Starting /dee2/code/volunteer_pipeline.sh SRR7169566 current disk space = 3056949739520 free memory = 1577526880 SRR7169566 SRAfilesize 1d4e206b3a886b16a27db0a940dd6a10 SRR7169566.sra SRR7169566.sra file validated SRR7169566 is paired end SRR7169566 is conventional basespace SRR7169566 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169566_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8765 34.0 33.0 34.0 33.0 34.0 2 33.4445 34.0 34.0 34.0 33.0 34.0 3 33.413 34.0 34.0 34.0 33.0 34.0 4 33.51025 34.0 34.0 34.0 33.0 34.0 5 33.496 34.0 34.0 34.0 33.0 34.0 6 37.068 38.0 37.0 38.0 36.0 38.0 7 37.33925 38.0 38.0 38.0 37.0 38.0 8 37.452 38.0 38.0 38.0 37.0 38.0 9 37.55225 38.0 38.0 38.0 38.0 38.0 10-14 37.49615 38.0 38.0 38.0 37.4 38.0 15-19 37.4971 38.0 38.0 38.0 37.6 38.0 20-24 37.498149999999995 38.0 38.0 38.0 37.8 38.0 25-29 37.5128 38.0 38.0 38.0 38.0 38.0 30-34 37.51259999999999 38.0 38.0 38.0 38.0 38.0 35-39 37.35235 38.0 38.0 38.0 37.0 38.0 40-44 37.347750000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.26755000000001 38.0 38.0 38.0 37.0 38.0 50-54 37.19565 38.0 38.0 38.0 36.2 38.0 55-59 37.1829 38.0 38.0 38.0 36.2 38.0 60-64 37.170300000000005 38.0 38.0 38.0 36.0 38.0 65-69 37.12329999999999 38.0 38.0 38.0 36.0 38.0 70-74 37.09565 38.0 38.0 38.0 36.0 38.0 75-79 36.99105 38.0 38.0 38.0 36.0 38.0 80-84 36.9283 38.0 38.0 38.0 36.0 38.0 85-89 36.8681 38.0 38.0 38.0 35.2 38.0 90-94 36.78345 38.0 38.0 38.0 35.0 38.0 95-99 36.62835 38.0 38.0 38.0 34.4 38.0 100-104 36.5707 38.0 38.0 38.0 34.2 38.0 105-109 36.47125 38.0 38.0 38.0 34.2 38.0 110-114 36.32340000000001 38.0 38.0 38.0 34.0 38.0 115-119 36.134699999999995 38.0 37.4 38.0 33.4 38.0 120-124 35.96495 38.0 37.0 38.0 32.8 38.0 125-129 35.804899999999996 38.0 37.0 38.0 32.2 38.0 130-134 35.68745 38.0 36.2 38.0 31.8 38.0 135-139 35.4208 38.0 36.0 38.0 31.0 38.0 140-144 35.1774 38.0 36.0 38.0 30.0 38.0 145-149 34.49485 38.0 35.2 38.0 27.6 38.0 150-151 31.689999999999998 36.5 31.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 1.0 17 4.0 18 3.0 19 4.0 20 2.0 21 4.0 22 4.0 23 6.0 24 7.0 25 6.0 26 16.0 27 22.0 28 28.0 29 24.0 30 38.0 31 44.0 32 73.0 33 76.0 34 131.0 35 214.0 36 554.0 37 2736.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.45010183299389 11.608961303462321 9.292260692464358 34.64867617107943 2 24.099999999999998 13.725000000000001 32.5 29.675 3 19.475 18.825 25.674999999999997 36.025 4 23.025000000000002 28.299999999999997 22.475 26.200000000000003 5 22.275 32.550000000000004 23.175 22.0 6 20.8 35.325 22.925 20.95 7 14.575 27.1 41.225 17.1 8 17.325 27.200000000000003 29.875 25.6 9 16.1 25.624999999999996 33.300000000000004 24.975 10-14 19.335 30.135 27.33 23.200000000000003 15-19 19.585 29.09 27.694999999999997 23.630000000000003 20-24 19.650000000000002 28.975 27.365000000000002 24.01 25-29 20.025000000000002 28.804999999999996 27.27 23.9 30-34 19.939999999999998 28.435 27.785 23.84 35-39 19.525000000000002 28.07 27.82 24.585 40-44 20.035 28.665000000000003 