Starting /dee2/code/volunteer_pipeline.sh SRR7169561 current disk space = 2810480594944 free memory = 1576871284 SRR7169561 SRAfilesize 83ca6b18a7a61cf2d7cb284997724ecf SRR7169561.sra SRR7169561.sra file validated SRR7169561 is paired end SRR7169561 is conventional basespace SRR7169561 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169561_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.1245 34.0 33.0 34.0 32.0 34.0 2 33.161 34.0 33.0 34.0 31.0 34.0 3 33.224 34.0 33.0 34.0 31.0 34.0 4 33.3945 34.0 33.0 34.0 33.0 34.0 5 33.3795 34.0 33.0 34.0 33.0 34.0 6 36.9675 38.0 37.0 38.0 35.0 38.0 7 37.3385 38.0 38.0 38.0 37.0 38.0 8 37.365 38.0 38.0 38.0 37.0 38.0 9 37.465 38.0 38.0 38.0 37.0 38.0 10-14 37.434599999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.398799999999994 38.0 38.0 38.0 37.0 38.0 20-24 37.3745 38.0 38.0 38.0 37.0 38.0 25-29 37.2776 38.0 38.0 38.0 37.0 38.0 30-34 37.240899999999996 38.0 38.0 38.0 36.6 38.0 35-39 37.16765 38.0 38.0 38.0 36.4 38.0 40-44 36.80649999999999 38.0 38.0 38.0 35.2 38.0 45-49 36.662200000000006 38.0 38.0 38.0 34.0 38.0 50-54 36.5142 38.0 38.0 38.0 34.0 38.0 55-59 36.46055 38.0 38.0 38.0 34.0 38.0 60-64 36.38975 38.0 37.4 38.0 34.0 38.0 65-69 36.3198 38.0 37.2 38.0 33.6 38.0 70-74 36.222 38.0 37.0 38.0 33.0 38.0 75-79 36.04715 38.0 37.0 38.0 33.0 38.0 80-84 35.9072 38.0 37.0 38.0 31.8 38.0 85-89 35.7856 38.0 37.0 38.0 31.0 38.0 90-94 35.47665 38.0 36.2 38.0 29.2 38.0 95-99 35.362849999999995 38.0 36.0 38.0 29.0 38.0 100-104 35.0697 38.0 36.0 38.0 28.6 38.0 105-109 34.829899999999995 38.0 35.4 38.0 27.6 38.0 110-114 34.398199999999996 38.0 34.8 38.0 25.0 38.0 115-119 34.223349999999996 38.0 34.6 38.0 24.0 38.0 120-124 33.94565 38.0 34.0 38.0 23.0 38.0 125-129 33.6473 38.0 34.0 38.0 20.6 38.0 130-134 33.40225 38.0 34.0 38.0 19.8 38.0 135-139 32.6181 37.6 33.0 38.0 15.0 38.0 140-144 32.11145 36.8 32.8 38.0 14.0 38.0 145-149 31.1099 36.0 31.0 38.0 8.8 38.0 150-151 26.85925 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 3.0 11 1.0 12 3.0 13 2.0 14 2.0 15 3.0 16 4.0 17 6.0 18 10.0 19 11.0 20 13.0 21 14.0 22 12.0 23 20.0 24 19.0 25 27.0 26 19.0 27 27.0 28 43.0 29 49.0 30 65.0 31 100.0 32 122.0 33 164.0 34 256.0 35 440.0 36 990.0 37 1574.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.66050507680291 11.871908357198645 8.070814891955221 36.396771674043215 2 22.45 14.875 33.975 28.7 3 18.925 20.65 25.874999999999996 34.55 4 22.25 29.15 23.599999999999998 25.0 5 22.5 33.775 24.0 19.725 6 19.1 34.675 25.424999999999997 20.8 7 15.049999999999999 25.15 41.199999999999996 18.6 8 17.575 25.25 31.075000000000003 26.1 9 17.075000000000003 25.124999999999996 33.475 24.325 10-14 19.82 30.03 26.745 23.405 15-19 19.885 28.95 27.139999999999997 24.025 20-24 20.24 28.134999999999998 27.76 23.865 25-29 19.939999999999998 28.799999999999997 27.634999999999998 23.625 30-34 19.96 28.565 27.689999999999998 23.785 35-39 20.05 28.895 27.485 23.57 40-44 19.98 28.77 27.76 23.49 45-49 20.200000000000003 28.24 27.46 24.099999999999998 50-54 19.875 28.52 27.810000000000002 23.794999999999998 55-59 20.724999999999998 28.4 27.175 23.7 60-64 20.080000000000002 28.02 27.76 24.14 65-69 20.27 28.415000000000003 27.279999999999998 24.035 70-74 20.335 28.244999999999997 27.71 23.71 75-79 