Starting /dee2/code/volunteer_pipeline.sh SRR7169567 current disk space = 3057294184448 free memory = 1037811244 SRR7169567 SRAfilesize a2719f334871033d930eb022432bd5f1 SRR7169567.sra SRR7169567.sra file validated SRR7169567 is paired end SRR7169567 is conventional basespace SRR7169567 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169567_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.67075 34.0 33.0 34.0 33.0 34.0 2 33.33775 34.0 33.0 34.0 33.0 34.0 3 33.459 34.0 34.0 34.0 33.0 34.0 4 33.42725 34.0 34.0 34.0 33.0 34.0 5 33.4595 34.0 34.0 34.0 33.0 34.0 6 37.01675 38.0 37.0 38.0 36.0 38.0 7 37.38475 38.0 38.0 38.0 37.0 38.0 8 37.43575 38.0 38.0 38.0 37.0 38.0 9 37.454 38.0 38.0 38.0 37.0 38.0 10-14 37.46875 38.0 38.0 38.0 37.0 38.0 15-19 37.46505 38.0 38.0 38.0 37.0 38.0 20-24 37.43145 38.0 38.0 38.0 37.0 38.0 25-29 37.39065 38.0 38.0 38.0 37.0 38.0 30-34 37.3173 38.0 38.0 38.0 37.0 38.0 35-39 37.253150000000005 38.0 38.0 38.0 36.8 38.0 40-44 37.10060000000001 38.0 38.0 38.0 36.0 38.0 45-49 36.97745 38.0 38.0 38.0 36.0 38.0 50-54 36.89555 38.0 38.0 38.0 36.0 38.0 55-59 36.85515 38.0 38.0 38.0 35.0 38.0 60-64 36.7993 38.0 38.0 38.0 35.0 38.0 65-69 36.65125 38.0 38.0 38.0 34.4 38.0 70-74 36.67555 38.0 38.0 38.0 34.8 38.0 75-79 36.5344 38.0 38.0 38.0 34.2 38.0 80-84 36.41625 38.0 38.0 38.0 34.0 38.0 85-89 36.2406 38.0 37.0 38.0 34.0 38.0 90-94 36.13895 38.0 37.2 38.0 33.4 38.0 95-99 35.9809 38.0 37.0 38.0 33.2 38.0 100-104 35.7187 38.0 37.0 38.0 31.2 38.0 105-109 35.5191 38.0 36.8 38.0 30.0 38.0 110-114 35.37675 38.0 36.4 38.0 30.4 38.0 115-119 35.06965 38.0 36.0 38.0 28.4 38.0 120-124 34.891650000000006 38.0 35.8 38.0 27.8 38.0 125-129 34.52225 38.0 35.0 38.0 26.2 38.0 130-134 34.22775 38.0 35.0 38.0 24.4 38.0 135-139 33.91865 38.0 34.8 38.0 23.0 38.0 140-144 33.562400000000004 38.0 34.0 38.0 20.6 38.0 145-149 32.747 38.0 33.8 38.0 15.4 38.0 150-151 28.782249999999998 36.0 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 1.0 10 1.0 11 0.0 12 1.0 13 2.0 14 4.0 15 1.0 16 4.0 17 6.0 18 7.0 19 7.0 20 10.0 21 10.0 22 3.0 23 13.0 24 15.0 25 22.0 26 22.0 27 18.0 28 31.0 29 41.0 30 55.0 31 77.0 32 92.0 33 107.0 34 186.0 35 329.0 36 782.0 37 2151.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.988741044012286 12.18014329580348 7.471852610030706 37.35926305015353 2 23.525 13.975000000000001 33.375 29.125 3 20.150000000000002 16.6 26.6 36.65 4 22.475 26.325 23.225 27.975 5 22.325 30.25 24.95 22.475 6 20.575 34.325 24.45 20.65 7 14.924999999999999 27.1 40.1 17.875 8 17.8 27.375 30.175 24.65 9 17.275 25.5 34.050000000000004 23.175 10-14 20.0 29.409999999999997 27.555000000000003 23.035 15-19 19.919999999999998 28.22 27.639999999999997 24.22 20-24 20.28 28.439999999999998 27.76 23.52 25-29 19.98 28.449999999999996 27.605 23.965 30-34 20.175 28.605000000000004 27.384999999999998 23.835 35-39 19.935 28.825 27.415 23.825 40-44 20.43 28.655 27.405 23.51 45-49 20.285 28.355000000000004 27.62 23.74 50-54 20.025000000000002 28.025 27.73 24.22 55-59 19.950000000000003 28.82 27.155 24.075 60-64 20.18 28.720000000000002 27.37 23.73 65-69 20.345 28.050000000000004 27.575 24.03 70-74 20.135 28.4 27.68 23.785 75-79 