Starting /dee2/code/volunteer_pipeline.sh SRR7169562 current disk space = 3057384681472 free memory = 1410232384 SRR7169562 SRAfilesize 2e89b5b77e388f2f30e624a655482ca2 SRR7169562.sra SRR7169562.sra file validated SRR7169562 is paired end SRR7169562 is conventional basespace SRR7169562 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169562_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.653 34.0 33.0 34.0 33.0 34.0 2 33.27025 34.0 33.0 34.0 33.0 34.0 3 33.29675 34.0 33.0 34.0 33.0 34.0 4 33.4405 34.0 33.0 34.0 33.0 34.0 5 33.3715 34.0 33.0 34.0 33.0 34.0 6 36.9295 38.0 37.0 38.0 35.0 38.0 7 37.248 38.0 38.0 38.0 36.0 38.0 8 37.34275 38.0 38.0 38.0 37.0 38.0 9 37.455 38.0 38.0 38.0 37.0 38.0 10-14 37.433949999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.38225 38.0 38.0 38.0 37.0 38.0 20-24 37.3393 38.0 38.0 38.0 37.0 38.0 25-29 37.27325 38.0 38.0 38.0 37.0 38.0 30-34 37.245799999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.2023 38.0 38.0 38.0 36.8 38.0 40-44 36.88015 38.0 38.0 38.0 35.4 38.0 45-49 36.721050000000005 38.0 38.0 38.0 34.4 38.0 50-54 36.6818 38.0 38.0 38.0 34.4 38.0 55-59 36.563300000000005 38.0 38.0 38.0 34.0 38.0 60-64 36.5355 38.0 38.0 38.0 34.0 38.0 65-69 36.3971 38.0 37.8 38.0 34.0 38.0 70-74 36.39045 38.0 37.8 38.0 34.0 38.0 75-79 36.20790000000001 38.0 37.2 38.0 33.4 38.0 80-84 36.0817 38.0 37.0 38.0 32.8 38.0 85-89 35.97485 38.0 37.0 38.0 32.6 38.0 90-94 35.7897 38.0 37.0 38.0 31.4 38.0 95-99 35.61195 38.0 36.6 38.0 30.6 38.0 100-104 35.30195 38.0 36.0 38.0 29.0 38.0 105-109 35.1894 38.0 36.0 38.0 28.8 38.0 110-114 34.66445 38.0 35.2 38.0 27.0 38.0 115-119 34.51615 38.0 35.0 38.0 26.4 38.0 120-124 34.3135 38.0 35.0 38.0 25.0 38.0 125-129 33.84125 38.0 34.0 38.0 22.6 38.0 130-134 33.684250000000006 38.0 34.0 38.0 22.2 38.0 135-139 32.955549999999995 38.0 33.6 38.0 14.8 38.0 140-144 32.48695 38.0 33.0 38.0 14.2 38.0 145-149 31.618000000000002 36.6 32.6 38.0 11.4 38.0 150-151 27.6095 35.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 1.0 9 1.0 10 1.0 11 1.0 12 2.0 13 1.0 14 2.0 15 7.0 16 1.0 17 2.0 18 10.0 19 8.0 20 11.0 21 16.0 22 13.0 23 15.0 24 20.0 25 25.0 26 24.0 27 34.0 28 36.0 29 46.0 30 49.0 31 69.0 32 109.0 33 160.0 34 228.0 35 394.0 36 986.0 37 1726.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.32548618219038 12.436028659160696 9.979529170931423 36.2589559877175 2 24.825 13.200000000000001 30.375000000000004 31.6 3 21.775 16.400000000000002 24.675 37.15 4 22.3 24.0 23.474999999999998 30.225 5 23.724999999999998 28.275 24.25 23.75 6 20.575 34.225 24.099999999999998 21.099999999999998 7 14.7 28.4 39.375 17.525 8 17.375 27.250000000000004 30.3 25.074999999999996 9 17.7 25.25 34.975 22.075 10-14 19.189999999999998 29.865000000000002 27.83 23.115 15-19 20.145 28.134999999999998 27.63 24.09 20-24 19.975 29.685 26.495 23.845 25-29 20.244999999999997 28.76 27.139999999999997 23.855 30-34 20.09 28.299999999999997 27.685 23.925 35-39 20.4 28.83 26.740000000000002 24.03 40-44 19.98 28.895 27.07 24.055 45-49 20.44 28.33 27.045 24.185000000000002 50-54 20.18 28.785 26.855 24.18 55-59 19.845 29.015 27.16 23.98 60-64 20.09 28.310000000000002 27.465 24.135 65-69 20.785 28.494999999999997 26.72 24.0 70-74 20.455000000000002 27.875 