Starting /dee2/code/volunteer_pipeline.sh SRR7169565 current disk space = 3057353428992 free memory = 1295548964 SRR7169565 SRAfilesize 6ebdb0a48ae58a922820f951aa325c95 SRR7169565.sra SRR7169565.sra file validated SRR7169565 is paired end SRR7169565 is conventional basespace SRR7169565 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169565_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.016 34.0 33.0 34.0 33.0 34.0 2 33.3935 34.0 34.0 34.0 33.0 34.0 3 33.494 34.0 34.0 34.0 33.0 34.0 4 33.54275 34.0 34.0 34.0 33.0 34.0 5 33.53475 34.0 34.0 34.0 33.0 34.0 6 37.22225 38.0 38.0 38.0 36.0 38.0 7 37.46525 38.0 38.0 38.0 37.0 38.0 8 37.53375 38.0 38.0 38.0 37.0 38.0 9 37.50275 38.0 38.0 38.0 38.0 38.0 10-14 37.543699999999994 38.0 38.0 38.0 37.8 38.0 15-19 37.5437 38.0 38.0 38.0 38.0 38.0 20-24 37.5138 38.0 38.0 38.0 37.6 38.0 25-29 37.517 38.0 38.0 38.0 37.6 38.0 30-34 37.4895 38.0 38.0 38.0 37.8 38.0 35-39 37.411 38.0 38.0 38.0 37.0 38.0 40-44 37.35735 38.0 38.0 38.0 36.8 38.0 45-49 37.2996 38.0 38.0 38.0 36.8 38.0 50-54 37.29805 38.0 38.0 38.0 36.6 38.0 55-59 37.1949 38.0 38.0 38.0 36.2 38.0 60-64 37.17315 38.0 38.0 38.0 36.0 38.0 65-69 37.14615 38.0 38.0 38.0 36.0 38.0 70-74 37.090650000000004 38.0 38.0 38.0 36.0 38.0 75-79 37.0343 38.0 38.0 38.0 36.0 38.0 80-84 36.96525 38.0 38.0 38.0 36.0 38.0 85-89 36.911500000000004 38.0 38.0 38.0 35.8 38.0 90-94 36.822050000000004 38.0 38.0 38.0 35.4 38.0 95-99 36.7127 38.0 38.0 38.0 34.6 38.0 100-104 36.624849999999995 38.0 38.0 38.0 34.4 38.0 105-109 36.5107 38.0 38.0 38.0 34.0 38.0 110-114 36.38440000000001 38.0 38.0 38.0 34.0 38.0 115-119 36.20765 38.0 37.6 38.0 33.8 38.0 120-124 36.00715 38.0 37.0 38.0 32.6 38.0 125-129 35.927499999999995 38.0 37.0 38.0 33.0 38.0 130-134 35.71124999999999 38.0 36.2 38.0 31.4 38.0 135-139 35.3801 38.0 36.0 38.0 31.0 38.0 140-144 35.07064999999999 38.0 36.0 38.0 29.4 38.0 145-149 34.6094 38.0 35.2 38.0 28.0 38.0 150-151 31.95925 36.5 33.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 2.0 16 2.0 17 3.0 18 2.0 19 0.0 20 2.0 21 5.0 22 4.0 23 7.0 24 9.0 25 4.0 26 8.0 27 23.0 28 18.0 29 30.0 30 45.0 31 58.0 32 49.0 33 73.0 34 113.0 35 234.0 36 580.0 37 2727.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.82720121796498 11.875158589190562 9.540725704136007 37.756914488708446 2 24.05 13.950000000000001 32.800000000000004 29.2 3 19.225 17.9 24.925 37.95 4 23.674999999999997 25.575 22.85 27.900000000000002 5 23.225 31.225 23.9 21.65 6 20.875 32.95 24.85 21.325 7 14.05 27.325 41.8 16.825000000000003 8 17.375 27.075 31.8 23.75 9 17.775 24.25 33.900000000000006 24.075 10-14 19.735 29.7 27.595 22.97 15-19 19.75 28.165000000000003 27.83 24.255 20-24 19.91 28.435 27.85 23.805 25-29 20.255000000000003 28.675 27.595 23.474999999999998 30-34 19.695 29.21 27.284999999999997 23.810000000000002 35-39 20.1 28.645 27.51 23.745 40-44 19.965 29.13 26.615 24.29 45-49 19.580000000000002 29.005 27.1 24.315 50-54 20.05 28.055000000000003 27.67 24.224999999999998 55-59 20.005 28.51 27.139999999999997 24.345 60-64 19.845 28.57 26.935 24.65 65-69 20.380000000000003 28.575 27.175 23.87 70-74 20.14 28.43 27.474999999999998 23.955000000000002 75-79 19.744999999999997 28.294999999999998 27.474999999999998 24.485 80-84 19.93 28.89 26.700000000000003 24.48 85-89 