20.990000000000002 27.800000000000004 27.415 23.794999999999998 80-84 20.580000000000002 27.744999999999997 27.775 23.9 85-89 20.61 28.360000000000003 27.255000000000003 23.775 90-94 20.035 28.34 27.474999999999998 24.15 95-99 19.875 27.755000000000003 28.244999999999997 24.125 100-104 20.600450337753315 28.55641731298474 26.82011508631474 24.02301726294721 105-109 20.185 27.91 27.994999999999997 23.91 110-114 20.266346250125164 27.901271653149095 28.456994092320016 23.37538800440573 115-119 20.562337402441464 28.10686411847108 27.531518911346808 23.799279567740644 120-124 20.6294406084259 27.974582207545286 27.194035825077556 24.201941358951267 125-129 21.035 28.02 27.365000000000002 23.580000000000002 130-134 20.67947563294306 28.179725808065648 27.37916541579105 23.76163314320024 135-139 21.08 27.794999999999998 26.87 24.255 140-144 20.995 28.48 26.855 23.669999999999998 145-149 20.805 28.685 26.900000000000002 23.61 150-151 20.9375 27.825 26.5625 24.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 3.0 23 2.0 24 2.5 25 3.5 26 3.5 27 6.0 28 8.5 29 12.0 30 15.0 31 19.5 32 25.5 33 33.0 34 43.0 35 55.5 36 79.5 37 107.0 38 116.0 39 150.5 40 196.0 41 216.5 42 240.5 43 260.0 44 269.5 45 278.5 46 276.0 47 263.0 48 240.0 49 201.5 50 164.5 51 144.5 52 139.5 53 111.5 54 76.5 55 59.0 56 40.5 57 29.5 58 25.0 59 16.5 60 9.5 61 10.0 62 11.0 63 8.5 64 5.5 65 4.0 66 4.0 67 3.5 68 3.5 69 2.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.075 105-109 0.0 110-114 0.13 115-119 0.06 120-124 0.06999999999999999 125-129 0.0 130-134 0.06999999999999999 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.44999999999999996 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.575 0.0 0.0 0.0 0.0 108-109 0.6625 0.0 0.0 0.0 0.0 110-111 0.775 0.0 0.0 0.0 0.0 112-113 0.9 0.0 0.0 0.0 0.0 114-115 0.95 0.0 0.0 0.0 0.0 116-117 1.025 0.0 0.0 0.0 0.0 118-119 1.1 0.0 0.0 0.0 0.0 120-121 1.3624999999999998 0.0 0.0 0.0 0.0 122-123 1.5125 0.0 0.0 0.0 0.0 124-125 1.725 0.0 0.0 0.0 0.0 126-127 1.8875000000000002 0.0 0.0 0.0 0.0 128-129 2.0125 0.0 0.0 0.0 0.0 130-131 2.2125 0.0 0.0 0.0 0.0 132-133 2.5375 0.0 0.0 0.0 0.0 134-135 2.8375 0.0 0.0 0.0 0.0 136-137 3.05 0.0 0.0 0.0 0.0 138-139 3.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGATTG 10 0.006832588 144.9875 9 TTCTCTC 10 0.006832588 144.9875 9 CGCAAAG 10 0.006832588 144.9875 2 >>END_MODULE SRR7169567 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169567_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.42175 33.0 33.0 34.0 32.0 34.0 2 32.7745 33.0 33.0 34.0 32.0 34.0 3 32.865 34.0 33.0 34.0 32.0 34.0 4 32.95175 34.0 33.0 34.0 32.0 34.0 5 32.8585 34.0 33.0 34.0 32.0 34.0 6 37.02525 38.0 38.0 38.0 36.0 38.0 7 37.04125 38.0 38.0 38.0 37.0 38.0 8 36.982 38.0 38.0 38.0 36.0 38.0 9 36.9505 38.0 38.0 38.0 36.0 38.0 10-14 36.9501 38.0 38.0 38.0 36.2 38.0 15-19 36.94815 38.0 38.0 38.0 36.0 38.0 20-24 36.98700000000001 38.0 38.0 38.0 36.2 38.0 25-29 37.00045 38.0 38.0 38.0 36.6 38.0 30-34 37.0187 38.0 38.0 38.0 36.4 38.0 35-39 36.90390000000001 38.0 38.0 38.0 36.2 38.0 40-44 36.8857 38.0 38.0 38.0 36.0 38.0 45-49 36.87045 38.0 38.0 38.0 36.0 38.0 50-54 36.624199999999995 38.0 38.0 38.0 35.8 38.0 