27.534999999999997 24.135 75-79 20.294999999999998 27.855 27.27 24.58 80-84 20.855 28.575 26.619999999999997 23.95 85-89 20.5 28.54 27.005000000000003 23.955000000000002 90-94 20.355 28.825 27.02 23.799999999999997 95-99 20.89 28.01 26.875 24.224999999999998 100-104 20.453748685330797 28.476987028597183 27.510392147042623 23.5588721390294 105-109 20.34 27.83 27.744999999999997 24.085 110-114 20.386061669591378 28.017046878917025 27.330157934319377 24.266733517172224 115-119 20.61370576162587 28.07228312559443 27.1061720979126 24.207839014867098 120-124 20.398458226961004 27.85703559092957 27.796966511488215 23.947539670621214 125-129 20.685857321652065 28.150187734668336 26.883604505632043 24.28035043804756 130-134 20.79 27.255000000000003 27.525 24.43 135-139 20.935000000000002 27.855 26.99 24.22 140-144 21.029999999999998 26.950000000000003 27.525 24.495 145-149 20.405 27.82 27.200000000000003 24.575 150-151 20.9375 27.700000000000003 26.737499999999997 24.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 1.0 23 2.5 24 2.5 25 2.5 26 4.0 27 4.5 28 4.0 29 7.0 30 11.5 31 16.0 32 27.5 33 42.5 34 46.0 35 54.0 36 69.5 37 93.0 38 120.5 39 147.0 40 171.5 41 200.0 42 235.5 43 243.0 44 256.0 45 275.5 46 273.5 47 268.0 48 256.0 49 238.5 50 201.0 51 153.0 52 129.0 53 110.0 54 87.0 55 67.0 56 47.0 57 31.5 58 22.5 59 19.5 60 15.0 61 8.5 62 5.5 63 5.0 64 5.5 65 5.5 66 2.5 67 1.5 68 2.0 69 2.0 70 2.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.165 105-109 0.0 110-114 0.27499999999999997 115-119 0.11499999999999999 120-124 0.11499999999999999 125-129 0.125 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.23750000000000002 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.5375 0.0 0.0 0.0 0.0 102-103 0.6125 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.8125 0.0 0.0 0.0 0.0 108-109 0.925 0.0 0.0 0.0 0.0 110-111 1.0625 0.0 0.0 0.0 0.0 112-113 1.1125 0.0 0.0 0.0 0.0 114-115 1.1749999999999998 0.0 0.0 0.0 0.0 116-117 1.3250000000000002 0.0 0.0 0.0 0.0 118-119 1.5875 0.0 0.0 0.0 0.0 120-121 1.7625 0.0 0.0 0.0 0.0 122-123 1.975 0.0 0.0 0.0 0.0 124-125 2.35 0.0 0.0 0.0 0.0 126-127 2.6125 0.0 0.0 0.0 0.0 128-129 2.9125 0.0 0.0 0.0 0.0 130-131 3.1875 0.0 0.0 0.0 0.0 132-133 3.3625 0.0 0.0 0.0 0.0 134-135 3.6125 0.0 0.0 0.0 0.0 136-137 3.9625000000000004 0.0 0.0 0.0 0.0 138-139 4.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTCCAT 10 0.006619789 146.50632 1 >>END_MODULE SRR7169562 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169562_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5135 33.0 33.0 34.0 32.0 34.0 2 32.86275 34.0 33.0 34.0 32.0 34.0 3 32.858 34.0 33.0 34.0 32.0 34.0 4 32.7515 34.0 33.0 34.0 32.0 34.0 5 32.7275 34.0 33.0 34.0 32.0 34.0 6 36.95075 38.0 38.0 38.0 36.0 38.0 7 36.97775 38.0 38.0 38.0 36.0 38.0 8 37.04575 38.0 38.0 38.0 36.0 38.0 9 36.8975 38.0 38.0 38.0 36.0 38.0 10-14 36.9535 38.0 38.0 38.0 36.2 38.0 15-19 36.97185 38.0 38.0 38.0 36.4 38.0 20-24 36.900549999999996 38.0 38.0 38.0 36.0 38.0 25-29 36.92075 38.0 38.0 38.0 36.0 38.0 30-34 36.842549999999996 38.0 38.0 38.0 36.0 38.0 35-39 36.827749999999995 38.0 38.0 38.0 36.0 38.0 40-44 36.76649999999999 38.0 38.0 38.0 36.0 38.0 45-49 36.78615 38.0 38.0 38.0 35.8 38.0 50-54 36.5698 38.0 38.0 38.0 35.4 