Starting /dee2/code/volunteer_pipeline.sh SRR7169563 current disk space = 3057258143744 free memory = 1514172132 SRR7169563 SRAfilesize 6fbe472e137ca8d1fd1e6275e015a8e6 SRR7169563.sra SRR7169563.sra file validated SRR7169563 is paired end SRR7169563 is conventional basespace SRR7169563 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169563_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.206 34.0 33.0 34.0 32.0 34.0 2 33.095 34.0 33.0 34.0 32.0 34.0 3 33.1035 34.0 33.0 34.0 31.0 34.0 4 33.264 34.0 33.0 34.0 32.0 34.0 5 33.14375 34.0 33.0 34.0 32.0 34.0 6 36.63375 38.0 37.0 38.0 34.0 38.0 7 37.06975 38.0 38.0 38.0 36.0 38.0 8 37.2155 38.0 38.0 38.0 36.0 38.0 9 37.27325 38.0 38.0 38.0 37.0 38.0 10-14 37.37095000000001 38.0 38.0 38.0 37.0 38.0 15-19 37.26925 38.0 38.0 38.0 37.0 38.0 20-24 37.30965 38.0 38.0 38.0 37.0 38.0 25-29 37.25435 38.0 38.0 38.0 37.0 38.0 30-34 37.27505 38.0 38.0 38.0 36.8 38.0 35-39 37.168099999999995 38.0 38.0 38.0 36.4 38.0 40-44 36.9082 38.0 38.0 38.0 35.4 38.0 45-49 36.74980000000001 38.0 38.0 38.0 35.0 38.0 50-54 36.7134 38.0 38.0 38.0 34.4 38.0 55-59 36.5555 38.0 38.0 38.0 34.2 38.0 60-64 36.4552 38.0 38.0 38.0 34.0 38.0 65-69 36.43705 38.0 38.0 38.0 34.0 38.0 70-74 36.298449999999995 38.0 37.6 38.0 33.4 38.0 75-79 36.187 38.0 37.0 38.0 33.2 38.0 80-84 36.15835 38.0 37.0 38.0 33.2 38.0 85-89 35.9942 38.0 37.0 38.0 33.0 38.0 90-94 35.84425 38.0 37.0 38.0 31.4 38.0 95-99 35.6694 38.0 36.8 38.0 30.6 38.0 100-104 35.3563 38.0 36.0 38.0 29.0 38.0 105-109 35.2267 38.0 36.0 38.0 29.0 38.0 110-114 34.697 38.0 35.2 38.0 26.6 38.0 115-119 34.4042 38.0 35.0 38.0 24.8 38.0 120-124 34.26775 38.0 35.0 38.0 24.0 38.0 125-129 33.91685 38.0 34.4 38.0 23.0 38.0 130-134 33.49005 38.0 34.0 38.0 18.6 38.0 135-139 33.156150000000004 38.0 34.0 38.0 15.0 38.0 140-144 32.629599999999996 38.0 33.2 38.0 14.2 38.0 145-149 31.2257 36.0 31.4 38.0 8.8 38.0 150-151 27.5225 35.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 2.0 13 0.0 14 4.0 15 5.0 16 4.0 17 6.0 18 13.0 19 9.0 20 12.0 21 9.0 22 17.0 23 15.0 24 13.0 25 23.0 26 25.0 27 35.0 28 36.0 29 61.0 30 79.0 31 99.0 32 105.0 33 141.0 34 240.0 35 373.0 36 803.0 37 1870.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.93586759762089 11.792086889061288 9.361261960175847 34.910783553141975 2 25.5 14.35 31.8 28.349999999999998 3 20.849999999999998 18.3 26.724999999999998 34.125 4 22.7 27.05 24.349999999999998 25.900000000000002 5 23.375 30.65 21.975 24.0 6 19.925 34.849999999999994 25.3 19.925 7 14.424999999999999 27.825 40.150000000000006 17.599999999999998 8 18.0 25.900000000000002 30.099999999999998 26.0 9 17.05 24.7 33.625 24.625 10-14 19.759999999999998 30.18 26.655 23.405 15-19 20.185 28.725 27.134999999999998 23.955000000000002 20-24 20.119999999999997 28.439999999999998 27.77 23.669999999999998 25-29 20.064999999999998 28.865000000000002 27.425 23.645 30-34 20.155 29.13 26.924999999999997 23.79 35-39 20.09 29.110000000000003 27.12 23.68 40-44 20.150000000000002 28.76 27.655 23.435 45-49 19.945 28.76 27.215 24.08 50-54 20.330000000000002 28.225 27.405 24.04 55-59 20.215 29.044999999999998 26.91 23.830000000000002 60-64 20.47 28.444999999999997 27.334999999999997 23.75 65-69 20.945 28.29 27.22 23.544999999999998 70-74 