20.549999999999997 28.000000000000004 27.555000000000003 23.895 90-94 20.07 28.89 26.865 24.175 95-99 19.900000000000002 28.305000000000003 27.425 24.37 100-104 20.169999999999998 28.799999999999997 27.195000000000004 23.835 105-109 19.805 28.605000000000004 27.894999999999996 23.695 110-114 20.25 28.360000000000003 27.605 23.785 115-119 20.84 28.08 27.229999999999997 23.849999999999998 120-124 21.165 27.96 26.86 24.015 125-129 20.330000000000002 28.12 27.605 23.945 130-134 20.875 27.950000000000003 27.165 24.01 135-139 20.415 27.855 27.55 24.18 140-144 20.43 28.28 27.18 24.11 145-149 20.74 27.315 27.994999999999997 23.95 150-151 20.5 28.262500000000003 26.85 24.3875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.5 21 0.5 22 0.5 23 1.0 24 1.5 25 3.0 26 6.0 27 6.0 28 7.5 29 16.0 30 19.0 31 20.0 32 27.0 33 36.0 34 45.0 35 60.0 36 77.0 37 95.5 38 121.0 39 143.5 40 165.0 41 205.5 42 237.5 43 248.0 44 250.0 45 283.0 46 310.5 47 281.5 48 249.5 49 218.0 50 178.5 51 162.0 52 133.0 53 92.5 54 75.0 55 60.5 56 50.5 57 31.5 58 18.5 59 18.0 60 13.5 61 7.0 62 7.0 63 6.0 64 2.5 65 2.5 66 1.5 67 1.5 68 1.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4749999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.4125 0.0 0.0 0.0 0.0 108-109 0.4875 0.0 0.0 0.0 0.0 110-111 0.525 0.0 0.0 0.0 0.0 112-113 0.6875 0.0 0.0 0.0 0.0 114-115 0.7625 0.0 0.0 0.0 0.0 116-117 0.85 0.0 0.0 0.0 0.0 118-119 0.9 0.0 0.0 0.0 0.0 120-121 0.9624999999999999 0.0 0.0 0.0 0.0 122-123 1.075 0.0 0.0 0.0 0.0 124-125 1.2999999999999998 0.0 0.0 0.0 0.0 126-127 1.4 0.0 0.0 0.0 0.0 128-129 1.5125000000000002 0.0 0.0 0.0 0.0 130-131 1.6875 0.0 0.0 0.0 0.0 132-133 1.8875 0.0 0.0 0.0 0.0 134-135 2.1625 0.0 0.0 0.0 0.0 136-137 2.4875 0.0 0.0 0.0 0.0 138-139 2.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169565 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169565_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.89675 33.0 33.0 34.0 32.0 34.0 2 32.99825 34.0 33.0 34.0 32.0 34.0 3 33.001 34.0 33.0 34.0 32.0 34.0 4 32.97625 34.0 33.0 34.0 33.0 34.0 5 32.99625 34.0 33.0 34.0 32.0 34.0 6 37.153 38.0 38.0 38.0 37.0 38.0 7 37.23175 38.0 38.0 38.0 37.0 38.0 8 37.18925 38.0 38.0 38.0 37.0 38.0 9 37.11325 38.0 38.0 38.0 37.0 38.0 10-14 37.12705 38.0 38.0 38.0 37.0 38.0 15-19 37.10475 38.0 38.0 38.0 37.0 38.0 20-24 37.021550000000005 38.0 38.0 38.0 37.0 38.0 25-29 36.990700000000004 38.0 38.0 38.0 37.0 38.0 30-34 36.9787 38.0 38.0 38.0 36.8 38.0 35-39 36.9983 38.0 38.0 38.0 36.8 38.0 40-44 36.94239999999999 38.0 38.0 38.0 36.4 38.0 45-49 36.9678 38.0 38.0 38.0 37.0 38.0 50-54 37.01305 38.0 38.0 38.0 37.0 38.0 55-59 36.88315 38.0 38.0 38.0 36.0 38.0 60-64 36.859700000000004 38.0 38.0 38.0 36.0 38.0 65-69 36.844300000000004 38.0 38.0 38.0 36.0 38.0 70-74 36.7256 38.0 38.0 38.0 36.0 38.0 75-79 36.7036 38.0 38.0 38.0 35.8 38.0 80-84 36.6287 38.0 38.0 38.0 35.2 38.0 85-89 36.51705 38.0 38.0 38.0 34.6 38.0 90-94 36.558 38.0 38.0 38.0 35.0 38.0 95-99 36.387800000000006 38.0 38.0 38.0 34.0 38.0 100-104 36.394600000000004 38.0 38.0 38.0 34.2 38.0 105-109 36.23845 38.0 38.0 38.0 34.0 38.0 110-114 36.095150000000004 38.0 38.0 38.0 33.8 38.0 115-119 35.8337 38.0 37.4 38.0 33.0 38.0 120-124 35.634100000000004 38.0 37.0 38.0 31.4 38.0 125-129 35.52445 38.0 36.8 38.0 31.4 38.0 130-134 35.269 38.0 36.4 38.0 31.0 38.0 135-139 34.96825 38.0 36.0 38.0 28.6 38.0 140-144 34.70290000000001 38.0 36.0 38.0 28.0 38.0 145-149 34.155100000000004 38.0 35.4 38.0 25.8 38.0 150-151 31.048375 36.5 31.