Starting /dee2/code/volunteer_pipeline.sh SRR7169564 current disk space = 3057211301888 free memory = 1411274568 SRR7169564 SRAfilesize 5ecaabae08310b0bcbb13cd210e27bb5 SRR7169564.sra SRR7169564.sra file validated SRR7169564 is paired end SRR7169564 is conventional basespace SRR7169564 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169564_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.38025 34.0 33.0 34.0 32.0 34.0 2 33.22275 34.0 33.0 34.0 32.0 34.0 3 33.18375 34.0 33.0 34.0 31.0 34.0 4 33.3125 34.0 33.0 34.0 33.0 34.0 5 33.21325 34.0 33.0 34.0 33.0 34.0 6 36.8255 38.0 37.0 38.0 35.0 38.0 7 37.02125 38.0 38.0 38.0 36.0 38.0 8 37.26475 38.0 38.0 38.0 37.0 38.0 9 37.28275 38.0 38.0 38.0 37.0 38.0 10-14 37.3425 38.0 38.0 38.0 37.0 38.0 15-19 37.388749999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.34035 38.0 38.0 38.0 37.0 38.0 25-29 37.3012 38.0 38.0 38.0 37.0 38.0 30-34 37.23924999999999 38.0 38.0 38.0 37.0 38.0 35-39 37.1604 38.0 38.0 38.0 36.6 38.0 40-44 37.00835 38.0 38.0 38.0 35.8 38.0 45-49 36.85365 38.0 38.0 38.0 35.2 38.0 50-54 36.77184999999999 38.0 38.0 38.0 35.0 38.0 55-59 36.62675 38.0 38.0 38.0 34.4 38.0 60-64 36.53735 38.0 38.0 38.0 34.0 38.0 65-69 36.5504 38.0 38.0 38.0 34.0 38.0 70-74 36.45354999999999 38.0 38.0 38.0 34.0 38.0 75-79 36.16799999999999 38.0 37.0 38.0 33.0 38.0 80-84 36.1819 38.0 37.4 38.0 33.4 38.0 85-89 35.999700000000004 38.0 37.0 38.0 32.4 38.0 90-94 35.78725 38.0 37.0 38.0 31.0 38.0 95-99 35.674099999999996 38.0 36.8 38.0 30.8 38.0 100-104 35.315250000000006 38.0 36.2 38.0 29.0 38.0 105-109 35.12205 38.0 36.0 38.0 28.6 38.0 110-114 34.7245 38.0 35.6 38.0 27.0 38.0 115-119 34.493199999999995 38.0 35.0 38.0 25.0 38.0 120-124 34.3121 38.0 34.8 38.0 24.8 38.0 125-129 33.9458 38.0 34.4 38.0 21.0 38.0 130-134 33.72425 38.0 34.0 38.0 21.8 38.0 135-139 33.33275 38.0 34.0 38.0 16.2 38.0 140-144 32.80565 38.0 33.2 38.0 15.6 38.0 145-149 31.2536 36.2 31.4 38.0 9.0 38.0 150-151 27.59325 35.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 2.0 10 1.0 11 2.0 12 0.0 13 2.0 14 4.0 15 4.0 16 8.0 17 9.0 18 11.0 19 6.0 20 7.0 21 10.0 22 4.0 23 10.0 24 7.0 25 20.0 26 33.0 27 35.0 28 50.0 29 59.0 30 65.0 31 81.0 32 121.0 33 150.0 34 208.0 35 373.0 36 845.0 37 1872.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.805569881382155 12.119649303764827 8.92212480660134 36.152656008251675 2 24.85 14.249999999999998 31.55 29.349999999999998 3 19.575 18.775 26.325 35.325 4 23.175 26.85 23.150000000000002 26.825 5 23.05 33.275 22.425 21.25 6 19.575 36.15 23.625 20.65 7 14.549999999999999 27.875 41.5 16.075 8 18.425 26.275 30.25 25.05 9 18.099999999999998 25.224999999999998 33.6 23.075000000000003 10-14 19.6 30.620000000000005 26.919999999999998 22.86 15-19 20.244999999999997 29.294999999999998 27.11 23.35 20-24 19.93 29.459999999999997 27.355 23.255 25-29 20.32 28.83 27.61 23.24 30-34 19.81 28.93 27.72 23.54 35-39 20.0 28.355000000000004 27.42 24.224999999999998 40-44 19.865 29.39 27.205000000000002 23.54 45-49 19.98 28.53 27.24 24.25 50-54 20.02 28.63 27.11 24.240000000000002 55-59 20.61 28.9 26.93 23.56 60-64 20.515 29.25 26.91 23.325000000000003 65-69 19.919999999999998 28.355000000000004 28.16 23.565 70-74 20.669999999999998 