27.715 23.585 45-49 20.48 28.549999999999997 27.439999999999998 23.53 50-54 20.575 28.275 27.555000000000003 23.595 55-59 20.655 28.810000000000002 27.13 23.405 60-64 20.155 28.625 27.405 23.815 65-69 20.185 27.860000000000003 27.915 24.04 70-74 20.355 28.389999999999997 27.685 23.57 75-79 20.785 28.470000000000002 27.265 23.48 80-84 20.395 28.78 27.55 23.275000000000002 85-89 20.1 27.97 27.91 24.02 90-94 20.22 29.225 26.655 23.9 95-99 20.1 28.705000000000002 27.57 23.625 100-104 21.01 28.134999999999998 27.02 23.835 105-109 20.69 28.515 26.974999999999998 23.82 110-114 20.405 28.355000000000004 26.955000000000002 24.285 115-119 20.724999999999998 28.265 27.275 23.735 120-124 20.745 27.91 27.35 23.995 125-129 20.905 27.715 27.36 24.02 130-134 20.765 27.98 27.275 23.98 135-139 20.544999999999998 27.985 27.575 23.895 140-144 20.335 28.12 27.18 24.365000000000002 145-149 21.055 27.67 27.250000000000004 24.025 150-151 21.337500000000002 28.462500000000002 26.474999999999998 23.724999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 1.5 23 1.0 24 1.5 25 1.5 26 1.5 27 4.5 28 6.5 29 8.5 30 15.0 31 18.5 32 27.0 33 43.0 34 50.0 35 60.5 36 84.5 37 106.5 38 132.0 39 168.0 40 184.0 41 210.5 42 255.0 43 262.0 44 281.5 45 298.5 46 275.0 47 254.0 48 222.5 49 201.5 50 184.5 51 143.0 52 123.0 53 98.5 54 62.0 55 49.0 56 39.0 57 26.5 58 18.0 59 13.5 60 13.0 61 11.5 62 9.5 63 8.0 64 6.5 65 6.0 66 4.0 67 2.0 68 1.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7999999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69894631209232 99.35000000000001 2 0.2508780732563974 0.5 3 0.050175614651279475 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.36250000000000004 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.5375000000000001 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 0.8125 0.0 0.0 0.0 0.0 106-107 0.9125000000000001 0.0 0.0 0.0 0.0 108-109 1.0 0.0 0.0 0.0 0.0 110-111 1.2875 0.0 0.0 0.0 0.0 112-113 1.575 0.0 0.0 0.0 0.0 114-115 1.825 0.0 0.0 0.0 0.0 116-117 2.0125 0.0 0.0 0.0 0.0 118-119 2.0875 0.0 0.0 0.0 0.0 120-121 2.3375 0.0 0.0 0.0 0.0 122-123 2.6125 0.0 0.0 0.0 0.0 124-125 2.7125 0.0 0.0 0.0 0.0 126-127 3.0 0.0 0.0 0.0 0.0 128-129 3.3 0.0 0.0 0.0 0.0 130-131 3.625 0.0 0.0 0.0 0.0 132-133 3.8625 0.0 0.0 0.0 0.0 134-135 4.2875 0.0 0.0 0.0 0.0 136-137 4.725 0.0 0.0 0.0 0.0 138-139 5.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGATGAA 10 0.006830828 145.0 5 GGTTCAT 10 0.006830828 145.0 5 GCAACCA 10 0.006830828 145.0 4 TGAATTT 10 0.006830828 145.0 8 >>END_MODULE SRR7169566 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169566_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.861 33.0 33.0 34.0 32.0 34.0 2 32.98625 34.0 33.0 34.0 32.0 34.0 3 33.011 34.0 33.0 34.0 32.0 34.0 4 32.92225 34.0 33.0 34.0 32.0 34.0 5 32.9995 34.0 33.0 34.0 33.0 34.0 6 37.10975 38.0 38.0 38.0 36.0 38.0 7 37.17825 38.0 38.0 38.0 37.0 38.0 8 37.14375 38.0 38.0 38.0 37.0 38.0 9 37.1685 38.0 38.0 38.0 37.0 38.0 10-14 37.0841 38.0 38.0 38.0 