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 4.0 4 4.0 5 0.0 6 2.0 7 3.0 8 2.0 9 2.0 10 1.0 11 1.0 12 1.0 13 1.0 14 3.0 15 5.0 16 0.0 17 4.0 18 4.0 19 5.0 20 10.0 21 6.0 22 7.0 23 10.0 24 10.0 25 11.0 26 14.0 27 26.0 28 29.0 29 27.0 30 45.0 31 33.0 32 48.0 33 82.0 34 118.0 35 218.0 36 477.0 37 2775.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.75975975975976 22.84784784784785 14.339339339339338 28.053053053053052 2 28.81101376720901 26.357947434292868 28.435544430538172 16.39549436795995 3 21.598596842896516 29.115509897268854 29.766975695314457 19.51891756452017 4 23.31580265464563 32.08114199849737 25.269221136989735 19.333834209867266 5 24.461692538808215 33.09964947421132 23.73560340510766 18.70305458187281 6 21.999498872463043 36.73264845903282 22.225006264094212 19.04284640440992 7 20.095214232022048 23.05186670007517 37.96041092458031 18.892508143322477 8 22.300175394637936 25.432222500626413 27.787521924329745 24.480080180405913 9 21.763085399449036 24.392687202604556 30.428249436513898 23.415977961432507 10-14 23.157472819279523 29.119695375519818 26.464251716017838 21.258580089182825 15-19 23.41182364729459 27.83066132264529 27.70541082164329 21.052104208416832 20-24 23.18215985968429 27.567025808068152 27.63217238787271 21.618641944374843 25-29 23.600741594428023 27.774715638623036 27.51916620734579 21.105376559603148 30-34 22.92783092101968 28.436920919517206 27.82090449241248 20.814343667050633 35-39 22.76052104208417 27.46492985971944 27.900801603206414 21.87374749498998 40-44 23.39210579042276 28.235824484071326 27.158885994790623 21.213183730715286 45-49 23.69646882043576 28.264462809917358 27.76358627598297 20.275482093663914 50-54 24.049681975259176 27.92607802874743 27.24996243802274 20.774277557970652 55-59 23.89704041263959 27.137062446792527 28.068506184586106 20.89739095598177 60-64 23.31580265464563 27.558226897069872 28.344603055346855 20.781367392937643 65-69 23.587174348697395 27.935871743486974 27.900801603206414 20.57615230460922 70-74 23.554464375187894 27.638039883755887 28.149113137588937 20.65838260346728 75-79 23.533243148454332 27.29094644020241 28.44330878300516 20.732501628338092 80-84 23.708602635402578 27.075504784808857 28.37817525928153 20.83771732050704 85-89 24.101818910657915 27.26361677606855 28.21065290374305 20.42391140953049 90-94 24.169547572523673 27.376121048148704 28.242897940778594 20.211433438549026 95-99 24.321482223335003 27.74161241862794 27.631447170756136 20.305458187280923 100-104 24.215111912272796 27.529918381653395 27.45480947373692 20.80016023233689 105-109 24.1327526655654 27.70686289232617 27.49662111428142 20.663763327827 110-114 24.313764776597875 27.915247445401725 27.49949909837708 20.271488679623324 115-119 24.331229335737902 27.562368500150285 27.717663560765455 20.388738603346358 120-124 24.47016383586352 27.902199508993437 27.82203517210281 19.805601483040235 125-129 24.31470809320972 27.567025808068152 27.872713605612624 20.245552493109496 130-134 25.274339830635867 27.9701357919527 27.12331512752418 19.632209249887257 135-139 24.853434885002756 27.4991231146966 27.91501728716741 19.732424713133238 140-144 24.264890046586185 27.59104343034614 28.096979411912038 20.047087111155637 145-149 24.53794139744553 27.598297019784624 27.513148009015776 20.35061357375407 150-151 25.350175087543768 27.47623811905953 26.813406703351678 20.36018009004502 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 4.0 1 2.