28.54 27.445000000000004 23.345 75-79 20.46 28.265 27.11 24.165 80-84 19.985 28.694999999999997 27.310000000000002 24.01 85-89 20.505000000000003 28.265 27.27 23.96 90-94 21.04 28.23 27.32 23.41 95-99 20.39 28.565 27.185 23.86 100-104 20.50640512409928 28.873098478783028 26.9515612489992 23.668935148118493 105-109 20.86 27.675 27.634999999999998 23.830000000000002 110-114 20.886329494241362 27.831747621432147 27.43114672008012 23.85077616424637 115-119 20.34034034034034 28.663663663663662 27.117117117117118 23.87887887887888 120-124 21.174056650985886 28.665799219297366 27.02432188970073 23.135822240016015 125-129 20.96604830241512 28.356417820891046 27.02135106755338 23.656182809140457 130-134 21.035 28.110000000000003 27.389999999999997 23.465 135-139 20.724999999999998 28.175 27.229999999999997 23.87 140-144 20.794999999999998 27.955000000000002 27.284999999999997 23.965 145-149 21.15 28.525 26.790000000000003 23.535 150-151 20.8125 28.525 26.424999999999997 24.2375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 0.5 23 0.5 24 0.5 25 0.5 26 5.5 27 9.5 28 10.5 29 14.0 30 15.0 31 20.5 32 34.0 33 41.0 34 51.5 35 72.5 36 81.5 37 94.5 38 126.5 39 164.0 40 191.0 41 205.5 42 240.0 43 261.0 44 263.5 45 271.0 46 268.0 47 251.5 48 234.0 49 213.0 50 185.5 51 153.0 52 117.0 53 101.0 54 87.0 55 59.0 56 38.0 57 30.5 58 23.0 59 17.5 60 12.5 61 9.0 62 7.5 63 4.0 64 2.0 65 1.0 66 1.0 67 1.5 68 2.0 69 2.0 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.08 105-109 0.0 110-114 0.15 115-119 0.1 120-124 0.09 125-129 0.005 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.55 0.0 0.0 0.0 0.0 104-105 0.65 0.0 0.0 0.0 0.0 106-107 0.7124999999999999 0.0 0.0 0.0 0.0 108-109 0.8375 0.0 0.0 0.0 0.0 110-111 0.9875 0.0 0.0 0.0 0.0 112-113 1.175 0.0 0.0 0.0 0.0 114-115 1.3375 0.0 0.0 0.0 0.0 116-117 1.4375 0.0 0.0 0.0 0.0 118-119 1.5875 0.0 0.0 0.0 0.0 120-121 1.7875 0.0 0.0 0.0 0.0 122-123 2.0625 0.0 0.0 0.0 0.0 124-125 2.2125 0.0 0.0 0.0 0.0 126-127 2.3625 0.0 0.0 0.0 0.0 128-129 2.6125 0.0 0.0 0.0 0.0 130-131 2.8875 0.0 0.0 0.0 0.0 132-133 3.0875 0.0 0.0 0.0 0.0 134-135 3.2625 0.0 0.0 0.0 0.0 136-137 3.5250000000000004 0.0 0.0 0.0 0.0 138-139 3.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTCCAC 10 0.006619789 146.50632 1 >>END_MODULE SRR7169564 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169564_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4165 33.0 33.0 34.0 32.0 34.0 2 32.70875 33.0 33.0 34.0 32.0 34.0 3 32.81875 33.0 33.0 34.0 32.0 34.0 4 32.764 33.0 33.0 34.0 32.0 34.0 5 32.757 34.0 33.0 34.0 32.0 34.0 6 36.9085 38.0 38.0 38.0 36.0 38.0 7 37.0375 38.0 38.0 38.0 36.0 38.0 8 36.9495 38.0 38.0 38.0 36.0 38.0 9 37.013 38.0 38.0 38.0 36.0 38.0 10-14 36.83624999999999 38.0 38.0 38.0 35.8 38.0 15-19 36.875800000000005 38.0 38.0 38.0 36.0 38.0 20-24 36.8516 38.0 38.0 38.0 36.0 38.0 25-29 36.886900000000004 38.0 38.0 38.0 36.0 38.0 30-34 36.775749999999995 38.0 38.0 38.0 36.0 38.0 35-39 36.7924 38.0 38.0 38.0 35.6 38.0 40-44 36.631099999999996 38.0 38.0 38.0 35.2 38.0 45-49 36.6409 38.0 38.0 38.0 35.4 38.0 50-54 36.431050000000006 38.0 38.0 38.0 34.8 38.0 55-59 36.04405 38.0 38.0 38.0 34.0 38.0 60-64 35.664950000000005 38.0 38.0 38.0 33.2 38.0 