38.0 55-59 36.33455 38.0 38.0 38.0 35.0 38.0 60-64 36.0649 38.0 38.0 38.0 34.0 38.0 65-69 35.9122 38.0 38.0 38.0 34.0 38.0 70-74 35.77255 38.0 38.0 38.0 33.6 38.0 75-79 35.7001 38.0 38.0 38.0 33.6 38.0 80-84 35.7745 38.0 38.0 38.0 33.2 38.0 85-89 35.829449999999994 38.0 38.0 38.0 33.4 38.0 90-94 35.86495000000001 38.0 38.0 38.0 33.6 38.0 95-99 35.689 38.0 38.0 38.0 33.0 38.0 100-104 35.464999999999996 38.0 38.0 38.0 31.0 38.0 105-109 35.3904 38.0 37.4 38.0 30.6 38.0 110-114 35.32215 38.0 37.4 38.0 30.2 38.0 115-119 35.125099999999996 38.0 37.0 38.0 29.2 38.0 120-124 34.9114 38.0 36.8 38.0 28.6 38.0 125-129 34.67144999999999 38.0 36.0 38.0 27.0 38.0 130-134 34.29774999999999 38.0 35.8 38.0 24.2 38.0 135-139 33.7297 38.0 35.0 38.0 19.0 38.0 140-144 33.2649 38.0 35.0 38.0 15.4 38.0 145-149 32.5166 38.0 34.4 38.0 9.0 38.0 150-151 28.923875 36.0 18.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 4.0 4 0.0 5 4.0 6 0.0 7 0.0 8 2.0 9 3.0 10 4.0 11 3.0 12 11.0 13 17.0 14 16.0 15 7.0 16 8.0 17 4.0 18 10.0 19 7.0 20 7.0 21 13.0 22 13.0 23 22.0 24 16.0 25 30.0 26 29.0 27 28.0 28 38.0 29 47.0 30 55.0 31 67.0 32 78.0 33 84.0 34 118.0 35 201.0 36 475.0 37 2569.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.11340206185567 23.00729192858939 13.879808901181795 25.99949710837314 2 27.200000000000003 27.625 28.025 17.150000000000002 3 21.525 28.525 29.375 20.575 4 24.2 33.0 24.775 18.025 5 26.1 33.6 22.05 18.25 6 21.325 36.65 23.325000000000003 18.7 7 20.775 22.5 37.3 19.425 8 22.975 25.900000000000002 26.05 25.074999999999996 9 22.025 25.324999999999996 30.725 21.925 10-14 24.055 28.67 25.545 21.73 15-19 23.09 27.755000000000003 27.55 21.605 20-24 24.07 28.24 26.950000000000003 20.74 25-29 24.104999999999997 28.205000000000002 27.02 20.669999999999998 30-34 23.315 27.779999999999998 27.139999999999997 21.765 35-39 23.595 28.110000000000003 27.74 20.555 40-44 24.169999999999998 28.244999999999997 26.784999999999997 20.8 45-49 23.215 28.265 27.474999999999998 21.044999999999998 50-54 24.372615940574182 27.479421802850833 27.454326440473803 20.693635816101185 55-59 23.46670708295443 28.27624532686673 27.270890168738 20.98615742144084 60-64 23.760666395774074 28.43356359203576 26.8488419341731 20.956928078017068 65-69 24.662076001020147 27.31956133639378 27.600102014792142 20.41826064779393 70-74 24.316870115940546 27.892129322233007 27.03917462587466 20.751825935951786 75-79 23.7686490905375 27.5035765379113 27.7232781524627 21.004496219088495 80-84 24.423213741233866 27.86868584205712 27.035267811769486 20.672832604939526 85-89 24.44984064349674 28.011332018009817 27.368847068346234 20.169980270147214 90-94 23.822029190444926 27.700621180748445 27.816776930458058 20.660572698348567 95-99 24.04724647922871 27.590732421382057 27.545303114431373 20.81671798495785 100-104 24.671069214094874 27.262186822604225 27.569692997933153 20.497050965367748 105-109 23.781686236960137 27.672226981807185 27.339615985486066 21.20647079574661 110-114 24.462352052379753 27.806597834298664 27.383530596826994 20.347519516494586 115-119 24.94464573268921 27.636876006441224 27.470813204508858 19.94766505636071 120-124 24.440533065124466 28.06135277847624 26.768921297460395 20.729192858938898 125-129 25.093236568894266 