Starting /dee2/code/volunteer_pipeline.sh SRR7169568 current disk space = 2819075428352 free memory = 1581159192 SRR7169568 SRAfilesize 3af5a90a7ae6bf94cfb1f4cb9c0a2493 SRR7169568.sra SRR7169568.sra file validated SRR7169568 is paired end SRR7169568 is conventional basespace SRR7169568 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169568_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.00825 34.0 33.0 34.0 33.0 34.0 2 33.50425 34.0 34.0 34.0 33.0 34.0 3 33.47125 34.0 34.0 34.0 33.0 34.0 4 33.50775 34.0 34.0 34.0 33.0 34.0 5 33.5505 34.0 34.0 34.0 33.0 34.0 6 37.12675 38.0 37.0 38.0 36.0 38.0 7 37.39175 38.0 38.0 38.0 37.0 38.0 8 37.45975 38.0 38.0 38.0 37.0 38.0 9 37.54425 38.0 38.0 38.0 37.0 38.0 10-14 37.51895 38.0 38.0 38.0 37.8 38.0 15-19 37.54075 38.0 38.0 38.0 37.8 38.0 20-24 37.539100000000005 38.0 38.0 38.0 37.8 38.0 25-29 37.5116 38.0 38.0 38.0 37.8 38.0 30-34 37.5086 38.0 38.0 38.0 38.0 38.0 35-39 37.344 38.0 38.0 38.0 37.0 38.0 40-44 37.3329 38.0 38.0 38.0 37.0 38.0 45-49 37.27075000000001 38.0 38.0 38.0 37.0 38.0 50-54 37.2531 38.0 38.0 38.0 36.2 38.0 55-59 37.19365 38.0 38.0 38.0 36.0 38.0 60-64 37.1429 38.0 38.0 38.0 36.0 38.0 65-69 37.11595 38.0 38.0 38.0 36.0 38.0 70-74 37.032849999999996 38.0 38.0 38.0 36.0 38.0 75-79 37.0294 38.0 38.0 38.0 36.0 38.0 80-84 36.896699999999996 38.0 38.0 38.0 35.6 38.0 85-89 36.853449999999995 38.0 38.0 38.0 35.2 38.0 90-94 36.8106 38.0 38.0 38.0 35.2 38.0 95-99 36.6736 38.0 38.0 38.0 34.8 38.0 100-104 36.5823 38.0 38.0 38.0 34.2 38.0 105-109 36.4392 38.0 38.0 38.0 34.0 38.0 110-114 36.28955 38.0 37.8 38.0 33.8 38.0 115-119 36.094849999999994 38.0 37.0 38.0 33.4 38.0 120-124 35.866 38.0 37.0 38.0 32.0 38.0 125-129 35.77715 38.0 37.0 38.0 32.6 38.0 130-134 35.60170000000001 38.0 36.2 38.0 31.0 38.0 135-139 35.2162 38.0 36.0 38.0 30.0 38.0 140-144 34.91134999999999 38.0 35.6 38.0 28.8 38.0 145-149 34.32415 38.0 35.0 38.0 26.6 38.0 150-151 31.411500000000004 36.5 31.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 2.0 16 2.0 17 2.0 18 0.0 19 3.0 20 4.0 21 1.0 22 7.0 23 7.0 24 11.0 25 8.0 26 16.0 27 19.0 28 24.0 29 28.0 30 29.0 31 47.0 32 63.0 33 91.0 34 135.0 35 239.0 36 595.0 37 2665.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.285097740543286 11.906575272911907 8.657019548108657 36.151307438436156 2 24.349999999999998 13.4 32.675 29.575000000000003 3 20.175 18.5 24.6 36.725 4 23.45 26.474999999999998 22.725 27.35 5 23.825 30.225 23.375 22.575 6 18.625 34.775 24.975 21.625 7 14.099999999999998 27.1 40.825 17.974999999999998 8 16.55 25.650000000000002 32.0 25.8 9 16.575 23.925 34.375 25.124999999999996 10-14 19.535 30.320000000000004 27.1 23.044999999999998 15-19 20.215 27.939999999999998 27.85 23.995 20-24 20.18 28.544999999999998 27.455000000000002 23.82 25-29 20.105 28.444999999999997 27.455000000000002 23.995 30-34 19.855 28.78 27.900000000000002 23.465 35-39 