65-69 35.603750000000005 38.0 38.0 38.0 33.0 38.0 70-74 35.4385 38.0 38.0 38.0 32.2 38.0 75-79 35.37335 38.0 38.0 38.0 31.0 38.0 80-84 35.46785 38.0 38.0 38.0 31.0 38.0 85-89 35.4985 38.0 38.0 38.0 31.0 38.0 90-94 35.43945 38.0 38.0 38.0 30.8 38.0 95-99 35.4283 38.0 37.8 38.0 31.0 38.0 100-104 35.111599999999996 38.0 37.0 38.0 28.8 38.0 105-109 34.914550000000006 38.0 37.0 38.0 27.8 38.0 110-114 34.85295 38.0 37.0 38.0 27.6 38.0 115-119 34.64880000000001 38.0 36.4 38.0 25.8 38.0 120-124 34.3061 38.0 36.0 38.0 23.8 38.0 125-129 34.09915 38.0 35.4 38.0 23.0 38.0 130-134 33.7626 38.0 35.0 38.0 19.0 38.0 135-139 33.11615 38.0 35.0 38.0 14.2 38.0 140-144 32.7436 38.0 34.6 38.0 13.6 38.0 145-149 31.612099999999998 38.0 32.8 38.0 4.2 38.0 150-151 28.03625 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 5.0 4 1.0 5 1.0 6 2.0 7 1.0 8 4.0 9 1.0 10 5.0 11 6.0 12 10.0 13 29.0 14 30.0 15 2.0 16 6.0 17 10.0 18 7.0 19 10.0 20 8.0 21 9.0 22 14.0 23 16.0 24 20.0 25 31.0 26 47.0 27 34.0 28 33.0 29 56.0 30 56.0 31 84.0 32 74.0 33 112.0 34 146.0 35 226.0 36 493.0 37 2403.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.57881462799496 23.556116015132407 12.862547288776796 26.00252206809584 2 29.175 26.0 29.599999999999998 15.225 3 19.675 27.800000000000004 32.5 20.025000000000002 4 23.974999999999998 32.125 25.3 18.6 5 25.074999999999996 35.225 22.15 17.549999999999997 6 21.15 37.824999999999996 22.75 18.275 7 20.150000000000002 22.7 37.775 19.375 8 22.475 25.525 27.224999999999998 24.775 9 21.275 24.099999999999998 29.799999999999997 24.825 10-14 23.33350002500375 28.834325148772315 26.699004850727608 21.133169975496322 15-19 23.195 27.925 27.63 21.25 20-24 22.91 28.58 27.35 21.16 25-29 23.29 27.939999999999998 27.905 20.865000000000002 30-34 22.67 28.87 27.565 20.895 35-39 23.150000000000002 28.57 27.61 20.669999999999998 40-44 22.634999999999998 27.935 28.084999999999997 21.345 45-49 23.375 27.595 27.875 21.154999999999998 50-54 22.75837778001409 27.719633692261247 28.288215759283485 21.233772768441177 55-59 23.20366132723112 28.207475209763537 28.14645308924485 20.442410373760488 60-64 23.473673427576315 27.82216758860889 27.909239909854538 20.794919073960255 65-69 23.48286316222188 27.398386516622992 28.287343918606446 20.831406402548687 70-74 23.29852358660425 28.02098873398837 27.516847574463704 21.16364010494367 75-79 22.985842985842986 27.794079794079796 28.386100386100388 20.833976833976834 80-84 23.518869373751855 27.512929489477187 28.506323928516565 20.461877208254393 85-89 23.750701852891634 27.98223674136083 27.727017508039403 20.54004389770813 90-94 23.728382502543237 27.131230925737537 28.44862665310275 20.69175991861648 95-99 23.52283696590967 27.597419092617997 28.38490067571 20.494843265762334 100-104 23.85349025974026 27.825689935064936 28.059050324675322 20.261769480519483 105-109 23.20794889992903 27.851566460508977 27.917469329818513 21.023015309743485 110-114 23.739187616976075 28.170367747483432 27.563356770701603 20.52708786483889 115-119 24.232616940581543 27.691529709228824 27.42857142857143 20.647281921618205 120-124 24.39503932244404 27.969348659003828 27.329098608590442 20.306513409961685 125-129 24.025974025974026 28.226461038961038 