27.981050297349057 26.44894667876222 20.476766454994454 130-134 24.982303569622815 27.378905854990393 27.515421175042974 20.123369400343815 135-139 24.75202197466809 27.829492853146142 27.11735083168015 20.301134340505623 140-144 25.16809290953545 27.14445802770986 27.113895680521598 20.57355338223309 145-149 24.830088405130564 28.611579539066888 26.802595942562217 19.75573611324033 150-151 25.704045058883768 27.13773681515617 26.459293394777266 20.698924731182796 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 3.0 22 5.0 23 5.5 24 5.5 25 3.5 26 6.0 27 8.0 28 7.5 29 7.5 30 8.0 31 12.5 32 15.5 33 20.5 34 30.5 35 42.5 36 53.0 37 81.0 38 121.0 39 152.5 40 177.5 41 212.0 42 248.5 43 287.5 44 321.5 45 308.5 46 294.5 47 275.5 48 236.0 49 207.0 50 186.0 51 162.0 52 127.5 53 101.5 54 70.0 55 43.5 56 33.0 57 27.0 58 24.0 59 14.5 60 11.0 61 11.5 62 8.5 63 5.5 64 2.5 65 1.0 66 2.0 67 2.0 68 2.5 69 2.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.38 55-59 1.03 60-64 1.5599999999999998 65-69 1.975 70-74 2.105 75-79 2.1399999999999997 80-84 1.6099999999999999 85-89 1.165 90-94 0.9950000000000001 95-99 0.9450000000000001 100-104 0.815 105-109 0.7849999999999999 110-114 0.7250000000000001 115-119 0.64 120-124 0.575 125-129 0.79 130-134 1.11 135-139 1.7049999999999998 140-144 1.8399999999999999 145-149 2.155 150-151 2.35 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.23750000000000002 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.5874999999999999 0.0 0.0 0.0 0.0 104-105 0.6499999999999999 0.0 0.0 0.0 0.0 106-107 0.7875 0.0 0.0 0.0 0.0 108-109 0.9 0.0 0.0 0.0 0.0 110-111 0.9874999999999999 0.0 0.0 0.0 0.0 112-113 1.0375 0.0 0.0 0.0 0.0 114-115 1.1 0.0 0.0 0.0 0.0 116-117 1.2625000000000002 0.0 0.0 0.0 0.0 118-119 1.5125 0.0 0.0 0.0 0.0 120-121 1.6875 0.0 0.0 0.0 0.0 122-123 1.8875000000000002 0.0 0.0 0.0 0.0 124-125 2.2375 0.0 0.0 0.0 0.0 126-127 2.4875 0.0 0.0 0.0 0.0 128-129 2.8125 0.0 0.0 0.0 0.0 130-131 3.0625 0.0 0.0 0.0 0.0 132-133 3.225 0.0 0.0 0.0 0.0 134-135 3.4375 0.0 0.0 0.0 0.0 136-137 3.7625 0.0 0.0 0.0 0.0 138-139 4.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATTCTG 10 0.007085229 143.2375 4 >>END_MODULE Read 828852 spots for SRR7169562.sra Written 828852 spots for SRR7169562.sra Read 828852 spots for SRR7169562.sra Written 828852 spots for SRR7169562.sra Read 828852 spots for SRR7169562.sra Written 828852 spots for SRR7169562.sra Read 828852 spots for SRR7169562.sra Written 828852 spots for SRR7169562.sra Read 828852 spots for SRR7169562.sra Written 828852 spots for SRR7169562.sra Read 828852 spots for SRR7169562.sra Written 828852 spots for SRR7169562.sra Read 828852 spots for SRR7169562.sra Written 828852 spots for SRR7169562.sra Read 828852 spots for SRR7169562.sra Written 828852 spots for SRR7169562.sra Read 828852 spots for SRR7169562.sra Written 828852 spots for SRR7169562.sra Read 828868 spots for SRR7169562.sra Written 828868 spots for SRR7169562.sra Read 828852 spots for SRR7169562.sra Written 828852 spots for SRR7169562.sra Read 828852 spots for SRR7169562.sra Written 828852 spots for SRR7169562.sra Read 828852 spots for SRR7169562.sra Written 828852 spots for SRR7169562.sra Read 828852 spots for SRR7169562.sra Written 828852 spots for