37.0 38.0 15-19 37.025650000000006 38.0 38.0 38.0 37.0 38.0 20-24 36.9809 38.0 38.0 38.0 37.0 38.0 25-29 36.973 38.0 38.0 38.0 36.8 38.0 30-34 36.9578 38.0 38.0 38.0 36.8 38.0 35-39 36.979 38.0 38.0 38.0 36.8 38.0 40-44 36.9489 38.0 38.0 38.0 37.0 38.0 45-49 36.951750000000004 38.0 38.0 38.0 36.4 38.0 50-54 36.92315 38.0 38.0 38.0 36.8 38.0 55-59 36.490449999999996 38.0 37.8 38.0 34.4 38.0 60-64 36.80045 38.0 38.0 38.0 36.0 38.0 65-69 36.7698 38.0 38.0 38.0 36.0 38.0 70-74 36.7023 38.0 38.0 38.0 35.8 38.0 75-79 36.6075 38.0 38.0 38.0 35.2 38.0 80-84 36.501 38.0 38.0 38.0 34.8 38.0 85-89 36.4337 38.0 38.0 38.0 34.8 38.0 90-94 36.397000000000006 38.0 38.0 38.0 34.2 38.0 95-99 36.287650000000006 38.0 38.0 38.0 34.0 38.0 100-104 36.2222 38.0 38.0 38.0 34.0 38.0 105-109 36.08605 38.0 38.0 38.0 34.0 38.0 110-114 36.007400000000004 38.0 38.0 38.0 33.8 38.0 115-119 35.866200000000006 38.0 38.0 38.0 33.2 38.0 120-124 35.608799999999995 38.0 37.2 38.0 32.2 38.0 125-129 35.426750000000006 38.0 37.0 38.0 31.6 38.0 130-134 34.961400000000005 38.0 36.0 38.0 28.2 38.0 135-139 34.77759999999999 38.0 36.0 38.0 27.8 38.0 140-144 34.36855 38.0 35.4 38.0 25.8 38.0 145-149 33.7204 38.0 35.0 38.0 21.8 38.0 150-151 30.274875 36.5 29.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 2.0 4 6.0 5 2.0 6 3.0 7 1.0 8 1.0 9 1.0 10 0.0 11 1.0 12 3.0 13 1.0 14 4.0 15 5.0 16 7.0 17 5.0 18 7.0 19 6.0 20 8.0 21 7.0 22 13.0 23 10.0 24 9.0 25 15.0 26 14.0 27 24.0 28 23.0 29 34.0 30 46.0 31 45.0 32 64.0 33 83.0 34 101.0 35 211.0 36 507.0 37 2719.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.11855927963982 23.36168084042021 14.70735367683842 24.81240620310155 2 28.993490235353033 25.212819228843266 29.11867801702554 16.675012518778168 3 21.256885327991988 28.41762643965949 29.994992488733104 20.330495743615423 4 23.00951427140711 32.77416124186279 24.41161742613921 19.804707060590886 5 24.086129193790686 36.354531797696545 20.931397095643465 18.627941912869304 6 21.341005754315738 37.45308981736302 22.742056542406804 18.463847885914436 7 20.21516137102827 23.2424318238679 38.20365273955467 18.33875406554916 8 22.405601400350086 24.88122030507627 27.731932983245812 24.981245311327832 9 21.310655327663834 25.362681340670335 29.539769884942473 23.78689344672336 10-14 22.826413206603302 29.374687343671834 26.263131565782892 21.53576788394197 15-19 23.773075191355243 27.695232377807795 27.415078293061185 21.116614137775777 20-24 22.884875168859757 27.778055736228545 28.163306148996845 21.173762945914845 25-29 23.65010258719912 28.00880748636341 27.64850122604214 20.692588700395337 30-34 23.348678943154525 27.502001601281023 27.627101681345078 21.522217774219378 35-39 23.17854283426741 27.95736589271417 27.171737389911932 21.692353883106485 40-44 22.785950165115583 27.77444210947663 28.26478534974482 21.174822375662963 45-49 22.803682209325597 27.396437862717633 28.16690014008405 21.632979787872724 50-54 23.31699509852956 27.87836350905272 27.883365009502853 20.921276382914876 