19.950000000000003 28.465 27.525 24.060000000000002 40-44 20.075000000000003 28.725 27.625 23.575 45-49 20.215 28.355000000000004 27.735 23.695 50-54 20.419999999999998 28.62 27.365000000000002 23.595 55-59 20.25 28.499999999999996 26.884999999999998 24.365000000000002 60-64 20.0 28.98 26.83 24.19 65-69 20.3 28.22 27.26 24.22 70-74 20.05 28.96 27.18 23.810000000000002 75-79 19.915 28.725 27.075 24.285 80-84 20.064999999999998 27.694999999999997 27.439999999999998 24.8 85-89 20.415 28.395 27.46 23.73 90-94 20.7 27.815 27.939999999999998 23.544999999999998 95-99 20.36 27.815 27.83 23.995 100-104 20.225 28.549999999999997 27.200000000000003 24.025 105-109 20.11 28.144999999999996 27.66 24.085 110-114 20.865000000000002 28.315 27.224999999999998 23.595 115-119 20.549999999999997 28.26 27.400000000000002 23.79 120-124 20.73 28.26 26.595000000000002 24.415 125-129 20.94 28.095 27.465 23.5 130-134 20.935000000000002 28.035 27.089999999999996 23.94 135-139 21.025 27.46 27.284999999999997 24.23 140-144 20.955 28.294999999999998 26.605 24.145 145-149 21.22 27.91 27.07 23.799999999999997 150-151 20.375 27.675 26.6625 25.2875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 0.5 21 0.0 22 0.0 23 1.5 24 2.0 25 1.0 26 3.5 27 4.5 28 4.5 29 10.5 30 16.5 31 19.5 32 26.0 33 35.5 34 58.0 35 78.0 36 92.0 37 105.0 38 125.0 39 155.5 40 168.5 41 199.0 42 238.0 43 243.5 44 254.5 45 283.0 46 287.0 47 271.5 48 234.0 49 194.5 50 174.0 51 141.0 52 130.0 53 107.0 54 76.0 55 62.5 56 36.0 57 31.5 58 33.0 59 24.0 60 17.0 61 13.0 62 12.5 63 7.0 64 1.5 65 2.0 66 2.0 67 3.5 68 3.0 69 2.0 70 2.0 71 1.0 72 1.0 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.525 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57297161517207 99.1 2 0.37678975131876413 0.75 3 0.050238633509168545 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.575 0.0 0.0 0.0 0.0 96-97 0.6625000000000001 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 0.9624999999999999 0.0 0.0 0.0 0.0 102-103 1.0625 0.0 0.0 0.0 0.0 104-105 1.225 0.0 0.0 0.0 0.0 106-107 1.375 0.0 0.0 0.0 0.0 108-109 1.5875 0.0 0.0 0.0 0.0 110-111 1.8375 0.0 0.0 0.0 0.0 112-113 2.075 0.0 0.0 0.0 0.0 114-115 2.3625 0.0 0.0 0.0 0.0 116-117 2.625 0.0 0.0 0.0 0.0 118-119 2.975 0.0 0.0 0.0 0.0 120-121 3.1625 0.0 0.0 0.0 0.0 122-123 3.425 0.0 0.0 0.0 0.0 124-125 3.7125 0.0 0.0 0.0 0.0 126-127 4.0625 0.0 0.0 0.0 0.0 128-129 4.475 0.0 0.0 0.0 0.0 130-131 4.85 0.0 0.0 0.0 0.0 132-133 5.3875 0.0 0.0 0.0 0.0 134-135 5.975 0.0 0.0 0.0 0.0 136-137 6.3875 0.0 0.0 0.0 0.0 138-139 6.