 60-64 37.036699999999996 38.0 38.0 38.0 36.0 38.0 65-69 36.96035 38.0 38.0 38.0 35.8 38.0 70-74 36.87445 38.0 38.0 38.0 35.4 38.0 75-79 36.84785 38.0 38.0 38.0 35.2 38.0 80-84 36.73485 38.0 38.0 38.0 34.8 38.0 85-89 36.7483 38.0 38.0 38.0 34.8 38.0 90-94 36.61385 38.0 38.0 38.0 34.2 38.0 95-99 36.5389 38.0 38.0 38.0 34.0 38.0 100-104 36.30795 38.0 37.8 38.0 33.8 38.0 105-109 36.16855 38.0 37.4 38.0 33.6 38.0 110-114 36.1123 38.0 37.2 38.0 33.2 38.0 115-119 35.8369 38.0 37.0 38.0 32.2 38.0 120-124 35.678200000000004 38.0 36.2 38.0 31.0 38.0 125-129 35.6169 38.0 36.4 38.0 31.0 38.0 130-134 35.408 38.0 36.0 38.0 30.4 38.0 135-139 35.17075 38.0 35.8 38.0 29.4 38.0 140-144 34.64395 38.0 35.0 38.0 27.6 38.0 145-149 34.0946 38.0 35.0 38.0 24.8 38.0 150-151 30.682499999999997 36.5 30.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 1.0 11 1.0 12 1.0 13 2.0 14 1.0 15 2.0 16 1.0 17 1.0 18 6.0 19 3.0 20 4.0 21 2.0 22 4.0 23 9.0 24 13.0 25 8.0 26 16.0 27 13.0 28 25.0 29 33.0 30 37.0 31 38.0 32 71.0 33 96.0 34 162.0 35 262.0 36 689.0 37 2497.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.07068659741576 12.693184697238408 8.614137319483152 35.62199138586268 2 24.3 13.375 31.4 30.925000000000004 3 20.1 18.25 25.624999999999996 36.025 4 22.35 25.0 22.325 30.325000000000003 5 22.900000000000002 29.2 24.65 23.25 6 21.725 33.074999999999996 24.4 20.8 7 14.924999999999999 28.775000000000002 39.574999999999996 16.725 8 17.45 27.400000000000002 29.95 25.2 9 17.95448862215554 25.03125781445361 33.53338334583646 23.48087021755439 10-14 19.36 30.555 26.855 23.23 15-19 19.84 28.93 27.22 24.01 20-24 20.035 29.09 27.834999999999997 23.04 25-29 19.67 28.860000000000003 27.77 23.7 30-34 20.565 28.57 27.32 23.544999999999998 35-39 20.22 28.79 27.134999999999998 23.855 40-44 20.06 28.735 27.400000000000002 23.805 45-49 20.155 28.725 26.765 24.355 50-54 20.19 29.07 27.215 23.525 55-59 20.549999999999997 29.020000000000003 26.950000000000003 23.48 60-64 20.365 28.845 26.484999999999996 24.305 65-69 20.35203520352035 28.452845284528454 26.897689768976896 24.2974297429743 70-74 20.080000000000002 28.744999999999997 26.96 24.215 75-79 20.165 28.255000000000003 27.200000000000003 24.38 80-84 19.869999999999997 28.735 26.965 24.43 85-89 20.68 28.215 26.915 24.19 90-94 21.154999999999998 27.229999999999997 26.924999999999997 24.69 95-99 19.939999999999998 28.055000000000003 27.93 24.075 100-104 20.505000000000003 28.015 27.02 24.46 105-109 20.84 28.244999999999997 27.055 23.86 110-114 20.49 28.139999999999997 27.43 23.94 115-119 20.59 27.67 27.67 24.07 120-124 20.36 27.29 27.43 24.92 125-129 20.544999999999998 28.175 27.250000000000004 24.03 130-134 21.060000000000002 28.455000000000002 26.735 23.75 135-139 21.065 27.41 27.33 24.195 140-144 20.89 28.425 26.650000000000002 24.035 145-149 21.015 27.91 27.205000000000002 23.87 150-151 20.625 27.787499999999998 26.637499999999996 24.