55-59 23.073075576451757 28.234882208773072 27.314560096033613 21.377482118741558 60-64 23.025361412635686 27.962583162423087 28.26271822320044 20.749337201740783 65-69 23.601800900450225 27.24862431215608 28.054027013506754 21.095547773886945 70-74 23.46908144886932 27.601560936561935 27.996798078847306 20.93255953572143 75-79 23.016111277894527 27.083958771139798 29.210447313119182 20.689482637846492 80-84 23.35134594215951 28.064645251676172 27.679375562894027 20.90463324327029 85-89 24.17192034424097 27.539277494245972 27.84449114380066 20.444311017712398 90-94 23.48526542252464 28.253364687046577 27.883124030619904 20.378245859808874 95-99 23.60326114139949 27.844745660981346 27.849747411594056 20.70224578602511 100-104 24.427328198459538 27.59327798339502 27.448234470341106 20.531159347804344 105-109 23.545886471617905 27.556889222305575 28.11702925731433 20.78019504876219 110-114 24.180881396628486 27.587414336451406 27.55740083037367 20.674303436546445 115-119 24.014408645187114 28.447068240944567 27.126275765459273 20.412247348409046 120-124 23.821675172620836 27.7644351045732 28.06964875412789 20.344240968678072 125-129 24.12309231923943 28.021015761821367 27.52064048036027 20.335251438578933 130-134 24.42209546682678 27.944561192834982 27.194035825077556 20.439307515260683 135-139 24.299439551641314 27.65712570056045 27.5320256204964 20.511409127301842 140-144 25.168842863574962 27.80029015958777 27.06488568712792 19.96598128970934 145-149 25.36134033508377 27.991997999499873 26.736684171042764 19.909977494373592 150-151 24.190523815476936 27.715964495561945 27.815976997124643 20.27753469183648 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 2.5 26 4.5 27 4.5 28 3.5 29 5.5 30 11.0 31 16.5 32 16.5 33 23.0 34 39.5 35 53.5 36 76.0 37 104.0 38 118.0 39 161.0 40 206.5 41 210.5 42 250.0 43 286.0 44 287.5 45 297.0 46 283.5 47 270.5 48 255.0 49 223.0 50 175.5 51 139.5 52 125.5 53 101.5 54 71.0 55 46.5 56 38.5 57 25.0 58 13.5 59 10.0 60 9.0 61 7.0 62 5.5 63 5.0 64 3.5 65 2.5 66 0.5 67 0.5 68 1.5 69 1.5 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.15 3 0.15 4 0.15 5 0.15 6 0.075 7 0.075 8 0.025 9 0.05 10-14 0.05 15-19 0.055 20-24 0.065 25-29 0.08499999999999999 30-34 0.08 35-39 0.08 40-44 0.06999999999999999 45-49 0.06 50-54 0.03 55-59 0.034999999999999996 60-64 0.045 65-69 0.05 70-74 0.06 75-79 0.06999999999999999 80-84 0.06999999999999999 85-89 0.06999999999999999 90-94 0.065 95-99 0.034999999999999996 100-104 0.03 105-109 0.025 110-114 0.045 115-119 0.06 120-124 0.06999999999999999 125-129 0.075 130-134 0.06999999999999999 135-139 0.08 140-144 0.055 145-149 0.025 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.025 0.0 0.0 0.025 0.0 54-55 0.025 0.0 0.0 0.025 0.0 56-57 0.025 0.0 0.0 0.025 0.0 58-59 0.025 0.0 0.0 0.025 0.0 60-61 0.025 0.0 0.0 0.025 0.0 62-63 0.025 0.0 0.0 0.025 0.0 64-65 0.025 0.0 0.0 0.025 0.0 66-67 0.05 0.0 0.0 0.025 0.0 68-69 0.05 0.0 0.0 0.025 0.0 70-71 0.05 0.0 0.0 0.025 0.0 72-73 0.05 0.0 0.0 