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTGATA 10 0.006830828 145.0 1 AGCACTT 10 0.006830828 145.0 4 GAAGAGC 45 6.5511256E-4 19.333332 140-144 GATCGGA 55 0.0025160722 15.818182 135-139 >>END_MODULE SRR7169568 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169568_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.84225 33.0 33.0 34.0 32.0 34.0 2 32.98375 34.0 33.0 34.0 32.0 34.0 3 33.028 34.0 33.0 34.0 33.0 34.0 4 32.97625 34.0 33.0 34.0 33.0 34.0 5 33.04225 34.0 33.0 34.0 33.0 34.0 6 37.1035 38.0 38.0 38.0 37.0 38.0 7 37.2455 38.0 38.0 38.0 37.0 38.0 8 37.224 38.0 38.0 38.0 37.0 38.0 9 37.25325 38.0 38.0 38.0 37.0 38.0 10-14 37.1952 38.0 38.0 38.0 37.0 38.0 15-19 37.13435 38.0 38.0 38.0 37.0 38.0 20-24 37.06445000000001 38.0 38.0 38.0 37.0 38.0 25-29 37.05265000000001 38.0 38.0 38.0 37.0 38.0 30-34 36.980399999999996 38.0 38.0 38.0 36.8 38.0 35-39 36.9728 38.0 38.0 38.0 36.8 38.0 40-44 36.970600000000005 38.0 38.0 38.0 37.0 38.0 45-49 36.97645 38.0 38.0 38.0 37.0 38.0 50-54 36.9447 38.0 38.0 38.0 36.2 38.0 55-59 36.4385 38.0 37.8 38.0 34.0 38.0 60-64 36.806149999999995 38.0 38.0 38.0 36.0 38.0 65-69 36.805499999999995 38.0 38.0 38.0 36.0 38.0 70-74 36.751850000000005 38.0 38.0 38.0 36.0 38.0 75-79 36.654599999999995 38.0 38.0 38.0 35.6 38.0 80-84 36.5237 38.0 38.0 38.0 35.0 38.0 85-89 36.489200000000004 38.0 38.0 38.0 35.0 38.0 90-94 36.39635 38.0 38.0 38.0 34.8 38.0 95-99 36.3969 38.0 38.0 38.0 34.2 38.0 100-104 36.261649999999996 38.0 38.0 38.0 34.2 38.0 105-109 36.177200000000006 38.0 38.0 38.0 34.0 38.0 110-114 36.1119 38.0 38.0 38.0 34.0 38.0 115-119 35.916199999999996 38.0 38.0 38.0 33.2 38.0 120-124 35.65405 38.0 37.4 38.0 32.4 38.0 125-129 35.40025 38.0 37.0 38.0 30.6 38.0 130-134 35.1013 38.0 36.0 38.0 29.8 38.0 135-139 34.8278 38.0 36.0 38.0 28.4 38.0 140-144 34.4168 38.0 35.4 38.0 27.0 38.0 145-149 33.9819 38.0 35.2 38.0 23.6 38.0 150-151 30.177375 36.5 28.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 1.0 4 0.0 5 5.0 6 2.0 7 3.0 8 0.0 9 1.0 10 0.0 11 4.0 12 3.0 13 1.0 14 2.0 15 4.0 16 6.0 17 6.0 18 3.0 19 3.0 20 4.0 21 8.0 22 7.0 23 9.0 24 12.0 25 26.0 26 23.0 27 19.0 28 20.0 29 32.0 30 42.0 31 39.0 32 63.0 33 87.0 34 97.0 35 180.0 36 521.0 37 2752.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.12140175219024 22.22778473091364 13.341677096370464 27.30913642052566 2 28.68955149085442 26.384364820846905 29.16562265096467 15.760461037334 3 21.333667585861118 27.776385058912005 30.408623715216848 20.481323640010025 4 23.327486845402152 33.47531946880481 23.978952643447755 19.218241042345277 5 24.016044121333668 35.82351466532966 23.063424417147154 17.09701679618952 6 21.932899349023536 37.73159739609414 22.70906359539309 17.626439659489236 7 20.45568352528793 21.256885327991988 37.75663495242864 20.530796194291437 8 21.27127127127127 25.75075075075075 28.353353353353356 24.624624624624623 9 21.426783479349186 24.20525657071339 29.962453066332916 24.405506883604506 10-14 23.038798498122652 28.545682102628284 26.282853566958696 22.132665832290364 15-19 23.4177848988584 27.628680152213096 27.80392549569397 21.14960945323453 20-24 23.520280420630947 28.30746119178768 27.591387080620933 20.58087130696044 25-29 23.232981014877524 28.482692982016733 