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 0.5 24 0.0 25 2.0 26 3.0 27 3.0 28 5.5 29 10.5 30 16.0 31 22.0 32 27.0 33 41.5 34 54.0 35 54.0 36 71.0 37 105.0 38 127.0 39 144.0 40 169.0 41 198.0 42 231.5 43 253.5 44 265.0 45 272.0 46 261.5 47 262.5 48 261.5 49 238.5 50 195.0 51 147.0 52 122.0 53 103.0 54 89.0 55 67.0 56 44.0 57 37.5 58 25.5 59 13.0 60 13.0 61 9.5 62 6.5 63 5.5 64 5.0 65 5.5 66 3.5 67 1.5 68 1.0 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.025 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.01 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.2125 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.5249999999999999 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.825 0.0 0.0 0.0 0.0 104-105 0.9625 0.0 0.0 0.0 0.0 106-107 1.125 0.0 0.0 0.0 0.0 108-109 1.2875 0.0 0.0 0.0 0.0 110-111 1.55 0.0 0.0 0.0 0.0 112-113 1.6875 0.0 0.0 0.0 0.0 114-115 1.8875 0.0 0.0 0.0 0.0 116-117 2.0 0.0 0.0 0.0 0.0 118-119 2.25 0.0 0.0 0.0 0.0 120-121 2.5250000000000004 0.0 0.0 0.0 0.0 122-123 2.8375 0.0 0.0 0.0 0.0 124-125 3.175 0.0 0.0 0.0 0.0 126-127 3.5125 0.0 0.0 0.0 0.0 128-129 3.8375000000000004 0.0 0.0 0.0 0.0 130-131 4.362500000000001 0.0 0.0 0.0 0.0 132-133 4.8375 0.0 0.0 0.0 0.0 134-135 5.35 0.0 0.0 0.0 0.0 136-137 5.725 0.0 0.0 0.0 0.0 138-139 6.199999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169560 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169560_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.87625 33.0 33.0 34.0 32.0 34.0 2 32.956 33.0 33.0 34.0 32.0 34.0 3 32.9795 34.0 33.0 34.0 32.0 34.0 4 32.9625 34.0 33.0 34.0 32.0 34.0 5 32.9515 34.0 33.0 34.0 32.0 34.0 6 37.05175 38.0 38.0 38.0 37.0 38.0 7 37.12575 38.0 38.0 38.0 37.0 38.0 8 37.08475 38.0 38.0 38.0 37.0 38.0 9 37.02425 38.0 38.0 38.0 37.0 38.0 10-14 37.08675 38.0 38.0 38.0 37.0 38.0 15-19 37.02185 38.0 38.0 38.0 36.8 38.0 20-24 36.94375 38.0 38.0 38.0 36.6 38.0 25-29 36.90095 38.0 38.0 38.0 36.6 38.0 30-34 36.81425 38.0 38.0 38.0 36.0 38.0 35-39 36.874 38.0 38.0 38.0 36.0 38.0 40-44 36.94615 38.0 38.0 38.0 36.2 38.0 45-49 36.9259 38.0 38.0 38.0 36.2 38.0 50-54 36.89035 38.0 38.0 38.0 36.4 38.0 55-59 36.88555 38.0 38.0 38.0 36.2 38.0 60-64 36.8061 38.0 38.0 38.0 36.0 38.0 65-69 36.7264 38.0 38.0 38.0 36.0 38.0 70-74 36.6704 38.0 38.0 38.0 35.6 38.0 75-79 36.5914 38.0 38.0 38.0 35.2 38.0 80-84 36.413650000000004 38.0 38.0 38.0 34.0 38.0 85-89 36.3626 38.0 38.0 38.0 34.2 38.0 90-94 36.33415 38.0 38.0 38.0 34.0 38.0 95-99 36.220000000000006 38.0 38.0 38.0 34.2 38.0 100-104 36.20915000000001 38.0 38.0 38.0 34.0 38.0 105-109 36.11055 38.0 38.0 38.0 33.8 38.0 110-114 35.96385 38.0 38.0 38.0 33.2 38.0 115-119 35.75645 38.0 37.6 38.0 32.8 38.0 120-124 35.407999999999994 38.0 37.0 38.0 31.0 38.0 125-129 35.1721 38.0 36.2 38.0 29.8 38.0 130-134 34.821549999999995 38.0 36.0 38.0 27.6 38.0 135-139 34.599450000000004 38.0 35.6 38.0 27.2 38.0 140-144 34.19395 38.0 35.2 38.0 23.6 38.0 145-149 33.7348 38.0 35.0 38.0 20.8 38.0 150-151 29.909 36.0 28.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 4.0 4 3.0 5 0.0 6 0.0 7 2.0 8 0.0 9 2.0 10 3.0 11 1.0 12 3.0 13 1.0 14 5.0 15 3.0 16 5.0 17 6.0 18 5.0 19 4.0 20 2.0 21 12.0 22 7.0 23 10.0 24 12.0 25 18.0 26 21.0 27 20.0 28 25.0 29 46.0 30 42.0 31 47.0 32 79.0 33 93.0 34 99.0 35 219.0 36 532.0 37 2653.