SRR7169562.sra Read 828852 spots for SRR7169562.sra Written 828852 spots for SRR7169562.sra Read 828852 spots for SRR7169562.sra Written 828852 spots for SRR7169562.sra Read 828852 spots for SRR7169562.sra Written 828852 spots for SRR7169562.sra Read 828852 spots for SRR7169562.sra Written 828852 spots for SRR7169562.sra Read 828852 spots for SRR7169562.sra Written 828852 spots for SRR7169562.sra Read 828852 spots for SRR7169562.sra Written 828852 spots for SRR7169562.sra SRR ids: ['SRR7169562.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qs8nmqse SRR7169562.sra spots: 16577056 blocks: [[1, 828852], [828853, 1657704], [1657705, 2486556], [2486557, 3315408], [3315409, 4144260], [4144261, 4973112], [4973113, 5801964], [5801965, 6630816], [6630817, 7459668], [7459669, 8288520], [8288521, 9117372], [9117373, 9946224], [9946225, 10775076], [10775077, 11603928], [11603929, 12432780], [12432781, 13261632], [13261633, 14090484], [14090485, 14919336], [14919337, 15748188], [15748189, 16577056]] SRR7169562 file size 5595719 SRR7169562 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169562 SRR7169562_1.fastq SRR7169562_2.fastq Input file: SRR7169562_1.fastq Paired file: SRR7169562_2.fastq trimmed: SRR7169562-trimmed-pair1.fastq, SRR7169562-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 00:21:14 2025 >> started Tue Feb 11 00:21:42 2025 >> done (28.139s) 16577056 read pairs processed; of these: 16557 ( 0.10%) short read pairs filtered out after trimming by size control 20372 ( 0.12%) empty read pairs filtered out after trimming by size control 16540127 (99.78%) read pairs available; of these: 8109762 (49.03%) trimmed read pairs available after processing 8430365 (50.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 9 0.00% 20 1 0.00% 21 3 0.00% 22 3 0.00% 23 9 0.00% 24 1 0.00% 25 3 0.00% 26 3 0.00% 27 8 0.00% 28 7 0.00% 29 6 0.00% 30 2 0.00% 31 9 0.00% 32 13 0.00% 33 16 0.00% 34 12 0.00% 35 20 0.00% 36 15 0.00% 37 29 0.00% 38 26 0.00% 39 19 0.00% 40 20 0.00% 41 25 0.00% 42 38 0.00% 43 33 0.00% 44 55 0.00% 45 53 0.00% 46 56 0.00% 47 57 0.00% 48 67 0.00% 49 79 0.00% 50 101 0.00% 51 101 0.00% 52 143 0.00% 53 117 0.00% 54 106 0.00% 55 128 0.00% 56 170 0.00% 57 175 0.00% 58 213 0.00% 59 243 0.00% 60 226 0.00% 61 292 0.00% 62 307 0.00% 63 338 0.00% 64 404 0.00% 65 472 0.00% 66 543 0.00% 67 661 0.00% 68 843 0.01% 69 1093 0.01% 70 1096 0.01% 71 1090 0.01% 72 1223 0.01% 73 1516 0.01% 74 1759 0.01% 75 2660 0.02% 76 2001 0.01% 77 1253 0.01% 78 1624 0.01% 79 2578 0.02% 80 4607 0.03% 81 2019 0.01% 82 2274 0.01% 83 2528 0.02% 84 3574 0.02% 85 4328 0.03% 86 5001 0.03% 87 5280 0.03% 88 5117 0.03% 89 5608 0.03% 90 5892 0.04% 91 6180 0.04% 92 6927 0.04% 93 7562 0.05% 94 8210 0.05% 95 9012 0.05% 96 9804 0.06% 97 11146 0.07% 98 13632 0.08% 99 18925 0.11% 100 22800 0.14% 101 14678 0.09% 102 12198 0.07% 103 12828 0.08% 104 13771 0.08% 105 14426 0.09% 106 15345 0.09% 107 15917 0.10% 108 16578 0.10% 109 17785 0.11% 110 18336 0.11% 111 19467 0.12% 112 20915 0.13% 113 21888 0.13% 114 23047 0.14% 115 24639 0.15% 116 25882 0.16% 117 26999 0.16% 118 27998 0.17% 119 29304 0.18% 120 30316 0.18% 121 31511 0.19% 122 33486 0.20% 123 35103 0.21% 124 36742 0.22% 125 38638 0.23% 126 41098 0.25% 127 43023 0.26% 128 45063 