19.73 28.249999999999996 27.61 24.41 80-84 20.105 28.055000000000003 27.779999999999998 24.060000000000002 85-89 20.485 28.360000000000003 27.785 23.369999999999997 90-94 19.939999999999998 28.315 27.415 24.33 95-99 20.345 28.055000000000003 27.49 24.11 100-104 20.963215395409442 28.08960609401624 27.438107647589455 23.509070862984867 105-109 20.005 28.775000000000002 27.605 23.615 110-114 20.58321622164224 28.207187311784782 27.09295322224453 24.116643244328447 115-119 20.546847613801393 28.99494216034854 26.961790775702337 23.49641945014773 120-124 20.52091159529176 28.970698722764837 26.79188580015026 23.716503881793138 125-129 20.622840835127423 28.798878485956042 27.43203324488059 23.14624743403595 130-134 21.115000000000002 28.465 27.229999999999997 23.189999999999998 135-139 20.89 28.139999999999997 27.029999999999998 23.94 140-144 21.11 28.53 26.26 24.099999999999998 145-149 20.625 28.285 27.634999999999998 23.455000000000002 150-151 20.525 28.1875 27.3125 23.974999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 1.0 21 1.5 22 0.5 23 1.5 24 2.0 25 2.0 26 1.5 27 5.0 28 10.0 29 13.0 30 17.0 31 23.5 32 32.0 33 38.0 34 52.0 35 66.5 36 83.0 37 101.5 38 119.0 39 155.0 40 194.0 41 212.0 42 235.0 43 268.0 44 280.5 45 271.0 46 267.5 47 250.5 48 229.5 49 210.5 50 177.0 51 152.5 52 124.5 53 99.0 54 75.0 55 55.5 56 44.0 57 37.5 58 28.5 59 17.5 60 14.0 61 9.0 62 4.5 63 3.0 64 4.5 65 3.5 66 2.0 67 2.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.975 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.22999999999999998 105-109 0.0 110-114 0.38 115-119 0.155 120-124 0.17500000000000002 125-129 0.135 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.2625 0.0 0.0 0.0 0.0 98-99 0.30000000000000004 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.3625 0.0 0.0 0.0 0.0 104-105 0.425 0.0 0.0 0.0 0.0 106-107 0.4625 0.0 0.0 0.0 0.0 108-109 0.575 0.0 0.0 0.0 0.0 110-111 0.6375 0.0 0.0 0.0 0.0 112-113 0.7625 0.0 0.0 0.0 0.0 114-115 0.875 0.0 0.0 0.0 0.0 116-117 0.9874999999999999 0.0 0.0 0.0 0.0 118-119 1.125 0.0 0.0 0.0 0.0 120-121 1.3125 0.0 0.0 0.0 0.0 122-123 1.5375 0.0 0.0 0.0 0.0 124-125 1.7125 0.0 0.0 0.0 0.0 126-127 1.9125 0.0 0.0 0.0 0.0 128-129 2.15 0.0 0.0 0.0 0.0 130-131 2.4625 0.0 0.0 0.0 0.0 132-133 2.6875 0.0 0.0 0.0 0.0 134-135 2.9375 0.0 0.0 0.0 0.0 136-137 3.1125 0.0 0.0 0.0 0.0 138-139 3.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTCCAT 10 0.0060887975 150.61038 1 >>END_MODULE SRR7169561 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169561_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.55725 33.0 33.0 34.0 32.0 34.0 2 32.8585 34.0 33.0 34.0 32.0 34.0 3 32.91925 34.0 33.0 34.0 32.0 34.0 4 32.895 34.0 33.0 34.0 32.0 34.0 5 32.862 34.0 33.0 34.0 32.0 34.0 6 37.05375 38.0 38.0 38.0 37.0 38.0 7 37.03725 38.0 38.0 38.0 37.0 38.0 8 37.13075 38.0 38.0 38.0 37.0 38.0 9 37.039 38.0 38.0 38.0 37.0 38.0 10-14 37.066250000000004 38.0 38.0 38.0 36.8 38.0 15-19 37.04600000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.0146 38.0 38.0 38.0 36.2 38.0 25-29 37.04995000000001 38.0 38.0 38.0 36.8 38.0 30-34 37.01559999999999 38.0 38.0 38.0 36.8 38.0 35-39 36.9258 38.0 38.0 38.0 36.4 38.0 40-44 36.88645 38.0 38.0 38.0 36.2 38.0 45-49 36.89335 38.0 38.0 38.0 36.0 38.0 50-54 