0.025 0.0 74-75 0.05 0.0 0.0 0.025 0.0 76-77 0.05 0.0 0.0 0.025 0.0 78-79 0.05 0.0 0.0 0.025 0.0 80-81 0.0875 0.0 0.0 0.025 0.0 82-83 0.1 0.0 0.0 0.025 0.0 84-85 0.1 0.0 0.0 0.025 0.0 86-87 0.125 0.0 0.0 0.025 0.0 88-89 0.16249999999999998 0.0 0.0 0.025 0.0 90-91 0.175 0.0 0.0 0.025 0.0 92-93 0.25 0.0 0.0 0.025 0.0 94-95 0.3375 0.0 0.0 0.025 0.0 96-97 0.4625 0.0 0.0 0.025 0.0 98-99 0.5125 0.0 0.0 0.025 0.0 100-101 0.6125 0.0 0.0 0.025 0.0 102-103 0.7124999999999999 0.0 0.0 0.025 0.0 104-105 0.7875 0.0 0.0 0.025 0.0 106-107 0.8625 0.0 0.0 0.025 0.0 108-109 0.925 0.0 0.0 0.025 0.0 110-111 1.1875 0.0 0.0 0.025 0.0 112-113 1.4125 0.0 0.0 0.025 0.0 114-115 1.65 0.0 0.0 0.025 0.0 116-117 1.8375 0.0 0.0 0.025 0.0 118-119 1.9375 0.0 0.0 0.025 0.0 120-121 2.1875 0.0 0.0 0.025 0.0 122-123 2.4375 0.0 0.0 0.025 0.0 124-125 2.5375 0.0 0.0 0.025 0.0 126-127 2.8125 0.0 0.0 0.025 0.0 128-129 3.125 0.0 0.0 0.025 0.0 130-131 3.4375 0.0 0.0 0.025 0.0 132-133 3.7125 0.0 0.0 0.025 0.0 134-135 4.1625 0.0 0.0 0.025 0.0 136-137 4.6 0.0 0.0 0.025 0.0 138-139 5.0875 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 878632 spots for SRR7169566.sra Written 878632 spots for SRR7169566.sra Read 878632 spots for SRR7169566.sra Written 878632 spots for SRR7169566.sra Read 878632 spots for SRR7169566.sra Written 878632 spots for SRR7169566.sra Read 878632 spots for SRR7169566.sra Written 878632 spots for SRR7169566.sra Read 878632 spots for SRR7169566.sra Written 878632 spots for SRR7169566.sra Read 878632 spots for SRR7169566.sra Written 878632 spots for SRR7169566.sra Read 878632 spots for SRR7169566.sra Written 878632 spots for SRR7169566.sra Read 878634 spots for SRR7169566.sra Written 878634 spots for SRR7169566.sra Read 878632 spots for SRR7169566.sra Written 878632 spots for SRR7169566.sra Read 878632 spots for SRR7169566.sra Written 878632 spots for SRR7169566.sra Read 878632 spots for SRR7169566.sra Written 878632 spots for SRR7169566.sra Read 878632 spots for SRR7169566.sra Written 878632 spots for SRR7169566.sra Read 878632 spots for SRR7169566.sra Written 878632 spots for SRR7169566.sra Read 878632 spots for SRR7169566.sra Written 878632 spots for SRR7169566.sra Read 878632 spots for SRR7169566.sra Written 878632 spots for SRR7169566.sra Read 878632 spots for SRR7169566.sra Written 878632 spots for SRR7169566.sra Read 878632 spots for SRR7169566.sra Written 878632 spots for SRR7169566.sra Read 878632 spots for SRR7169566.sra Written 878632 spots for SRR7169566.sra Read 878632 spots for SRR7169566.sra Written 878632 spots for SRR7169566.sra Read 878632 spots for SRR7169566.sra Written 878632 spots for SRR7169566.sra SRR ids: ['SRR7169566.