20.685000000000002 28.33 27.105 23.880000000000003 75-79 20.875 28.465 27.08 23.580000000000002 80-84 21.099999999999998 28.37 26.615 23.915 85-89 20.835 28.165000000000003 27.139999999999997 23.86 90-94 20.560000000000002 28.655 26.900000000000002 23.885 95-99 20.645 28.310000000000002 26.855 24.19 100-104 20.538349927452845 28.978836243558316 26.877470355731226 23.605343473257616 105-109 20.65 28.854999999999997 26.765 23.73 110-114 20.794111756459046 28.274584418185462 26.937712797917087 23.993591027438413 115-119 20.82269929440024 28.589300905769903 26.902867437321724 23.68513236250813 120-124 20.36323610346725 28.158302896882976 27.20768499524691 24.27077600440286 125-129 21.01710171017102 27.972797279727974 27.117711771177117 23.89238923892389 130-134 21.355 27.845 26.900000000000002 23.9 135-139 21.16 28.375 26.77 23.695 140-144 21.745 27.715 26.87 23.669999999999998 145-149 21.21 28.12 26.575 24.095 150-151 20.974999999999998 27.55 26.6 24.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 1.0 15 1.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 1.5 23 2.0 24 1.5 25 2.0 26 6.5 27 8.5 28 9.5 29 10.0 30 13.0 31 23.0 32 30.0 33 37.0 34 44.0 35 58.0 36 79.0 37 92.5 38 126.0 39 153.0 40 171.0 41 207.0 42 234.5 43 251.0 44 280.0 45 278.0 46 259.5 47 256.5 48 237.5 49 205.5 50 181.0 51 157.0 52 119.0 53 109.5 54 93.0 55 62.0 56 44.5 57 27.5 58 26.0 59 26.0 60 14.5 61 10.5 62 11.5 63 8.0 64 5.5 65 5.5 66 3.5 67 1.5 68 1.5 69 2.5 70 2.0 71 1.5 72 1.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.065 105-109 0.0 110-114 0.13999999999999999 115-119 0.08499999999999999 120-124 0.065 125-129 0.01 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.30000000000000004 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.44999999999999996 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 0.975 0.0 0.0 0.0 0.0 110-111 1.125 0.0 0.0 0.0 0.0 112-113 1.3624999999999998 0.0 0.0 0.0 0.0 114-115 1.4375 0.0 0.0 0.0 0.0 116-117 1.5 0.0 0.0 0.0 0.0 118-119 1.675 0.0 0.0 0.0 0.0 120-121 2.0125 0.0 0.0 0.0 0.0 122-123 2.325 0.0 0.0 0.0 0.0 124-125 2.4875 0.0 0.0 0.0 0.0 126-127 2.8 0.0 0.0 0.0 0.0 128-129 3.05 0.0 0.0 0.0 0.0 130-131 3.4625 0.0 0.0 0.0 0.0 132-133 3.7125 0.0 0.0 0.0 0.0 134-135 4.012499999999999 0.0 0.0 0.0 0.0 136-137 4.300000000000001 0.0 0.0 0.0 0.0 138-139 4.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169563 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169563_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.371 33.0 33.0 34.0 32.0 34.0 2 32.678 33.0 33.0 34.0 32.0 34.0 3 32.64425 33.0 33.0 34.0 32.0 34.0 4 32.61525 33.0 33.0 34.0 32.0 34.0 5 32.71925 34.0 33.0 34.0 32.0 34.0 6 36.84325 38.0 38.0 38.0 36.0 38.0 7 36.8825 38.0 38.0 38.0 36.0 38.0 8 36.837 38.0 38.0 38.0 36.0 38.0 9 36.81025 38.0 38.0 38.0 36.0 38.0 10-14 36.785199999999996 38.0 38.0 38.0 35.8 38.0 15-19 36.73625 38.0 38.0 38.0 35.8 38.0 20-24 36.72495 38.0 38.0 38.0 35.8 38.0 25-29 36.7528 38.0 38.0 38.0 35.6 38.0 30-34 36.677299999999995 38.0 38.0 38.0 35.6 38.0 35-39 36.61545 38.0 38.0 38.0 35.2 38.0 40-44 36.518100000000004 38.0 38.0 38.0 34.8 38.0 45-49 36.50915 38.0 38.0 38.0 34.6 38.0 50-54 36.3005 38.0 38.0 38.0 34.2 38.0 55-59 35.9836 38.0 38.0 38.0 34.0 38.0 60-64 35.653 38.0 38.0 38.0 