36.611399999999996 38.0 38.0 38.0 35.6 38.0 55-59 36.208 38.0 38.0 38.0 34.8 38.0 60-64 35.8757 38.0 38.0 38.0 33.8 38.0 65-69 35.6805 38.0 38.0 38.0 33.6 38.0 70-74 35.5758 38.0 38.0 38.0 33.2 38.0 75-79 35.463350000000005 38.0 38.0 38.0 33.0 38.0 80-84 35.620900000000006 38.0 38.0 38.0 32.6 38.0 85-89 35.73135 38.0 38.0 38.0 33.0 38.0 90-94 35.767900000000004 38.0 38.0 38.0 33.2 38.0 95-99 35.65255 38.0 38.0 38.0 32.6 38.0 100-104 35.4126 38.0 38.0 38.0 30.4 38.0 105-109 35.38675 38.0 37.8 38.0 30.6 38.0 110-114 35.3461 38.0 37.8 38.0 30.6 38.0 115-119 35.217949999999995 38.0 37.0 38.0 29.6 38.0 120-124 34.972300000000004 38.0 37.0 38.0 28.2 38.0 125-129 34.60535 38.0 36.0 38.0 26.6 38.0 130-134 34.13889999999999 38.0 35.8 38.0 23.2 38.0 135-139 33.53175 38.0 35.0 38.0 17.2 38.0 140-144 33.1293 38.0 35.0 38.0 14.0 38.0 145-149 32.176500000000004 38.0 34.4 38.0 6.4 38.0 150-151 28.542125 36.0 18.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 3.0 4 4.0 5 3.0 6 1.0 7 0.0 8 1.0 9 1.0 10 2.0 11 7.0 12 7.0 13 24.0 14 23.0 15 5.0 16 3.0 17 4.0 18 7.0 19 9.0 20 14.0 21 18.0 22 16.0 23 20.0 24 14.0 25 25.0 26 30.0 27 43.0 28 49.0 29 47.0 30 43.0 31 56.0 32 70.0 33 96.0 34 116.0 35 208.0 36 440.0 37 2586.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.74779319041614 21.689785624211854 12.534678436317781 26.027742749054223 2 26.900000000000002 25.6 31.525 15.975 3 20.3 27.400000000000002 30.475 21.825 4 23.075000000000003 35.225 23.599999999999998 18.099999999999998 5 23.575 36.175000000000004 22.225 18.025 6 21.099999999999998 37.425000000000004 22.625 18.85 7 18.825 21.099999999999998 40.375 19.7 8 22.0 25.974999999999998 27.975 24.05 9 22.75 24.525 29.15 23.575 10-14 23.580000000000002 28.73 26.46 21.23 15-19 23.755000000000003 28.299999999999997 27.334999999999997 20.61 20-24 23.345 28.62 26.979999999999997 21.055 25-29 23.26 27.779999999999998 28.025 20.935000000000002 30-34 23.18 28.325 27.68 20.815 35-39 22.975 28.485 27.43 21.11 40-44 23.585 28.349999999999998 27.79 20.275000000000002 45-49 23.71 28.435 27.229999999999997 20.625 50-54 23.563420642501633 28.259011613292444 27.791463475943896 20.386104268262027 55-59 23.631461131461133 28.286528286528284 27.78286528286528 20.299145299145298 60-64 23.338461538461537 28.53846153846154 27.482051282051284 20.64102564102564 65-69 23.916069495282777 28.360055678713202 27.395989070474812 20.327885755529206 70-74 23.824775286703172 27.56483107759066 27.978096910837895 20.632296724868272 75-79 23.829457364341085 27.581395348837205 28.13953488372093 20.449612403100776 80-84 23.647469458987782 27.78462170208397 28.107997125551794 20.45991171337645 85-89 23.77479728696007 27.72196440410016 28.063644244989543 20.439594063950228 90-94 23.7797437461867 28.02013422818792 27.770998576367706 20.429123449257677 95-99 23.827668546461414 27.480566986739824 28.095310674185846 20.596453792612916 100-104 23.882108674735402 28.03970223325062 27.740922671798245 20.33726642021573 105-109 24.07894736842105 27.332995951417004 27.49493927125506 21.093117408906885 110-114 23.71691250757729 27.066073954334207 28.24813093554253 20.968882602545968 115-119 24.17914964442427 28.173702526857312 27.573510869017 20.073636959701417 120-124 24.663337872597975 27.30115499066929 27.78534321884299 