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.58658658658659 23.24824824824825 13.88888888888889 26.276276276276278 2 28.97897897897898 27.2022022022022 26.5015015015015 17.31731731731732 3 19.809666917104934 30.47833708990734 30.177811169546708 19.534184823441024 4 24.3993993993994 34.209209209209206 22.94794794794795 18.443443443443446 5 25.125125125125123 36.13613613613614 21.871871871871875 16.866866866866868 6 21.7129977460556 36.83946907087403 23.140495867768596 18.307037315301777 7 21.308598646277265 23.289044873401853 36.34996239659063 19.05239408373026 8 23.31411381298571 27.275006267234897 26.071697167209827 23.339182752569563 9 21.790371113340022 26.730190571715145 29.212637913741226 22.26680040120361 10-14 24.12082957619477 28.308786694719966 26.044484520589116 21.525899208496142 15-19 23.752065288138986 27.787513142742704 27.46708055875432 20.99334101036399 20-24 23.63554352728913 28.431814764697037 27.33423545331529 20.598406254698542 25-29 23.826226386731474 27.990178884601896 27.028110437440496 21.155484291226138 30-34 23.467548076923077 27.76943108974359 27.579126602564102 21.183894230769234 35-39 23.356054530874097 28.889334402566156 27.150160384923815 20.604450681635928 40-44 23.788745109840505 27.786137024776806 27.289597753034407 21.13552011234828 45-49 23.981151937440472 28.201914882951527 26.90861697328187 20.908316206326134 50-54 23.47102466412673 28.027872468417886 27.53158211349509 20.969520753960296 55-59 23.610137233296605 28.117800260442756 26.870680156265653 21.40138234999499 60-64 23.794486215538846 27.994987468671678 27.368421052631582 20.842105263157894 65-69 23.601643945469124 28.32297514033681 27.235364875701684 20.840016038492383 70-74 23.97212194143602 28.374448455675893 27.22121941436021 20.432210188527876 75-79 23.780151446767967 27.079885662704978 28.183140263778146 20.95682262674891 80-84 23.816924002406257 27.100461199117703 28.07800280729898 21.00461199117706 85-89 24.4758752131608 27.816230313973318 26.767980740294917 20.939913732570968 90-94 24.23422068481476 27.653281195167196 27.713440617636735 20.39905750238131 95-99 23.901387984165957 27.714586360675455 27.664478629052464 20.719547026106127 100-104 24.61916215674484 27.28001603527761 27.55061134495891 20.550210463018644 105-109 24.364948143694573 26.97028909263991 27.736860564156522 20.927902199508992 110-114 24.170426065162907 27.93483709273183 27.709273182957396 20.18546365914787 115-119 24.902275233035983 27.65861481407237 27.27773879923825 20.161371153653405 120-124 24.175107812656705 27.504763815063683 27.635141911543474 20.684986460736134 125-129 24.49706516831385 27.697787588421214 27.110821251191492 20.694325992073445 130-134 25.185631145896046 28.000200682319885 26.505117399157136 20.309050772626932 135-139 25.03511235955056 27.171950240770464 27.46789727126806 20.325040128410915 140-144 25.572997642810574 27.854957620743264 26.686393500175537 19.885651236270625 145-149 25.559121452211414 27.294153043827095 27.213920369070305 19.932805134891186 150-151 25.12518778167251 28.542814221331998 27.01552328492739 19.316474712068104 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 4.0 1 2.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 1.0 22 2.0 23 2.0 24 2.5 25 2.5 26 3.0 27 3.0 28 2.0 29 5.5 30 9.0 31 11.5 32 15.5 33 23.0 34 28.5 35 41.5 36 60.5 37 85.0 38 112.0 39 147.0 40 193.0 41 216.0 42 246.5 43 284.0 44 299.0 45 291.5 46 283.0 47 280.5 48 257.5 49 234.0 50 197.0 51 157.5 52 127.0 53 96.5 54 77.5 55 56.5 56 38.0 57 29.5 58 22.0 59 13.5 60 8.0 61 3.5 62 6.0 63 5.5 64 3.5 65 3.5 66 1.