33.0 38.0 65-69 35.518449999999994 38.0 38.0 38.0 32.0 38.0 70-74 35.33585000000001 38.0 38.0 38.0 30.2 38.0 75-79 35.24715 38.0 38.0 38.0 29.4 38.0 80-84 35.36085 38.0 38.0 38.0 29.8 38.0 85-89 35.4811 38.0 38.0 38.0 31.0 38.0 90-94 35.450599999999994 38.0 38.0 38.0 30.6 38.0 95-99 35.283100000000005 38.0 37.4 38.0 29.8 38.0 100-104 35.09865 38.0 37.0 38.0 29.0 38.0 105-109 34.84010000000001 38.0 37.0 38.0 27.0 38.0 110-114 34.7741 38.0 37.0 38.0 26.6 38.0 115-119 34.755849999999995 38.0 36.6 38.0 27.2 38.0 120-124 34.3515 38.0 36.0 38.0 23.4 38.0 125-129 34.1203 38.0 35.8 38.0 23.0 38.0 130-134 33.8506 38.0 35.2 38.0 21.8 38.0 135-139 33.099000000000004 38.0 34.2 38.0 14.2 38.0 140-144 32.74335 38.0 34.6 38.0 13.8 38.0 145-149 31.59515 38.0 33.0 38.0 4.2 38.0 150-151 27.7845 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 7.0 4 3.0 5 1.0 6 3.0 7 1.0 8 0.0 9 1.0 10 5.0 11 8.0 12 12.0 13 21.0 14 23.0 15 8.0 16 8.0 17 1.0 18 5.0 19 6.0 20 12.0 21 14.0 22 19.0 23 21.0 24 28.0 25 23.0 26 50.0 27 52.0 28 42.0 29 59.0 30 54.0 31 82.0 32 71.0 33 111.0 34 162.0 35 235.0 36 484.0 37 2361.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.80100755667507 22.61964735516373 14.38287153652393 26.19647355163728 2 29.45 26.1 27.0 17.45 3 20.275000000000002 28.849999999999998 30.425 20.45 4 22.225 34.175 23.974999999999998 19.625 5 23.9 35.9 21.95 18.25 6 21.55 36.825 22.400000000000002 19.225 7 20.75 21.525 37.45 20.275000000000002 8 22.75 26.325 26.075 24.85 9 21.375 26.174999999999997 28.499999999999996 23.95 10-14 23.628544281642245 28.719307896184425 25.883882582387358 21.76826523978597 15-19 23.044999999999998 27.800000000000004 27.279999999999998 21.875 20-24 23.155 28.16 26.96 21.725 25-29 23.18 28.275 27.42 21.125 30-34 23.325000000000003 27.91 27.485 21.279999999999998 35-39 23.43 28.24 27.045 21.285 40-44 23.51 27.82 27.51 21.16 45-49 23.505000000000003 27.365000000000002 27.615000000000002 21.515 50-54 23.563709474742396 27.861271676300582 27.439055038954514 21.135963810002515 55-59 24.12149485320217 27.5138177577202 27.589878809391006 20.774808579686628 60-64 23.64398548131486 27.012933899084913 28.030264301416086 21.31281631818414 65-69 24.110306578339237 27.191495917424124 27.504750166897757 21.19344733733888 70-74 23.86562403539459 27.137565593168024 27.523407757999795 21.4734026134376 75-79 23.480051480051483 26.851994851994853 28.236808236808237 21.43114543114543 80-84 23.632273238572452 27.216484303098476 27.758462010430513 21.392780447898556 85-89 23.9169169678766 27.65870793666955 27.409255205416688 21.015119890037163 90-94 24.078300116638776 27.039910745981032 27.29854455094072 21.583244586439474 95-99 23.77190317026233 27.615719639420643 27.853742530132685 20.75863466018434 100-104 24.418604651162788 27.56825075834176 27.325581395348834 20.687563195146613 105-109 24.005660282003337 27.65452064486784 27.528175064436244 20.811644008692575 110-114 23.91523713420787 27.583249243188696 27.13925327951564 21.36226034308779 115-119 24.240742609222078 27.318131369185757 28.095045908586417 20.34608011300575 120-124 23.883377813585778 27.342766503852157 27.876529533209126 20.89732614935294 125-129 24.601769911504427 27.43362831858407 27.489254108723138 20.47534766118837 130-134 25.206926318996597 