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.5 8 0.5 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 1.5 27 2.5 28 5.0 29 5.5 30 9.0 31 10.5 32 13.5 33 26.0 34 33.0 35 51.5 36 71.0 37 89.0 38 117.0 39 144.0 40 191.5 41 249.5 42 276.5 43 298.5 44 306.5 45 291.5 46 282.5 47 258.0 48 235.0 49 225.5 50 186.5 51 145.0 52 122.5 53 95.5 54 68.5 55 47.0 56 40.5 57 31.0 58 21.0 59 15.0 60 8.5 61 5.5 62 4.5 63 3.0 64 1.5 65 1.0 66 0.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.125 3 0.22499999999999998 4 0.17500000000000002 5 0.15 6 0.22499999999999998 7 0.22499999999999998 8 0.22499999999999998 9 0.17500000000000002 10-14 0.20500000000000002 15-19 0.2 20-24 0.22499999999999998 25-29 0.215 30-34 0.165 35-39 0.2 40-44 0.18 45-49 0.17500000000000002 50-54 0.165 55-59 0.155 60-64 0.17500000000000002 65-69 0.2 70-74 0.21 75-79 0.20500000000000002 80-84 0.20500000000000002 85-89 0.215 90-94 0.20500000000000002 95-99 0.15 100-104 0.145 105-109 0.11499999999999999 110-114 0.18 115-119 0.19 120-124 0.20500000000000002 125-129 0.22499999999999998 130-134 0.215 135-139 0.215 140-144 0.185 145-149 0.17500000000000002 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69894631209232 99.35000000000001 2 0.27596588058203714 0.5499999999999999 3 0.0 0.0 4 0.025087807325639738 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.4125 0.0 0.0 0.0 0.0 108-109 0.4875 0.0 0.0 0.0 0.0 110-111 0.525 0.0 0.0 0.0 0.0 112-113 0.6875 0.0 0.0 0.0 0.0 114-115 0.7625 0.0 0.0 0.0 0.0 116-117 0.85 0.0 0.0 0.0 0.0 118-119 0.9 0.0 0.0 0.0 0.0 120-121 0.9624999999999999 0.0 0.0 0.0 0.0 122-123 1.075 0.0 0.0 0.0 0.0 124-125 1.2999999999999998 0.0 0.0 0.0 0.0 126-127 1.4 0.0 0.0 0.0 0.0 128-129 1.5125000000000002 0.0 0.0 0.0 0.0 130-131 1.6875 0.0 0.0 0.0 0.0 132-133 1.8875 0.0 0.0 0.0 0.0 134-135 2.1625 0.0 0.0 0.0 0.0 136-137 2.4875 0.0 0.0 0.0 0.0 138-139 2.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGGTTTC 10 0.006830828 145.0 3 TCAATGT 10 0.006830828 145.0 8 >>END_MODULE Read 884881 spots for SRR7169565.sra Written 884881 spots for SRR7169565.sra Read 884881 spots for SRR7169565.sra Written 884881 spots for SRR7169565.sra Read 884881 spots for SRR7169565.sra Written 884881 spots for SRR7169565.sra Read 884881 spots for SRR7169565.sra Written 884881 spots for SRR7169565.sra Read 884881 spots for SRR7169565.sra Written 884881 spots for SRR7169565.sra Read 884881 spots for SRR7169565.sra Written 884881 spots for SRR7169565.sra Read 884881 spots for SRR7169565.sra Written 884881 spots for SRR7169565.sra Read 884881 spots for SRR7169565.sra Written 884881 spots for SRR7169565.sra Read 884881 spots for SRR7169565.sra Written 884881 spots for SRR7169565.sra Read 884894 spots for SRR7169565.sra Written 884894 spots for SRR7169565.sra Read 884881 spots for SRR7169565.sra Written 884881 spots for SRR7169565.sra Read 884881 spots for