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2aw1_34r SRR7169566.sra spots: 17572642 blocks: [[1, 878632], [878633, 1757264], [1757265, 2635896], [2635897, 3514528], [3514529, 4393160], [4393161, 5271792], [5271793, 6150424], [6150425, 7029056], [7029057, 7907688], [7907689, 8786320], [8786321, 9664952], [9664953, 10543584], [10543585, 11422216], [11422217, 12300848], [12300849, 13179480], [13179481, 14058112], [14058113, 14936744], [14936745, 15815376], [15815377, 16694008], [16694009, 17572642]] SRR7169566 file size 5933091 SRR7169566 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169566 SRR7169566_1.fastq SRR7169566_2.fastq Input file: SRR7169566_1.fastq Paired file: SRR7169566_2.fastq trimmed: SRR7169566-trimmed-pair1.fastq, SRR7169566-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 03:33:43 2025 >> started Tue Feb 11 03:41:21 2025 >> done (458.239s) 17572642 read pairs processed; of these: 15697 ( 0.09%) short read pairs filtered out after trimming by size control 51131 ( 0.29%) empty read pairs filtered out after trimming by size control 17505814 (99.62%) read pairs available; of these: 7131107 (40.74%) trimmed read pairs available after processing 10374707 (59.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 3 0.00% 21 3 0.00% 22 2 0.00% 23 5 0.00% 24 7 0.00% 25 3 0.00% 26 5 0.00% 27 9 0.00% 28 15 0.00% 29 13 0.00% 30 12 0.00% 31 9 0.00% 32 10 0.00% 33 5 0.00% 34 10 0.00% 35 7 0.00% 36 10 0.00% 37 8 0.00% 38 13 0.00% 39 13 0.00% 40 24 0.00% 41 16 0.00% 42 18 0.00% 43 26 0.00% 44 22 0.00% 45 41 0.00% 46 31 0.00% 47 37 0.00% 48 54 0.00% 49 56 0.00% 50 54 0.00% 51 69 0.00% 52 83 0.00% 53 82 0.00% 54 83 0.00% 55 110 0.00% 56 99 0.00% 57 113 0.00% 58 107 0.00% 59 142 0.00% 60 189 0.00% 61 202 0.00% 62 226 0.00% 63 255 0.00% 64 305 0.00% 65 320 0.00% 66 309 0.00% 67 444 0.00% 68 571 0.00% 69 1105 0.01% 70 1097 0.01% 71 828 0.00% 72 793 0.00% 73 882 0.01% 74 1046 0.01% 75 1100 0.01% 76 1188 0.01% 77 1348 0.01% 78 1469 0.01% 79 1603 0.01% 80 1940 0.01% 81 2047 0.01% 82 2427 0.01% 83 2803 0.02% 84 3611 0.02% 85 4316 0.02% 86 4654 0.03% 87 5001 0.03% 88 5443 0.03% 89 5831 0.03% 90 6071 0.03% 91 6519 0.04% 92 6937 0.04% 93 7415 0.04% 94 8138 0.05% 95 8584 0.05% 96 9311 0.05% 97 9740 0.06% 98 9880 0.06% 99 10692 0.06% 100 11410 0.07% 101 12020 0.07% 102 12872 0.07% 103 13746 0.08% 104 14570 0.08% 105 15532 0.09% 106 16146 0.09% 107 16600 0.09% 108 17367 0.10% 109 17890 0.10% 110 18843 0.11% 111 19835 0.11% 112 20991 0.12% 113 22522 0.13% 114 23355 0.13% 115 24640 0.14% 116 26006 0.15% 117 26819 0.15% 118 27682 0.16% 119 28106 0.16% 120 29635 0.17% 121 30598 0.17% 122 32350 0.18% 123 33874 0.19% 124 35493 0.20% 125 37415 0.21% 126 38993 0.22% 127 40565 0.23% 128 41903 0.24% 129 44147 0.25% 130 45572 0.26% 131 47986 0.27% 132 50414 0.29% 133 53299 0.30% 134 56674 0.32% 135 61245 0.35% 136 64495 0.37% 137 68549 0.39% 138 73386 0.42% 139 77100 0.44% 140 81918 0.47% 141 87967 0.50% 142 96776 0.55% 143 108751 0.62% 144 124553 0.71% 145 146072 0.83% 146 177682 1.01% 147 237918 1.36% 148 352386 2.01% 149 669649 3.83% 150 3558713 20.33% 151 10374707 59.26% 17505814 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=12.75 fanout-score-rank=11 prefix-density=0.34 prefix-fanout=6.5 