26.96389580053826 26.608439547047176 21.220738333417966 135-139 24.727941552138148 27.967097532314924 26.970827159863077 20.33413375568385 140-144 25.237851662404093 27.1304347826087 26.961636828644505 20.670076726342714 145-149 25.07201646090535 27.6440329218107 27.12448559670782 20.159465020576132 150-151 25.15241925022701 28.08405759501881 26.553379167207158 20.21014398754702 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 2.5 19 3.0 20 6.0 21 8.0 22 6.0 23 4.5 24 5.5 25 8.0 26 7.5 27 5.5 28 6.0 29 8.0 30 7.0 31 9.5 32 17.0 33 24.5 34 37.5 35 56.5 36 72.5 37 90.5 38 112.5 39 127.5 40 171.5 41 213.0 42 246.5 43 283.0 44 277.5 45 279.0 46 282.5 47 267.5 48 244.0 49 216.0 50 191.5 51 163.0 52 136.5 53 106.5 54 78.0 55 56.0 56 41.0 57 34.5 58 25.0 59 13.0 60 8.5 61 9.5 62 8.5 63 6.5 64 5.0 65 3.0 66 1.5 67 1.0 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.015 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.525 55-59 1.395 60-64 2.1950000000000003 65-69 2.635 70-74 2.81 75-79 2.875 80-84 2.21 85-89 1.7850000000000001 90-94 1.405 95-99 1.27 100-104 1.0999999999999999 105-109 1.065 110-114 0.8999999999999999 115-119 0.89 120-124 0.705 125-129 1.125 130-134 1.5350000000000001 135-139 2.1350000000000002 140-144 2.25 145-149 2.8000000000000003 150-151 3.6374999999999997 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57318604067285 99.15 2 0.42681395932714034 0.8500000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.32499999999999996 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 0.95 0.0 0.0 0.0 0.0 110-111 1.1 0.0 0.0 0.0 0.0 112-113 1.3375 0.0 0.0 0.0 0.0 114-115 1.4249999999999998 0.0 0.0 0.0 0.0 116-117 1.5 0.0 0.0 0.0 0.0 118-119 1.675 0.0 0.0 0.0 0.0 120-121 2.025 0.0 0.0 0.0 0.0 122-123 2.3625 0.0 0.0 0.0 0.0 124-125 2.5625 0.0 0.0 0.0 0.0 126-127 2.85 0.0 0.0 0.0 0.0 128-129 3.0999999999999996 0.0 0.0 0.0 0.0 130-131 3.525 0.0 0.0 0.0 0.0 132-133 3.7750000000000004 0.0 0.0 0.0 0.0 134-135 4.0 0.0 0.0 0.0 0.0 136-137 4.275 0.0 0.0 0.0 0.0 138-139 4.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 40 0.007756974 18.082386 45-49 AAAAAAA 85 0.0034823103 11.793972 25-29 >>END_MODULE Read 911140 spots for SRR7169563.sra Written 911140 spots for SRR7169563.sra Read 911140 spots for SRR7169563.sra Written 911140 spots for SRR7169563.sra Read 911140 spots for SRR7169563.sra Written 911140 spots for SRR7169563.sra Read 911140 spots for SRR7169563.sra Written 911140 spots for SRR7169563.sra Read 911140 spots for SRR7169563.sra Written 911140 spots for SRR7169563.sra Read 911140 spots for SRR7169563.sra Written 911140 spots for SRR7169563.sra Read 911140 spots for SRR7169563.sra Written 911140 spots for SRR7169563.sra Read 911140 spots for SRR7169563.sra Written 911140 spots for SRR7169563.sra Read 911140 spots for SRR7169563.sra Written 911140 spots for SRR7169563.sra Read 911140 spots for SRR7169563.sra Written 911140 spots for SRR7169563.sra Read 911140 spots for SRR7169563.sra Written 911140 spots for SRR7169563.sra Read 911140 spots for SRR7169563.sra Written 911140 spots for SRR7169563.sra Read 911154 spots for SRR7169563.sra Written 911154 spots for SRR7169563.sra Read 911140 spots for SRR7169563.sra Written 911140 spots for SRR7169563.sra Read 911140 spots for SRR7169563.sra Written 911140 spots for SRR7169563.sra Read 911140 spots for SRR7169563.sra Written 911140 spots for SRR7169563.sra Read 911140 spots for SRR7169563.sra Written 911140 spots for SRR7169563.sra Read 911140 spots for SRR7169563.sra Written 911140 spots for SRR7169563.sra Read 911140 spots for SRR7169563.sra Written 911140 spots for SRR7169563.sra Read 911140 spots for SRR7169563.sra Written 911140 spots for SRR7169563.sra SRR ids: ['SRR7169563.