55-59 36.1481 38.0 38.0 38.0 34.8 38.0 60-64 35.94705 38.0 38.0 38.0 34.0 38.0 65-69 35.758799999999994 38.0 38.0 38.0 34.0 38.0 70-74 35.6278 38.0 38.0 38.0 33.4 38.0 75-79 35.5088 38.0 38.0 38.0 32.6 38.0 80-84 35.61055 38.0 38.0 38.0 32.8 38.0 85-89 35.70745 38.0 38.0 38.0 33.0 38.0 90-94 35.62045 38.0 38.0 38.0 33.0 38.0 95-99 35.6246 38.0 38.0 38.0 32.6 38.0 100-104 35.51115 38.0 38.0 38.0 32.0 38.0 105-109 35.38925 38.0 38.0 38.0 31.2 38.0 110-114 35.29225 38.0 37.4 38.0 31.0 38.0 115-119 35.00515 38.0 37.2 38.0 29.0 38.0 120-124 34.715250000000005 38.0 36.6 38.0 27.4 38.0 125-129 34.67045 38.0 36.4 38.0 27.8 38.0 130-134 34.25075 38.0 36.0 38.0 24.2 38.0 135-139 33.8197 38.0 35.2 38.0 21.8 38.0 140-144 33.43 38.0 35.0 38.0 15.8 38.0 145-149 32.64805 38.0 34.6 38.0 11.2 38.0 150-151 28.985374999999998 36.0 24.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 4.0 4 0.0 5 2.0 6 0.0 7 1.0 8 1.0 9 4.0 10 2.0 11 7.0 12 13.0 13 28.0 14 27.0 15 2.0 16 8.0 17 6.0 18 6.0 19 9.0 20 5.0 21 10.0 22 19.0 23 16.0 24 24.0 25 12.0 26 25.0 27 30.0 28 32.0 29 38.0 30 55.0 31 61.0 32 75.0 33 85.0 34 137.0 35 215.0 36 439.0 37 2593.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.41633064516129 24.495967741935484 12.02116935483871 27.06653225806452 2 28.65 27.150000000000002 28.175 16.025 3 19.75 28.849999999999998 31.85 19.55 4 22.725 35.175 23.875 18.224999999999998 5 25.025 34.925 22.275 17.775 6 21.9 37.525 23.724999999999998 16.85 7 21.6 21.7 37.574999999999996 19.125 8 22.0 24.525 28.4 25.074999999999996 9 21.65 24.625 30.599999999999998 23.125 10-14 23.313313313313312 28.90890890890891 25.850850850850847 21.926926926926924 15-19 23.72609870857944 28.05085594153569 27.41015116628291 20.812894183601962 20-24 23.465 27.474999999999998 27.72 21.34 25-29 23.175 28.29 27.595 20.94 30-34 22.770000000000003 27.785 27.815 21.63 35-39 23.175 28.415000000000003 27.46 20.95 40-44 23.5 27.339999999999996 27.66 21.5 45-49 24.11 28.07 27.395000000000003 20.424999999999997 50-54 23.766658285139552 28.141815438772944 27.020367110887605 21.071159165199898 55-59 23.702836193288864 28.071694078109882 27.48103263913641 20.74443708946484 60-64 23.740786240786242 28.235053235053236 27.354627354627354 20.669533169533167 65-69 23.17342793973983 27.122217080569694 27.76492364645997 21.939431333230498 70-74 23.36506303061487 27.707743761255465 28.582454334962698 20.344738873166968 75-79 23.65436172406682 27.711899360692925 27.80470200041246 20.8290369148278 80-84 23.542072358306857 28.0875269037614 27.33422158450343 21.036179153428307 85-89 24.15515571639737 27.641571945562976 27.84545593557266 20.357816402466998 90-94 24.012823122328516 27.34581721962141 28.119275391817627 20.522084266232444 95-99 23.5320984521695 27.911697538695762 27.744227353463586 20.81197665567115 100-104 24.151058321912593 27.546825034262216 27.744784528704123 20.55733211512106 105-109 23.778138308659504 27.20036503751774 28.14337862502535 20.878118028797406 110-114 22.899680964197096 28.363802096520992 27.91816478452423 20.818352154757687 115-119 23.494919880705655 28.120103118839406 27.826922104837486 20.55805489561745 120-124 24.274886306215258 27.96361798888328 