20.250163917889747 125-129 24.161141758186144 27.977124348398196 27.298952376132394 20.562781517283263 130-134 24.693056192368434 27.8516480717306 27.316725253451523 20.138570482449435 135-139 24.756034925526453 27.503852080123263 27.59116589625064 20.14894709809964 140-144 24.80699948533196 27.48327328872877 27.143592382913024 20.566134843026248 145-149 25.11630311175437 28.848340742272306 25.850304972604153 20.185051173369175 150-151 25.294956566835214 27.784260339686245 26.669259691430053 20.25152340204849 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 1.0 15 0.5 16 1.0 17 1.5 18 4.0 19 5.5 20 5.5 21 9.0 22 9.0 23 6.0 24 6.0 25 7.5 26 8.5 27 10.5 28 10.5 29 10.0 30 17.0 31 24.5 32 29.5 33 32.5 34 40.0 35 51.0 36 78.5 37 118.0 38 136.0 39 150.0 40 193.0 41 239.5 42 251.5 43 259.5 44 277.0 45 283.0 46 271.5 47 248.0 48 225.5 49 200.5 50 172.5 51 143.0 52 111.0 53 89.5 54 71.0 55 49.0 56 35.5 57 26.5 58 19.5 59 16.0 60 12.0 61 11.0 62 7.5 63 3.5 64 3.0 65 1.5 66 1.5 67 1.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8750000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.545 55-59 1.72 60-64 2.5 65-69 3.015 70-74 3.2099999999999995 75-79 3.25 80-84 2.59 85-89 1.955 90-94 1.66 95-99 1.585 100-104 1.265 105-109 1.2 110-114 1.02 115-119 0.865 120-124 0.865 125-129 1.205 130-134 1.855 135-139 2.65 140-144 2.85 145-149 3.27 150-151 3.5875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44668008048289 98.85000000000001 2 0.5030181086519114 1.0 3 0.05030181086519115 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.0875 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.4125 0.0 0.0 0.0 0.0 108-109 0.525 0.0 0.0 0.0 0.0 110-111 0.5874999999999999 0.0 0.0 0.0 0.0 112-113 0.7125 0.0 0.0 0.0 0.0 114-115 0.8375 0.0 0.0 0.0 0.0 116-117 0.975 0.0 0.0 0.0 0.0 118-119 1.125 0.0 0.0 0.0 0.0 120-121 1.3125 0.0 0.0 0.0 0.0 122-123 1.5375 0.0 0.0 0.0 0.0 124-125 1.7 0.0 0.0 0.0 0.0 126-127 1.875 0.0 0.0 0.0 0.0 128-129 2.1 0.0 0.0 0.0 0.0 130-131 2.3499999999999996 0.0 0.0 0.0 0.0 132-133 2.5875 0.0 0.0 0.0 0.0 134-135 2.85 0.0 0.0 0.0 0.0 136-137 3.025 0.0 0.0 0.0 0.0 138-139 3.2249999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCTCGT 10 0.0070282277 143.625 6 CCCAGAT 10 0.0070282277 143.625 1 TCTCGTG 10 0.0070282277 143.625 7 CTCGTGG 10 0.0070282277 143.625 8 >>END_MODULE Read 930391 spots for SRR7169561.sra Written 930391 spots for SRR7169561.sra Read 930391 spots for SRR7169561.sra Written 930391 spots for SRR7169561.sra Read 930391 spots for SRR7169561.sra Written 930391 spots for SRR7169561.sra Read 930391 spots for SRR7169561.sra Written 930391 spots for SRR7169561.sra Read 930391 spots for SRR7169561.sra Written 930391 spots for SRR7169561.sra Read 930392 spots for SRR7169561.sra Written 930392 spots for SRR7169561.sra Read 930391 spots for SRR7169561.sra Written 930391 spots for SRR7169561.sra Read 930391 spots for SRR7169561.sra Written 930391 spots for SRR7169561.sra Read 930391 spots for SRR7169561.sra Written 930391 spots for SRR7169561.sra Read 930391 spots for SRR7169561.sra Written 930391 spots for SRR7169561.sra Read 930391 spots for SRR7169561.sra Written 930391 spots for SRR7169561.sra Read 930391 spots for SRR7169561.sra Written 930391 spots for SRR7169561.sra Read 930391 