27.572037337662337 20.1755275974026 130-134 24.255232469318123 27.982889443397667 26.92366451087233 20.838213576411878 135-139 24.26399057907941 27.929957503456045 27.597153243561518 20.208898673903025 140-144 24.424860378131886 28.021724650304865 26.930368396782296 20.62304657478096 145-149 24.417348356227812 28.198796110510884 27.442506559654266 19.941348973607038 150-151 25.35265950562961 27.682153487770154 27.59156205513136 19.373624951468877 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 1.5 18 2.0 19 4.0 20 5.0 21 4.5 22 8.0 23 9.0 24 8.5 25 13.0 26 11.5 27 8.5 28 11.0 29 11.5 30 14.0 31 19.5 32 26.0 33 34.5 34 42.5 35 58.5 36 85.5 37 110.0 38 131.0 39 160.5 40 184.0 41 224.5 42 264.5 43 275.0 44 273.5 45 263.5 46 276.0 47 265.0 48 234.0 49 213.0 50 170.5 51 135.0 52 113.0 53 86.5 54 64.5 55 50.0 56 36.5 57 24.5 58 19.5 59 14.5 60 8.5 61 6.0 62 4.5 63 2.5 64 2.0 65 2.5 66 1.0 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8750000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.015 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.63 55-59 1.675 60-64 2.3800000000000003 65-69 2.6950000000000003 70-74 2.8049999999999997 75-79 2.875 80-84 2.355 85-89 2.045 90-94 1.7000000000000002 95-99 1.585 100-104 1.44 105-109 1.37 110-114 1.155 115-119 1.125 120-124 0.8200000000000001 125-129 1.44 130-134 1.815 135-139 2.3449999999999998 140-144 2.415 145-149 2.815 150-151 3.4125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.55 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.8125 0.0 0.0 0.0 0.0 110-111 0.95 0.0 0.0 0.0 0.0 112-113 1.125 0.0 0.0 0.0 0.0 114-115 1.2875 0.0 0.0 0.0 0.0 116-117 1.4125 0.0 0.0 0.0 0.0 118-119 1.55 0.0 0.0 0.0 0.0 120-121 1.725 0.0 0.0 0.0 0.0 122-123 1.9874999999999998 0.0 0.0 0.0 0.0 124-125 2.1375 0.0 0.0 0.0 0.0 126-127 2.3 0.0 0.0 0.0 0.0 128-129 2.5625 0.0 0.0 0.0 0.0 130-131 2.8375 0.0 0.0 0.0 0.0 132-133 3.0375 0.0 0.0 0.0 0.0 134-135 3.2125 0.0 0.0 0.0 0.0 136-137 3.45 0.0 0.0 0.0 0.0 138-139 3.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTCATA 10 0.007195433 142.5 2 >>END_MODULE Read 1015994 spots for SRR7169564.sra Written 1015994 spots for SRR7169564.sra Read 1015994 spots for SRR7169564.sra Written 1015994 spots for SRR7169564.sra Read 1015994 spots for SRR7169564.sra Written 1015994 spots for SRR7169564.sra Read 1015994 spots for SRR7169564.sra Written 1015994 spots for SRR7169564.sra Read 1015994 spots for SRR7169564.sra Written 1015994 spots for SRR7169564.sra Read 1015994 spots for SRR7169564.sra Written 1015994 spots for SRR7169564.sra Read 1015994 spots for SRR7169564.sra Written 1015994 spots for SRR7169564.sra Read 1015994 spots for SRR7169564.sra Written 1015994 spots for SRR7169564.sra Read 1015994 spots for SRR7169564.sra Written 1015994 spots for SRR7169564.sra Read 1016004 spots for SRR7169564.sra Written 1016004 spots for SRR7169564.sra Read 1015994 spots for SRR7169564.sra Written 1015994 spots for SRR7169564.sra Read 1015994 spots for SRR7169564.sra Written 1015994 spots for SRR7169564.sra Read 1015994 spots for SRR7169564.sra Written 1015994 spots for SRR7169564.sra Read 1015994 spots for SRR7169564.sra Written 1015994 spots for SRR7169564.sra Read 1015994 spots for SRR7169564.sra Written 1015994 spots for SRR7169564.sra Read 1015994 spots for SRR7169564.sra Written 1015994 spots for SRR7169564.sra Read 1015994 spots for SRR7169564.sra Written 1015994 spots for SRR7169564.sra Read 1015994 spots for SRR7169564.sra Written 1015994 spots for SRR7169564.sra Read 1015994 spots for SRR7169564.sra Written 1015994 spots for SRR7169564.sra Read 1015994 spots for SRR7169564.sra Written 1015994 spots for SRR7169564.sra SRR ids: ['SRR7169564.