SRR7169565.sra Written 884881 spots for SRR7169565.sra Read 884881 spots for SRR7169565.sra Written 884881 spots for SRR7169565.sra Read 884881 spots for SRR7169565.sra Written 884881 spots for SRR7169565.sra Read 884881 spots for SRR7169565.sra Written 884881 spots for SRR7169565.sra Read 884881 spots for SRR7169565.sra Written 884881 spots for SRR7169565.sra Read 884881 spots for SRR7169565.sra Written 884881 spots for SRR7169565.sra Read 884881 spots for SRR7169565.sra Written 884881 spots for SRR7169565.sra Read 884881 spots for SRR7169565.sra Written 884881 spots for SRR7169565.sra Read 884881 spots for SRR7169565.sra Written 884881 spots for SRR7169565.sra SRR ids: ['SRR7169565.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_49zotim2 SRR7169565.sra spots: 17697633 blocks: [[1, 884881], [884882, 1769762], [1769763, 2654643], [2654644, 3539524], [3539525, 4424405], [4424406, 5309286], [5309287, 6194167], [6194168, 7079048], [7079049, 7963929], [7963930, 8848810], [8848811, 9733691], [9733692, 10618572], [10618573, 11503453], [11503454, 12388334], [12388335, 13273215], [13273216, 14158096], [14158097, 15042977], [15042978, 15927858], [15927859, 16812739], [16812740, 17697633]] SRR7169565 file size 5975446 SRR7169565 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169565 SRR7169565_1.fastq SRR7169565_2.fastq Input file: SRR7169565_1.fastq Paired file: SRR7169565_2.fastq trimmed: SRR7169565-trimmed-pair1.fastq, SRR7169565-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 01:01:04 2025 >> started Tue Feb 11 01:01:23 2025 >> done (19.570s) 17697633 read pairs processed; of these: 14568 ( 0.08%) short read pairs filtered out after trimming by size control 53055 ( 0.30%) empty read pairs filtered out after trimming by size control 17630010 (99.62%) read pairs available; of these: 6915560 (39.23%) trimmed read pairs available after processing 10714450 (60.77%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 2 0.00% 21 3 0.00% 22 4 0.00% 23 2 0.00% 24 7 0.00% 25 2 0.00% 26 9 0.00% 27 10 0.00% 28 5 0.00% 29 8 0.00% 30 7 0.00% 31 4 0.00% 32 9 0.00% 33 0 0.00% 34 6 0.00% 35 10 0.00% 36 6 0.00% 37 10 0.00% 38 13 0.00% 39 19 0.00% 40 14 0.00% 41 12 0.00% 42 18 0.00% 43 15 0.00% 44 17 0.00% 45 14 0.00% 46 11 0.00% 47 28 0.00% 48 35 0.00% 49 23 0.00% 50 37 0.00% 51 47 0.00% 52 48 0.00% 53 43 0.00% 54 47 0.00% 55 59 0.00% 56 65 0.00% 57 81 0.00% 58 92 0.00% 59 96 0.00% 60 105 0.00% 61 144 0.00% 62 128 0.00% 63 161 0.00% 64 176 0.00% 65 174 0.00% 66 212 0.00% 67 274 0.00% 68 351 0.00% 69 651 0.00% 70 743 0.00% 71 527 0.00% 72 459 0.00% 73 544 0.00% 74 576 0.00% 75 632 0.00% 76 659 0.00% 77 746 0.00% 78 933 0.01% 79 895 0.01% 80 1081 0.01% 81 1245 0.01% 82 1460 0.01% 83 1587 0.01% 84 2236 0.01% 85 2802 0.02% 86 2871 0.02% 87 3159 0.02% 88 3444 0.02% 89 3428 0.02% 90 3791 0.02% 91 4009 0.02% 92 4346 0.02% 93 4453 0.03% 94 4783 0.03% 95 5170 0.03% 96 5545 0.03% 97 5873 0.03% 98 6233 0.04% 99 6509 0.04% 100 6711 0.04% 101 7294 0.04% 102 7913 0.04% 103 8184 0.05% 104 8829 0.05% 105 9334 0.05% 106 9875 0.06% 107 10215 0.06% 108 10768 0.06% 109 11182 0.06% 110 11830 0.07% 111 12549 0.07% 112 13264 0.08% 113 13925 0.08% 114 14474 0.08% 115 15697 0.09% 116 16406 0.09% 117 17238 0.10% 118 18322 0.10% 119 18937 0.11% 120 19825 