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.1 3 0.17500000000000002 4 0.1 5 0.1 6 0.17500000000000002 7 0.27499999999999997 8 0.27499999999999997 9 0.3 10-14 0.19 15-19 0.135 20-24 0.23500000000000001 25-29 0.215 30-34 0.16 35-39 0.24 40-44 0.31 45-49 0.255 50-54 0.26 55-59 0.16999999999999998 60-64 0.25 65-69 0.24 70-74 0.27999999999999997 75-79 0.295 80-84 0.26 85-89 0.31 90-94 0.265 95-99 0.215 100-104 0.22 105-109 0.20500000000000002 110-114 0.25 115-119 0.22999999999999998 120-124 0.29 125-129 0.335 130-134 0.33999999999999997 135-139 0.32 140-144 0.305 145-149 0.29 150-151 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47183098591549 98.875 2 0.4778672032193159 0.95 3 0.025150905432595575 0.075 4 0.025150905432595575 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.2125 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.5249999999999999 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.8375 0.0 0.0 0.0 0.0 104-105 1.0125 0.0 0.0 0.0 0.0 106-107 1.15 0.0 0.0 0.0 0.0 108-109 1.325 0.0 0.0 0.0 0.0 110-111 1.6 0.0 0.0 0.0 0.0 112-113 1.7374999999999998 0.0 0.0 0.0 0.0 114-115 1.925 0.0 0.0 0.0 0.0 116-117 2.0 0.0 0.0 0.0 0.0 118-119 2.25 0.0 0.0 0.0 0.0 120-121 2.55 0.0 0.0 0.0 0.0 122-123 2.8625 0.0 0.0 0.0 0.0 124-125 3.2249999999999996 0.0 0.0 0.0 0.0 126-127 3.5875000000000004 0.0 0.0 0.0 0.0 128-129 3.925 0.0 0.0 0.0 0.0 130-131 4.4625 0.0 0.0 0.0 0.0 132-133 4.9375 0.0 0.0 0.0 0.0 134-135 5.4375 0.0 0.0 0.0 0.0 136-137 5.800000000000001 0.0 0.0 0.0 0.0 138-139 6.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCAGTT 10 0.006830828 145.0 9 GAGAAGG 20 0.00593511 29.0 40-44 AAAAAAA 20 0.00593511 29.0 15-19 >>END_MODULE Read 1016469 spots for SRR7169560.sra Written 1016469 spots for SRR7169560.sra Read 1016469 spots for SRR7169560.sra Written 1016469 spots for SRR7169560.sra Read 1016469 spots for SRR7169560.sra Written 1016469 spots for SRR7169560.sra Read 1016469 spots for SRR7169560.sra Written 1016469 spots for SRR7169560.sra Read 1016482 spots for SRR7169560.sra Written 1016482 spots for SRR7169560.sra Read 1016469 spots for SRR7169560.sra Written 1016469 spots for SRR7169560.sra Read 1016469 spots for SRR7169560.sra Written 1016469 spots for SRR7169560.sra Read 1016469 spots for SRR7169560.sra Written 1016469 spots for SRR7169560.sra Read 1016469 spots for SRR7169560.sra Written 1016469 spots for SRR7169560.sra Read 1016469 spots for SRR7169560.sra Written 1016469 spots for SRR7169560.sra Read 1016469 spots for SRR7169560.sra Written 1016469 spots for SRR7169560.sra Read 1016469 spots for SRR7169560.sra Written 1016469 spots for SRR7169560.sra Read 1016469 spots for SRR7169560.sra Written 1016469 spots for SRR7169560.sra Read 1016469 spots for SRR7169560.sra Written 1016469 spots for SRR7169560.sra Read 1016469 spots for SRR7169560.sra Written 1016469 spots for SRR7169560.sra Read 1016469 spots for SRR7169560.sra Written 1016469 spots for SRR7169560.sra Read 1016469 spots for SRR7169560.sra Written 1016469 spots for SRR7169560.sra Read 1016469 spots for SRR7169560.sra Written 1016469 spots for SRR7169560.sra Read 1016469 spots for SRR7169560.sra Written 1016469 spots for SRR7169560.sra Read 1016469 spots for SRR7169560.sra Written 1016469 spots for SRR7169560.sra SRR ids: ['SRR7169560.