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_16cro06m SRR7169564.sra spots: 20319890 blocks: [[1, 1015994], [1015995, 2031988], [2031989, 3047982], [3047983, 4063976], [4063977, 5079970], [5079971, 6095964], [6095965, 7111958], [7111959, 8127952], [8127953, 9143946], [9143947, 10159940], [10159941, 11175934], [11175935, 12191928], [12191929, 13207922], [13207923, 14223916], [14223917, 15239910], [15239911, 16255904], [16255905, 17271898], [17271899, 18287892], [18287893, 19303886], [19303887, 20319890]] SRR7169564 file size 6864043 SRR7169564 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169564 SRR7169564_1.fastq SRR7169564_2.fastq Input file: SRR7169564_1.fastq Paired file: SRR7169564_2.fastq trimmed: SRR7169564-trimmed-pair1.fastq, SRR7169564-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 00:41:30 2025 >> started Tue Feb 11 00:42:08 2025 >> done (38.267s) 20319890 read pairs processed; of these: 17822 ( 0.09%) short read pairs filtered out after trimming by size control 15048 ( 0.07%) empty read pairs filtered out after trimming by size control 20287020 (99.84%) read pairs available; of these: 9986582 (49.23%) trimmed read pairs available after processing 10300438 (50.77%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 4 0.00% 20 5 0.00% 21 5 0.00% 22 3 0.00% 23 5 0.00% 24 5 0.00% 25 11 0.00% 26 12 0.00% 27 6 0.00% 28 6 0.00% 29 10 0.00% 30 18 0.00% 31 11 0.00% 32 12 0.00% 33 19 0.00% 34 16 0.00% 35 19 0.00% 36 26 0.00% 37 23 0.00% 38 33 0.00% 39 35 0.00% 40 23 0.00% 41 34 0.00% 42 34 0.00% 43 49 0.00% 44 42 0.00% 45 40 0.00% 46 57 0.00% 47 61 0.00% 48 70 0.00% 49 66 0.00% 50 95 0.00% 51 110 0.00% 52 108 0.00% 53 129 0.00% 54 144 0.00% 55 160 0.00% 56 167 0.00% 57 201 0.00% 58 198 0.00% 59 225 0.00% 60 281 0.00% 61 299 0.00% 62 378 0.00% 63 401 0.00% 64 423 0.00% 65 454 0.00% 66 538 0.00% 67 597 0.00% 68 727 0.00% 69 908 0.00% 70 1011 0.00% 71 1091 0.01% 72 1322 0.01% 73 1573 0.01% 74 1800 0.01% 75 2356 0.01% 76 1978 0.01% 77 1428 0.01% 78 2111 0.01% 79 3762 0.02% 80 6230 0.03% 81 2175 0.01% 82 2345 0.01% 83 2784 0.01% 84 3823 0.02% 85 4448 0.02% 86 5045 0.02% 87 5309 0.03% 88 5401 0.03% 89 5659 0.03% 90 6149 0.03% 91 6698 0.03% 92 7416 0.04% 93 8218 0.04% 94 8376 0.04% 95 9239 0.05% 96 10128 0.05% 97 11681 0.06% 98 13482 0.07% 99 18005 0.09% 100 22318 0.11% 101 16616 0.08% 102 13198 0.07% 103 13351 0.07% 104 14308 0.07% 105 14999 0.07% 106 16182 0.08% 107 16565 0.08% 108 17261 0.09% 109 18191 0.09% 110 19259 0.09% 111 20295 0.10% 112 21798 0.11% 113 22973 0.11% 114 24550 0.12% 115 26026 0.13% 116 27071 0.13% 117 28273 0.14% 118 29588 0.15% 119 31069 0.15% 120 32635 0.16% 121 33698 0.17% 122 36095 0.18% 123 38120 0.19% 124 40575 0.20% 125 42960 0.21% 126 45757 0.23% 127 