27.417887822132393 20.343607882769074 125-129 23.926629744423554 28.799349626543368 27.148010771810377 20.1260098572227 130-134 24.812528694587563 27.266234759985718 27.25093097995205 20.670305565474674 135-139 24.410739905718383 27.992416478786637 27.029104324656693 20.567739290838286 140-144 24.5749216623003 27.72384034519957 27.384805054707968 20.31643293779216 145-149 24.679884345311855 27.643535729037588 27.49380421313507 20.18277571251549 150-151 24.352667011910928 27.67995857068876 27.589331952356293 20.378042465044018 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 1.0 17 1.5 18 2.5 19 4.5 20 6.0 21 5.0 22 4.5 23 7.0 24 8.0 25 9.5 26 9.5 27 7.5 28 8.5 29 12.5 30 17.5 31 15.0 32 16.0 33 27.0 34 39.5 35 60.5 36 80.5 37 99.5 38 121.0 39 156.0 40 198.5 41 228.5 42 253.0 43 275.5 44 283.5 45 279.0 46 264.5 47 242.0 48 231.0 49 219.5 50 189.0 51 146.5 52 110.0 53 82.0 54 63.0 55 45.5 56 34.5 57 29.5 58 22.5 59 17.5 60 14.5 61 11.5 62 7.5 63 6.0 64 5.5 65 4.5 66 4.5 67 3.5 68 1.5 69 1.0 70 1.0 71 1.0 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.1 15-19 0.11 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.575 55-59 1.805 60-64 2.32 65-69 2.7550000000000003 70-74 2.825 75-79 3.02 80-84 2.4299999999999997 85-89 1.905 90-94 1.7399999999999998 95-99 1.4749999999999999 100-104 1.4949999999999999 105-109 1.38 110-114 1.265 115-119 1.085 120-124 1.05 125-129 1.595 130-134 1.9849999999999999 135-139 2.42 140-144 2.665 145-149 3.16 150-151 3.45 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.2875 0.0 0.0 0.0 0.0 100-101 0.32499999999999996 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.5875 0.0 0.0 0.0 0.0 110-111 0.6875 0.0 0.0 0.0 0.0 112-113 0.8 0.0 0.0 0.0 0.0 114-115 0.85 0.0 0.0 0.0 0.0 116-117 0.925 0.0 0.0 0.0 0.0 118-119 1.0 0.0 0.0 0.0 0.0 120-121 1.2875 0.0 0.0 0.0 0.0 122-123 1.425 0.0 0.0 0.0 0.0 124-125 1.6125 0.0 0.0 0.0 0.0 126-127 1.7625000000000002 0.0 0.0 0.0 0.0 128-129 1.9125 0.0 0.0 0.0 0.0 130-131 2.1125 0.0 0.0 0.0 0.0 132-133 2.4375 0.0 0.0 0.0 0.0 134-135 2.725 0.0 0.0 0.0 0.0 136-137 2.925 0.0 0.0 0.0 0.0 138-139 3.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 873876 spots for SRR7169567.sra Written 873876 spots for SRR7169567.sra Read 873876 spots for SRR7169567.sra Written 873876 spots for SRR7169567.sra Read 873876 spots for SRR7169567.sra Written 873876 spots for SRR7169567.sra Read 873876 spots for SRR7169567.sra Written 873876 spots for SRR7169567.sra Read 873876 spots for SRR7169567.sra Written 873876 spots for SRR7169567.sra Read 873876 spots for SRR7169567.sra Written 873876 spots for SRR7169567.sra Read 873876 spots for SRR7169567.sra Written 873876 spots for SRR7169567.sra Read 873876 spots for SRR7169567.sra Written 873876 spots for SRR7169567.sra Read 873876 spots for SRR7169567.sra Written 873876 spots for SRR7169567.sra Read 873876 spots for SRR7169567.sra Written 873876 spots for SRR7169567.sra Read 873876 spots for SRR7169567.sra Written 873876 spots for SRR7169567.sra Read 873876 spots for SRR7169567.sra Written 873876 spots for SRR7169567.sra Read 873876 spots for SRR7169567.sra Written 873876 spots for SRR7169567.sra Read 873876 spots for