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mnoylwoy SRR7169560.sra spots: 20329393 blocks: [[1, 1016469], [1016470, 2032938], [2032939, 3049407], [3049408, 4065876], [4065877, 5082345], [5082346, 6098814], [6098815, 7115283], [7115284, 8131752], [8131753, 9148221], [9148222, 10164690], [10164691, 11181159], [11181160, 12197628], [12197629, 13214097], [13214098, 14230566], [14230567, 15247035], [15247036, 16263504], [16263505, 17279973], [17279974, 18296442], [18296443, 19312911], [19312912, 20329393]] SRR7169560 file size 6867263 SRR7169560 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169560 SRR7169560_1.fastq SRR7169560_2.fastq Input file: SRR7169560_1.fastq Paired file: SRR7169560_2.fastq trimmed: SRR7169560-trimmed-pair1.fastq, SRR7169560-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 01:18:00 2025 >> started Tue Feb 11 01:18:22 2025 >> done (22.313s) 20329393 read pairs processed; of these: 29482 ( 0.15%) short read pairs filtered out after trimming by size control 68690 ( 0.34%) empty read pairs filtered out after trimming by size control 20231221 (99.52%) read pairs available; of these: 10274166 (50.78%) trimmed read pairs available after processing 9957055 (49.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 7 0.00% 20 4 0.00% 21 7 0.00% 22 10 0.00% 23 13 0.00% 24 9 0.00% 25 7 0.00% 26 10 0.00% 27 15 0.00% 28 13 0.00% 29 12 0.00% 30 14 0.00% 31 17 0.00% 32 12 0.00% 33 7 0.00% 34 14 0.00% 35 20 0.00% 36 22 0.00% 37 23 0.00% 38 25 0.00% 39 20 0.00% 40 24 0.00% 41 31 0.00% 42 27 0.00% 43 31 0.00% 44 45 0.00% 45 49 0.00% 46 66 0.00% 47 56 0.00% 48 49 0.00% 49 63 0.00% 50 87 0.00% 51 91 0.00% 52 103 0.00% 53 106 0.00% 54 115 0.00% 55 128 0.00% 56 149 0.00% 57 169 0.00% 58 201 0.00% 59 226 0.00% 60 284 0.00% 61 290 0.00% 62 316 0.00% 63 341 0.00% 64 413 0.00% 65 496 0.00% 66 639 0.00% 67 801 0.00% 68 1070 0.01% 69 1450 0.01% 70 1425 0.01% 71 1075 0.01% 72 1160 0.01% 73 1233 0.01% 74 1394 0.01% 75 1554 0.01% 76 1744 0.01% 77 1920 0.01% 78 2225 0.01% 79 2426 0.01% 80 2839 0.01% 81 3222 0.02% 82 3674 0.02% 83 4335 0.02% 84 5890 0.03% 85 6640 0.03% 86 7023 0.03% 87 7405 0.04% 88 8141 0.04% 89 8358 0.04% 90 8895 0.04% 91 9642 0.05% 92 10315 0.05% 93 10928 0.05% 94 11682 0.06% 95 12553 0.06% 96 13379 0.07% 97 14366 0.07% 98 14918 0.07% 99 15670 0.08% 100 16352 0.08% 101 17444 0.09% 102 18706 0.09% 103 19710 0.10% 104 20840 0.10% 105 22991 0.11% 106 23696 0.12% 107 24870 0.12% 108 25611 0.13% 109 26640 0.13% 110 27606 0.14% 111 28854 0.14% 112 30563 0.15% 113 32684 0.16% 114 34139 0.17% 115 35791 0.18% 116 37472 0.19% 117 39459 0.20% 118 40361 0.20% 119 41660 0.21% 120 42923 0.21% 121 44603 0.22% 122 47244 0.23% 123 49292 0.24% 124 51840 0.26% 125 54799 0.27% 126 57453 0.28% 127 59857 0.30% 128 63059 0.31% 129 65194 0.32% 130 69273 0.34% 131 71651 0.35% 132 74833 0.37% 133 79611 0.39% 134 85269 0.42% 135 89754 0.44% 136 95711 0.47% 137 101047 0.50% 138 108184 0.53% 139 116608 0.58% 140 124380 0.61% 