spots for SRR7169561.sra Written 930391 spots for SRR7169561.sra Read 930391 spots for SRR7169561.sra Written 930391 spots for SRR7169561.sra Read 930391 spots for SRR7169561.sra Written 930391 spots for SRR7169561.sra Read 930391 spots for SRR7169561.sra Written 930391 spots for SRR7169561.sra Read 930391 spots for SRR7169561.sra Written 930391 spots for SRR7169561.sra Read 930391 spots for SRR7169561.sra Written 930391 spots for SRR7169561.sra Read 930391 spots for SRR7169561.sra Written 930391 spots for SRR7169561.sra Read 930391 spots for SRR7169561.sra Written 930391 spots for SRR7169561.sra SRR ids: ['SRR7169561.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tyn82p51 SRR7169561.sra spots: 18607821 blocks: [[1, 930391], [930392, 1860782], [1860783, 2791173], [2791174, 3721564], [3721565, 4651955], [4651956, 5582346], [5582347, 6512737], [6512738, 7443128], [7443129, 8373519], [8373520, 9303910], [9303911, 10234301], [10234302, 11164692], [11164693, 12095083], [12095084, 13025474], [13025475, 13955865], [13955866, 14886256], [14886257, 15816647], [15816648, 16747038], [16747039, 17677429], [17677430, 18607821]] SRR7169561 file size 6283879 SRR7169561 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169561 SRR7169561_1.fastq SRR7169561_2.fastq Input file: SRR7169561_1.fastq Paired file: SRR7169561_2.fastq trimmed: SRR7169561-trimmed-pair1.fastq, SRR7169561-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Apr 11 12:04:39 2025 >> started Fri Apr 11 12:04:59 2025 >> done (19.749s) 18607821 read pairs processed; of these: 18641 ( 0.10%) short read pairs filtered out after trimming by size control 14627 ( 0.08%) empty read pairs filtered out after trimming by size control 18574553 (99.82%) read pairs available; of these: 9237934 (49.73%) trimmed read pairs available after processing 9336619 (50.27%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 6 0.00% 20 7 0.00% 21 7 0.00% 22 5 0.00% 23 4 0.00% 24 7 0.00% 25 7 0.00% 26 10 0.00% 27 9 0.00% 28 11 0.00% 29 14 0.00% 30 20 0.00% 31 14 0.00% 32 16 0.00% 33 18 0.00% 34 14 0.00% 35 24 0.00% 36 20 0.00% 37 29 0.00% 38 29 0.00% 39 26 0.00% 40 39 0.00% 41 62 0.00% 42 55 0.00% 43 50 0.00% 44 56 0.00% 45 45 0.00% 46 64 0.00% 47 71 0.00% 48 68 0.00% 49 83 0.00% 50 86 0.00% 51 125 0.00% 52 129 0.00% 53 144 0.00% 54 143 0.00% 55 170 0.00% 56 179 0.00% 57 212 0.00% 58 183 0.00% 59 228 0.00% 60 283 0.00% 61 370 0.00% 62 401 0.00% 63 398 0.00% 64 446 0.00% 65 521 0.00% 66 570 0.00% 67 668 0.00% 68 741 0.00% 69 893 0.00% 70 1079 0.01% 71 1118 0.01% 72 1407 0.01% 73 1619 0.01% 74 1807 0.01% 75 2561 0.01% 76 2191 0.01% 77 1260 0.01% 78 1610 0.01% 79 2682 0.01% 80 4965 0.03% 81 2030 0.01% 82 2380 0.01% 83 2820 0.02% 84 3701 0.02% 85 4370 0.02% 86 5153 0.03% 87 5126 0.03% 88 4853 0.03% 89 5380 0.03% 90 5732 0.03% 91 6487 0.03% 92 6797 0.04% 93 7607 0.04% 94 8276 0.04% 95 8923 0.05% 96 9903 0.05% 97 11190 0.06% 98 13435 0.07% 99 19861 0.11% 100 24184 0.13% 101 14846 0.08% 102 12238 0.07% 103 12969 0.07% 104 13814 0.07% 105 14329 0.08% 106 15256 0.08% 107 16008 0.09% 108 16751 0.09% 109 17630 0.09% 110 18331 0.10% 111 19630 0.11% 112 21179 0.11% 113 22273 0.12% 114 23693 0.13% 115 24888 0.13% 116 26010 0.14% 117 27508 0.15% 118 28083 0.15% 119 29513 0.16% 120 30731 