sequence=GGTGCTGGTGCTGGAGTAGGAGGTTTAGGTGTAAAGATATCAAGAGGAAGAAGCACCTTGTCAACCTGATAAACAGCTAACTGGCTATCAGTGTAGATAGTGCCGGATACGCTTGTATTTGTAAGCCCTGTAGTTATATTCACAGAGTTTCCTGTGGTGGTTACGTTAAGCTCTAACCTGCCACCTGATCCTGCTTGTGTGGTCAGAGGGTTGCTCACAGTCTGGAACTGGGAACTTGATAGAAATTGTGGTATAATGTGAAACTGTACTAGCTCAGCCTTTTCTTGATCGCTTAGGGAGTTGAGGGTGCCTGATTTGAGACTTGAAAATGCGTTATCGCTAGGTGCAAAGATGGTTATAGCATTGTTTGTGTTGTTGAGCTGGCCATTCA criterion=fanout-score sequence-density=0.12 sequence-density-rank=7 fanout-score=108.61 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=19.2 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.84 fanout-score-rank=39 prefix-density=0.25 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.11 sequence-density-rank=15 fanout-score=272.38 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=29.7 sequence=AAGAAGAAGAAA SRR7169566 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 04:35:33 Started mapping on | Feb 11 04:35:56 Finished on | Feb 11 06:00:45 Mapping speed, Million of reads per hour | 12.38 Number of input reads | 17505814 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 16704402 Uniquely mapped reads % | 95.42% Average mapped length | 295.09 Number of splices: Total | 16221666 Number of splices: Annotated (sjdb) | 15942713 Number of splices: GT/AG | 15981846 Number of splices: GC/AG | 192840 Number of splices: AT/AC | 13323 Number of splices: Non-canonical | 33657 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 306746 % of reads mapped to multiple loci | 1.75% Number of reads mapped to too many loci | 45043 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.51% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 510097 510097 510097 N_multimapping 306746 306746 306746 N_noFeature 408160 16507118 514915 N_ambiguous 164401 1255 72864 UnstrandedReadsAssigned:16131841 PositiveStrandReadsAssigned:196029 NegativeStrandReadsAssigned:16116623 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169566 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169566-trimmed-pair1.fastq SRR7169566-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,505,814 reads, 16,013,765 reads pseudoaligned [quant] estimated average fragment length: 255.646 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,199 rounds 52401 SRR7169566.ke.tsv 34699 SRR7169566.se.tsv 87100 total ==> SRR7169566.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1763.35 359 12.5997 Potri.005G024800.1.v4.1 1035 780.354 38 3.01369 Potri.004G059700.1.v4.1 961 706.398 6 0.525664 Potri.007G009000.2.v4.1 1416 1161.35 0 0 Potri.003G141000.2.v4.1 2943 2688.35 331 7.61987 Potri.016G087400.1.v4.1 270 77.186 1586 1271.66 Potri.015G069301.1.v4.1 564 316.69 0 0 Potri.010G195200.1.v4.1 1773 1518.35 22 0.896717 Potri.012G127500.1.v4.1 977 722.379 6938 594.395 ==> SRR7169566.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1287 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 217 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 13 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169566 completed mapping pipeline successfully