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zc35ca39 SRR7169563.sra spots: 18222814 blocks: [[1, 911140], [911141, 1822280], [1822281, 2733420], [2733421, 3644560], [3644561, 4555700], [4555701, 5466840], [5466841, 6377980], [6377981, 7289120], [7289121, 8200260], [8200261, 9111400], [9111401, 10022540], [10022541, 10933680], [10933681, 11844820], [11844821, 12755960], [12755961, 13667100], [13667101, 14578240], [14578241, 15489380], [15489381, 16400520], [16400521, 17311660], [17311661, 18222814]] SRR7169563 file size 6153413 SRR7169563 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169563 SRR7169563_1.fastq SRR7169563_2.fastq Input file: SRR7169563_1.fastq Paired file: SRR7169563_2.fastq trimmed: SRR7169563-trimmed-pair1.fastq, SRR7169563-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 01:06:36 2025 >> started Tue Feb 11 01:06:55 2025 >> done (19.110s) 18222814 read pairs processed; of these: 16855 ( 0.09%) short read pairs filtered out after trimming by size control 14733 ( 0.08%) empty read pairs filtered out after trimming by size control 18191226 (99.83%) read pairs available; of these: 9105506 (50.05%) trimmed read pairs available after processing 9085720 (49.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 8 0.00% 20 2 0.00% 21 2 0.00% 22 3 0.00% 23 9 0.00% 24 7 0.00% 25 8 0.00% 26 9 0.00% 27 10 0.00% 28 5 0.00% 29 6 0.00% 30 14 0.00% 31 11 0.00% 32 12 0.00% 33 14 0.00% 34 15 0.00% 35 11 0.00% 36 18 0.00% 37 22 0.00% 38 34 0.00% 39 30 0.00% 40 38 0.00% 41 32 0.00% 42 39 0.00% 43 39 0.00% 44 41 0.00% 45 65 0.00% 46 53 0.00% 47 75 0.00% 48 80 0.00% 49 85 0.00% 50 86 0.00% 51 106 0.00% 52 113 0.00% 53 120 0.00% 54 138 0.00% 55 171 0.00% 56 174 0.00% 57 194 0.00% 58 223 0.00% 59 261 0.00% 60 272 0.00% 61 319 0.00% 62 365 0.00% 63 425 0.00% 64 469 0.00% 65 519 0.00% 66 600 0.00% 67 658 0.00% 68 821 0.00% 69 1044 0.01% 70 1220 0.01% 71 1191 0.01% 72 1348 0.01% 73 1679 0.01% 74 1844 0.01% 75 2548 0.01% 76 2094 0.01% 77 1736 0.01% 78 2378 0.01% 79 3849 0.02% 80 6139 0.03% 81 2519 0.01% 82 2920 0.02% 83 3328 0.02% 84 4431 0.02% 85 5144 0.03% 86 5610 0.03% 87 6085 0.03% 88 6252 0.03% 89 6511 0.04% 90 7059 0.04% 91 7532 0.04% 92 8172 0.04% 93 8995 0.05% 94 9534 0.05% 95 10570 0.06% 96 11296 0.06% 97 12654 0.07% 98 14322 0.08% 99 18532 0.10% 100 22312 0.12% 101 17637 0.10% 102 14683 0.08% 103 14925 0.08% 104 15799 0.09% 105 16938 0.09% 106 17866 0.10% 107 18415 0.10% 108 19274 0.11% 109 20116 0.11% 110 21042 0.12% 111 22474 0.12% 112 23639 0.13% 113 24826 0.14% 114 26152 0.14% 115 27510 0.15% 116 28747 0.16% 117 30252 0.17% 118 31558 0.17% 119 32086 0.18% 120 33619 0.18% 121 35044 0.19% 122 36902 0.20% 123 39114 0.22% 124 41692 0.23% 125 43591 0.24% 126 46193 0.25% 127 48086 0.26% 128 50170 0.28% 129 52666 0.29% 