0.17% 121 32671 0.18% 122 34269 0.18% 123 36638 0.20% 124 38977 0.21% 125 41050 0.22% 126 43476 0.23% 127 45440 0.24% 128 47082 0.25% 129 49279 0.27% 130 52276 0.28% 131 55184 0.30% 132 59271 0.32% 133 63205 0.34% 134 68632 0.37% 135 73114 0.39% 136 79078 0.43% 137 84918 0.46% 138 92088 0.50% 139 100984 0.54% 140 109486 0.59% 141 120651 0.65% 142 135351 0.73% 143 150984 0.81% 144 178092 0.96% 145 216245 1.16% 146 275080 1.48% 147 377135 2.03% 148 567494 3.06% 149 1073347 5.78% 150 4342467 23.38% 151 9336619 50.27% 18574553 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=42 prefix-density=0.17 prefix-fanout=2.0 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.09 sequence-density-rank=19 fanout-score=300.33 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=30.7 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.59 fanout-score-rank=36 prefix-density=0.35 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=27 fanout-score=226.85 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=25.6 sequence=GAAGAAGAAGAAA SRR7169561 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 11 12:05:43 Started mapping on | Apr 11 12:05:44 Finished on | Apr 11 12:07:30 Mapping speed, Million of reads per hour | 630.83 Number of input reads | 18574553 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 17543211 Uniquely mapped reads % | 94.45% Average mapped length | 294.24 Number of splices: Total | 17207004 Number of splices: Annotated (sjdb) | 16925540 Number of splices: GT/AG | 16940232 Number of splices: GC/AG | 210480 Number of splices: AT/AC | 13359 Number of splices: Non-canonical | 42933 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 326006 % of reads mapped to multiple loci | 1.76% Number of reads mapped to too many loci | 74374 % of reads mapped to too many loci | 0.40% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.33% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 724207 724207 724207 N_multimapping 326006 326006 326006 N_noFeature 407645 17364061 500377 N_ambiguous 157268 698 70437 UnstrandedReadsAssigned:16978298 PositiveStrandReadsAssigned:178452 NegativeStrandReadsAssigned:16972397 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169561 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169561-trimmed-pair1.fastq SRR7169561-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,574,553 reads, 16,876,356 reads pseudoaligned [quant] estimated average fragment length: 252.609 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,190 rounds 52401 SRR7169561.ke.tsv 34699 SRR7169561.se.tsv 87100 total ==> SRR7169561.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.39 378 12.2867 Potri.005G024800.1.v4.1 1035 783.391 58 4.25089 Potri.004G059700.1.v4.1 961 709.46 8 0.64743 Potri.007G009000.2.v4.1 1416 1164.39 0 0 Potri.003G141000.2.v4.1 2943 2691.39 302.029 6.44323 Potri.016G087400.1.v4.1 270 73.7937 1515 1178.76 Potri.015G069301.1.v4.1 564 318.62 0 0 Potri.010G195200.1.v4.1 1773 1521.39 5 0.188695 Potri.012G127500.1.v4.1 977 725.439 7353 581.962 ==> SRR7169561.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 874 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 183 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169561 completed mapping pipeline successfully