47710 0.24% 128 50101 0.25% 129 52795 0.26% 130 55615 0.27% 131 58940 0.29% 132 63325 0.31% 133 67798 0.33% 134 71919 0.35% 135 78480 0.39% 136 84239 0.42% 137 91005 0.45% 138 99089 0.49% 139 108828 0.54% 140 119570 0.59% 141 130705 0.64% 142 145631 0.72% 143 164727 0.81% 144 191844 0.95% 145 233509 1.15% 146 287374 1.42% 147 391348 1.93% 148 592761 2.92% 149 1124619 5.54% 150 4822567 23.77% 151 10300438 50.77% 20287020 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=14.55 fanout-score-rank=10 prefix-density=0.37 prefix-fanout=6.6 sequence=GGTGCTGGTGCTG criterion=fanout-score sequence-density=0.13 sequence-density-rank=7 fanout-score=101.30 fanout-score-rank=1 prefix-density=0.70 prefix-fanout=18.4 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.47 fanout-score-rank=40 prefix-density=0.30 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=32 fanout-score=228.82 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=25.4 sequence=GAAGAAGAAGAAA SRR7169564 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 00:43:04 Started mapping on | Feb 11 00:43:04 Finished on | Feb 11 00:45:30 Mapping speed, Million of reads per hour | 500.23 Number of input reads | 20287020 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 19317132 Uniquely mapped reads % | 95.22% Average mapped length | 294.56 Number of splices: Total | 18398725 Number of splices: Annotated (sjdb) | 18080974 Number of splices: GT/AG | 18123198 Number of splices: GC/AG | 216861 Number of splices: AT/AC | 14948 Number of splices: Non-canonical | 43718 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 401184 % of reads mapped to multiple loci | 1.98% Number of reads mapped to too many loci | 23147 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.66% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 588297 588297 588297 N_multimapping 401184 401184 401184 N_noFeature 470142 19089105 581412 N_ambiguous 195940 1410 78083 UnstrandedReadsAssigned:18651050 PositiveStrandReadsAssigned:226617 NegativeStrandReadsAssigned:18657637 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169564 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169564-trimmed-pair1.fastq SRR7169564-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,287,020 reads, 18,506,234 reads pseudoaligned [quant] estimated average fragment length: 259.92 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,140 rounds 52401 SRR7169564.ke.tsv 34699 SRR7169564.se.tsv 87100 total ==> SRR7169564.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759.08 451 12.9629 Potri.005G024800.1.v4.1 1035 776.08 60 3.90891 Potri.004G059700.1.v4.1 961 702.126 1 0.0720105 Potri.007G009000.2.v4.1 1416 1157.08 0 0 Potri.003G141000.2.v4.1 2943 2684.08 396.071 7.46086 Potri.016G087400.1.v4.1 270 72.3917 2192 1530.95 Potri.015G069301.1.v4.1 564 311.787 0 0 Potri.010G195200.1.v4.1 1773 1514.08 9 0.300542 Potri.012G127500.1.v4.1 977 718.109 6356 447.512 ==> SRR7169564.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1638 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 311 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 27 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7169564 completed mapping pipeline successfully