SRR7169567.sra Written 873876 spots for SRR7169567.sra Read 873876 spots for SRR7169567.sra Written 873876 spots for SRR7169567.sra Read 873876 spots for SRR7169567.sra Written 873876 spots for SRR7169567.sra Read 873876 spots for SRR7169567.sra Written 873876 spots for SRR7169567.sra Read 873876 spots for SRR7169567.sra Written 873876 spots for SRR7169567.sra Read 873876 spots for SRR7169567.sra Written 873876 spots for SRR7169567.sra Read 873876 spots for SRR7169567.sra Written 873876 spots for SRR7169567.sra SRR ids: ['SRR7169567.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m7ruldiy SRR7169567.sra spots: 17477520 blocks: [[1, 873876], [873877, 1747752], [1747753, 2621628], [2621629, 3495504], [3495505, 4369380], [4369381, 5243256], [5243257, 6117132], [6117133, 6991008], [6991009, 7864884], [7864885, 8738760], [8738761, 9612636], [9612637, 10486512], [10486513, 11360388], [11360389, 12234264], [12234265, 13108140], [13108141, 13982016], [13982017, 14855892], [14855893, 15729768], [15729769, 16603644], [16603645, 17477520]] SRR7169567 file size 5900857 SRR7169567 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169567 SRR7169567_1.fastq SRR7169567_2.fastq Input file: SRR7169567_1.fastq Paired file: SRR7169567_2.fastq trimmed: SRR7169567-trimmed-pair1.fastq, SRR7169567-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 01:03:15 2025 >> started Tue Feb 11 01:03:36 2025 >> done (21.220s) 17477520 read pairs processed; of these: 17722 ( 0.10%) short read pairs filtered out after trimming by size control 17077 ( 0.10%) empty read pairs filtered out after trimming by size control 17442721 (99.80%) read pairs available; of these: 9587244 (54.96%) trimmed read pairs available after processing 7855477 (45.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 3 0.00% 21 7 0.00% 22 7 0.00% 23 11 0.00% 24 6 0.00% 25 7 0.00% 26 9 0.00% 27 20 0.00% 28 7 0.00% 29 12 0.00% 30 17 0.00% 31 9 0.00% 32 15 0.00% 33 22 0.00% 34 19 0.00% 35 76 0.00% 36 38 0.00% 37 16 0.00% 38 29 0.00% 39 30 0.00% 40 30 0.00% 41 29 0.00% 42 48 0.00% 43 35 0.00% 44 35 0.00% 45 50 0.00% 46 54 0.00% 47 60 0.00% 48 68 0.00% 49 77 0.00% 50 53 0.00% 51 85 0.00% 52 98 0.00% 53 104 0.00% 54 88 0.00% 55 144 0.00% 56 127 0.00% 57 142 0.00% 58 182 0.00% 59 226 0.00% 60 194 0.00% 61 242 0.00% 62 271 0.00% 63 332 0.00% 64 320 0.00% 65 377 0.00% 66 429 0.00% 67 473 0.00% 68 547 0.00% 69 810 0.00% 70 899 0.01% 71 897 0.01% 72 930 0.01% 73 1090 0.01% 74 1324 0.01% 75 1684 0.01% 76 1393 0.01% 77 1149 0.01% 78 1582 0.01% 79 2647 0.02% 80 4154 0.02% 81 1776 0.01% 82 2046 0.01% 83 2400 0.01% 84 3236 0.02% 85 3942 0.02% 86 4619 0.03% 87 4678 0.03% 88 4707 0.03% 89 5025 0.03% 90 5282 0.03% 91 5736 0.03% 92 6166 0.04% 93 6575 0.04% 94 7452 0.04% 95 7932 0.05% 96 8769 0.05% 97 9526 0.05% 98 11096 0.06% 99 13701 0.08% 100 17057 0.10% 101 14284 0.08% 102 11936 0.07% 103 12281 0.07% 104 12987 0.07% 105 13911 0.08% 106 14618 0.08% 107 15304 0.09% 108 16085 0.09% 109 17168 0.10% 110 17872 0.10% 111 18890 0.11% 112 20123 0.12% 113 21283 0.12% 114 22427 0.13% 115 23463 0.13% 116 24957 0.14% 117 26424 0.15% 118 27734 0.16% 119 29163 0.17% 120 30587 0.18% 121 32315 0.19% 122 34230 