141 135571 0.67% 142 150452 0.74% 143 167510 0.83% 144 193563 0.96% 145 232411 1.15% 146 286893 1.42% 147 386844 1.91% 148 592683 2.93% 149 1095768 5.42% 150 4710207 23.28% 151 9957055 49.22% 20231221 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.39 fanout-score-rank=40 prefix-density=0.20 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=422.67 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=19.0 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCAGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTAACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=5.55 fanout-score-rank=26 prefix-density=0.33 prefix-fanout=3.8 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=38 fanout-score=69.63 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=13.7 sequence=GAGAAGGCATACCATGAGCAGCTCTCTGTGGCTGAGATAACCAACAGTGCTTTTGAGCCATCATCCATGATGGCCAAGTGTGACCCACGTCATGGCAAGTACATGGCTTGCTGCCTGATGTATAGAGGTGATGTTGTGCCCAAGGATGTGAATGCAGCTGTGGCTACCATCAAGACCAAGCG SRR7169560 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 01:19:25 Started mapping on | Feb 11 01:19:25 Finished on | Feb 11 01:21:24 Mapping speed, Million of reads per hour | 612.04 Number of input reads | 20231221 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 19119507 Uniquely mapped reads % | 94.50% Average mapped length | 293.44 Number of splices: Total | 18117858 Number of splices: Annotated (sjdb) | 17798940 Number of splices: GT/AG | 17862847 Number of splices: GC/AG | 205504 Number of splices: AT/AC | 14915 Number of splices: Non-canonical | 34592 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 347200 % of reads mapped to multiple loci | 1.72% Number of reads mapped to too many loci | 22199 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.63% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 789537 789537 789537 N_multimapping 347200 347200 347200 N_noFeature 408134 18877316 516879 N_ambiguous 206242 1115 71970 UnstrandedReadsAssigned:18505131 PositiveStrandReadsAssigned:241076 NegativeStrandReadsAssigned:18530658 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169560 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169560-trimmed-pair1.fastq SRR7169560-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,231,221 reads, 18,427,210 reads pseudoaligned [quant] estimated average fragment length: 240.197 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,086 rounds 52401 SRR7169560.ke.tsv 34699 SRR7169560.se.tsv 87100 total ==> SRR7169560.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.8 362 10.2212 Potri.005G024800.1.v4.1 1035 795.803 26 1.64093 Potri.004G059700.1.v4.1 961 721.803 6 0.417499 Potri.007G009000.2.v4.1 1416 1176.8 0 0 Potri.003G141000.2.v4.1 2943 2703.8 321.031 5.96341 Potri.016G087400.1.v4.1 270 80.1679 2187 1370.16 Potri.015G069301.1.v4.1 564 329.38 0 0 Potri.010G195200.1.v4.1 1773 1533.8 22 0.720403 Potri.012G127500.1.v4.1 977 737.803 5535 376.79 ==> SRR7169560.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1200 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 257 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 23 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169560 completed mapping pipeline successfully