130 55036 0.30% 131 58072 0.32% 132 61330 0.34% 133 65826 0.36% 134 70063 0.39% 135 74810 0.41% 136 79795 0.44% 137 86075 0.47% 138 93538 0.51% 139 101355 0.56% 140 109872 0.60% 141 120482 0.66% 142 133792 0.74% 143 150235 0.83% 144 174213 0.96% 145 209440 1.15% 146 256402 1.41% 147 350296 1.93% 148 524443 2.88% 149 995048 5.47% 150 4276686 23.51% 151 9085720 49.95% 18191226 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=36 prefix-density=0.23 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=237.08 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=17.0 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAACAAGGAGTTCAGCAGCCTGTACTCCATGGTAAGGATCAATATGGAATCCGGATTTTCCATGCACAATGATCTCAGCA criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=6.07 fanout-score-rank=26 prefix-density=0.31 prefix-fanout=4.0 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.04 sequence-density-rank=40 fanout-score=151.49 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=14.1 sequence=AGAAAGAAATGAGAATTCTCATGGTGGGTCTTGATGCTGCTGGTAAGACCACCATCTTGTACAAGCTCAA SRR7169563 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 01:07:39 Started mapping on | Feb 11 01:07:39 Finished on | Feb 11 01:09:33 Mapping speed, Million of reads per hour | 574.46 Number of input reads | 18191226 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 16959021 Uniquely mapped reads % | 93.23% Average mapped length | 293.82 Number of splices: Total | 15523412 Number of splices: Annotated (sjdb) | 15255164 Number of splices: GT/AG | 15297045 Number of splices: GC/AG | 175675 Number of splices: AT/AC | 13121 Number of splices: Non-canonical | 37571 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 355556 % of reads mapped to multiple loci | 1.95% Number of reads mapped to too many loci | 22454 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.66% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 895939 895939 895939 N_multimapping 355556 355556 355556 N_noFeature 350501 16752306 437101 N_ambiguous 186534 1412 65303 UnstrandedReadsAssigned:16421986 PositiveStrandReadsAssigned:205303 NegativeStrandReadsAssigned:16456617 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169563 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169563-trimmed-pair1.fastq SRR7169563-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,191,226 reads, 16,375,889 reads pseudoaligned [quant] estimated average fragment length: 251.58 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,092 rounds 52401 SRR7169563.ke.tsv 34699 SRR7169563.se.tsv 87100 total ==> SRR7169563.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1767.42 255 7.56367 Potri.005G024800.1.v4.1 1035 784.42 39 2.60644 Potri.004G059700.1.v4.1 961 710.452 2 0.14758 Potri.007G009000.2.v4.1 1416 1165.42 0 0 Potri.003G141000.2.v4.1 2943 2692.42 349.047 6.7963 Potri.016G087400.1.v4.1 270 75.4478 1863 1294.49 Potri.015G069301.1.v4.1 564 318.52 0 0 Potri.010G195200.1.v4.1 1773 1522.42 25 0.86087 Potri.012G127500.1.v4.1 977 726.441 9252 667.678 ==> SRR7169563.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1116 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 304 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7169563 completed mapping pipeline successfully