0.20% 123 36060 0.21% 124 38430 0.22% 125 40337 0.23% 126 43093 0.25% 127 45620 0.26% 128 47778 0.27% 129 50433 0.29% 130 53166 0.30% 131 56031 0.32% 132 60412 0.35% 133 65325 0.37% 134 69622 0.40% 135 75361 0.43% 136 81274 0.47% 137 87366 0.50% 138 95485 0.55% 139 106764 0.61% 140 116117 0.67% 141 126668 0.73% 142 141915 0.81% 143 162092 0.93% 144 191115 1.10% 145 231257 1.33% 146 293284 1.68% 147 402500 2.31% 148 615749 3.53% 149 1203816 6.90% 150 4436569 25.44% 151 7855477 45.04% 17442721 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=41 prefix-density=0.14 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.10 sequence-density-rank=14 fanout-score=271.27 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=29.3 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.79 fanout-score-rank=41 prefix-density=0.29 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=24 fanout-score=299.97 fanout-score-rank=1 prefix-density=1.03 prefix-fanout=28.1 sequence=AAGAAGAAGAAG SRR7169567 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 01:04:26 Started mapping on | Feb 11 01:04:26 Finished on | Feb 11 01:06:10 Mapping speed, Million of reads per hour | 603.79 Number of input reads | 17442721 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 16601860 Uniquely mapped reads % | 95.18% Average mapped length | 294.12 Number of splices: Total | 16312026 Number of splices: Annotated (sjdb) | 16043850 Number of splices: GT/AG | 16066994 Number of splices: GC/AG | 195679 Number of splices: AT/AC | 12575 Number of splices: Non-canonical | 36778 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 334441 % of reads mapped to multiple loci | 1.92% Number of reads mapped to too many loci | 31347 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.67% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 525250 525250 525250 N_multimapping 334441 334441 334441 N_noFeature 331300 16436918 406985 N_ambiguous 155192 857 65325 UnstrandedReadsAssigned:16115368 PositiveStrandReadsAssigned:164085 NegativeStrandReadsAssigned:16129550 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169567 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169567-trimmed-pair1.fastq SRR7169567-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,442,721 reads, 16,043,966 reads pseudoaligned [quant] estimated average fragment length: 250.454 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,167 rounds 52401 SRR7169567.ke.tsv 34699 SRR7169567.se.tsv 87100 total ==> SRR7169567.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1768.55 324 10.8211 Potri.005G024800.1.v4.1 1035 785.546 42 3.15805 Potri.004G059700.1.v4.1 961 711.584 1 0.0830071 Potri.007G009000.2.v4.1 1416 1166.55 0 0 Potri.003G141000.2.v4.1 2943 2693.55 329.037 7.21541 Potri.016G087400.1.v4.1 270 73.2084 1317 1062.59 Potri.015G069301.1.v4.1 564 319.99 0 0 Potri.010G195200.1.v4.1 1773 1523.55 36 1.39569 Potri.012G127500.1.v4.1 977 727.568 6826 554.159 ==> SRR7169567.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 891 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 239 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169567 completed mapping pipeline successfully