0.27% 129 46687 0.28% 130 49363 0.30% 131 51560 0.31% 132 54825 0.33% 133 58339 0.35% 134 62246 0.38% 135 66332 0.40% 136 70908 0.43% 137 76082 0.46% 138 82278 0.50% 139 89427 0.54% 140 96704 0.58% 141 105743 0.64% 142 117402 0.71% 143 129188 0.78% 144 152168 0.92% 145 181428 1.10% 146 229032 1.38% 147 313571 1.90% 148 473140 2.86% 149 903170 5.46% 150 3808589 23.03% 151 8430365 50.97% 16540127 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=11.85 fanout-score-rank=9 prefix-density=0.25 prefix-fanout=6.8 sequence=CAACCTCCTCATAATCCTTCTC criterion=fanout-score sequence-density=0.10 sequence-density-rank=16 fanout-score=277.02 fanout-score-rank=1 prefix-density=1.00 prefix-fanout=28.7 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=5.70 fanout-score-rank=23 prefix-density=0.33 prefix-fanout=3.9 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.11 sequence-density-rank=13 fanout-score=195.25 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=24.5 sequence=AGAAGAAGAAAT SRR7169562 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 00:22:39 Started mapping on | Feb 11 00:22:39 Finished on | Feb 11 00:25:02 Mapping speed, Million of reads per hour | 416.39 Number of input reads | 16540127 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 15587809 Uniquely mapped reads % | 94.24% Average mapped length | 294.02 Number of splices: Total | 15039621 Number of splices: Annotated (sjdb) | 14790330 Number of splices: GT/AG | 14807839 Number of splices: GC/AG | 182742 Number of splices: AT/AC | 11655 Number of splices: Non-canonical | 37385 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 306915 % of reads mapped to multiple loci | 1.86% Number of reads mapped to too many loci | 37333 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.62% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 662309 662309 662309 N_multimapping 306915 306915 306915 N_noFeature 297142 15420696 364226 N_ambiguous 161522 1045 60806 UnstrandedReadsAssigned:15129145 PositiveStrandReadsAssigned:166068 NegativeStrandReadsAssigned:15162777 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169562 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169562-trimmed-pair1.fastq SRR7169562-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,540,127 reads, 15,087,051 reads pseudoaligned [quant] estimated average fragment length: 244.258 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,062 rounds 52401 SRR7169562.ke.tsv 34699 SRR7169562.se.tsv 87100 total ==> SRR7169562.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1774.74 274 8.83967 Potri.005G024800.1.v4.1 1035 791.742 49 3.54351 Potri.004G059700.1.v4.1 961 717.756 5 0.398854 Potri.007G009000.2.v4.1 1416 1172.74 0 0 Potri.003G141000.2.v4.1 2943 2699.74 256.074 5.43081 Potri.016G087400.1.v4.1 270 75.0801 1529 1166.01 Potri.015G069301.1.v4.1 564 324.205 0 0 Potri.010G195200.1.v4.1 1773 1529.74 11 0.411714 Potri.012G127500.1.v4.1 977 733.749 7926 618.482 ==> SRR7169562.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 685 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 283 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 17 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169562 completed mapping pipeline successfully