0.11% 121 20604 0.12% 122 22181 0.13% 123 23206 0.13% 124 25148 0.14% 125 26165 0.15% 126 27582 0.16% 127 29566 0.17% 128 30435 0.17% 129 32542 0.18% 130 34130 0.19% 131 36263 0.21% 132 38973 0.22% 133 41339 0.23% 134 44101 0.25% 135 47423 0.27% 136 50906 0.29% 137 55408 0.31% 138 58962 0.33% 139 64161 0.36% 140 69538 0.39% 141 75944 0.43% 142 84652 0.48% 143 95492 0.54% 144 112161 0.64% 145 133354 0.76% 146 165534 0.94% 147 225676 1.28% 148 345613 1.96% 149 706109 4.01% 150 3845561 21.81% 151 10714450 60.77% 17630010 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=44 prefix-density=0.18 prefix-fanout=2.0 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.10 sequence-density-rank=28 fanout-score=305.01 fanout-score-rank=1 prefix-density=1.05 prefix-fanout=28.7 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=4.29 fanout-score-rank=29 prefix-density=0.43 prefix-fanout=3.3 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.10 sequence-density-rank=21 fanout-score=323.68 fanout-score-rank=1 prefix-density=1.15 prefix-fanout=29.0 sequence=AAGAAGAAGAAG SRR7169565 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 01:02:08 Started mapping on | Feb 11 01:02:09 Finished on | Feb 11 01:03:44 Mapping speed, Million of reads per hour | 668.08 Number of input reads | 17630010 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 16942590 Uniquely mapped reads % | 96.10% Average mapped length | 296.75 Number of splices: Total | 17108406 Number of splices: Annotated (sjdb) | 16838254 Number of splices: GT/AG | 16861006 Number of splices: GC/AG | 203598 Number of splices: AT/AC | 13104 Number of splices: Non-canonical | 30698 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 306519 % of reads mapped to multiple loci | 1.74% Number of reads mapped to too many loci | 18166 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.03% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 393768 393768 393768 N_multimapping 306519 306519 306519 N_noFeature 325734 16783270 397360 N_ambiguous 150894 697 62751 UnstrandedReadsAssigned:16465962 PositiveStrandReadsAssigned:158623 NegativeStrandReadsAssigned:16482479 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169565 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169565-trimmed-pair1.fastq SRR7169565-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,630,010 reads, 16,331,503 reads pseudoaligned [quant] estimated average fragment length: 256.658 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,126 rounds 52401 SRR7169565.ke.tsv 34699 SRR7169565.se.tsv 87100 total ==> SRR7169565.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1762.34 298 8.97839 Potri.005G024800.1.v4.1 1035 779.342 53 3.61094 Potri.004G059700.1.v4.1 961 705.392 2 0.150547 Potri.007G009000.2.v4.1 1416 1160.34 0 0 Potri.003G141000.2.v4.1 2943 2687.34 336.04 6.63957 Potri.016G087400.1.v4.1 270 69.4745 2217 1694.39 Potri.015G069301.1.v4.1 564 313.674 0 0 Potri.010G195200.1.v4.1 1773 1517.34 8 0.279949 Potri.012G127500.1.v4.1 977 721.374 7923 583.179 ==> SRR7169565.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 751 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 258 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 0 SRR7169565 completed mapping pipeline successfully