27.621099033211443 20.663226969894303 30-34 23.407132839110396 28.43117611701062 27.36425566018834 20.797435383690644 35-39 22.839969947407965 27.9038317054846 27.628349611820685 21.62784873528675 40-44 23.391256447493618 28.429065050828783 27.908257799589364 20.271420702088236 45-49 23.123529117219967 27.845375794902612 27.830354013319315 21.20074107455811 50-54 23.502327210850307 27.861468394975226 27.88148741304239 20.754716981132077 55-59 23.630994093502853 27.550305335869457 28.00580638702573 20.812894183601962 60-64 23.62953692115144 27.60450563204005 27.97496871088861 20.7909887359199 65-69 23.65074596976069 27.881245619305094 27.575848603184138 20.892159807750073 70-74 24.108752253154417 28.214500300420585 27.19807730823152 20.478670138193472 75-79 23.65284455128205 28.054887820512818 27.53405448717949 20.758213141025642 80-84 23.086939102564102 27.549078525641026 28.540665064102566 20.823317307692307 85-89 23.717948717948715 27.669270833333332 28.009815705128204 20.602964743589745 90-94 24.216324486730095 27.986980470706058 27.516274411617424 20.28042063094642 95-99 23.733733733733732 27.932932932932935 27.74274274274274 20.59059059059059 100-104 24.22680412371134 27.699929936943253 27.409668701831645 20.663597237513763 105-109 24.28700090063044 28.219753827679376 27.409186430501354 20.08405884118883 110-114 24.21284477148721 27.601742003303798 27.661811082745157 20.523602142463833 115-119 24.16382936110555 28.03424794712598 27.158021229721612 20.643901462046866 120-124 24.46670005007511 27.756634952428644 27.426139208813222 20.350525788683026 125-129 24.43654212160673 27.94751076830612 27.34148051687869 20.274466593208455 130-134 25.299213781361107 27.552706695377836 27.122039160699085 20.02604036256197 135-139 24.956168912488103 27.771377047537943 27.380654210289034 19.891799829684917 140-144 25.74976217894157 27.847594252240526 26.971411405397287 19.431232163420617 145-149 25.77949051599019 27.741354286572246 26.83549371903308 19.643661478404482 150-151 24.92184569213455 27.83543828935851 26.947605352007002 20.295110666499937 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 3.0 1 2.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 1.0 24 1.5 25 1.5 26 2.0 27 4.0 28 6.0 29 11.5 30 13.5 31 16.0 32 25.5 33 31.0 34 43.0 35 61.0 36 77.0 37 98.0 38 117.5 39 155.5 40 197.0 41 227.0 42 264.0 43 282.0 44 296.5 45 298.5 46 264.0 47 256.5 48 246.0 49 191.0 50 166.5 51 143.0 52 104.5 53 90.5 54 70.5 55 52.0 56 42.5 57 27.5 58 23.0 59 23.0 60 16.0 61 8.0 62 8.5 63 9.0 64 4.5 65 3.0 66 3.0 67 2.5 68 1.5 69 3.0 70 2.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.22499999999999998 3 0.27499999999999997 4 0.22499999999999998 5 0.27499999999999997 6 0.15 7 0.15 8 0.1 9 0.125 10-14 0.125 15-19 0.13999999999999999 20-24 0.15 25-29 0.185 30-34 0.18 35-39 0.17500000000000002 40-44 0.155 45-49 0.145 50-54 0.095 55-59 0.11 60-64 0.125 65-69 0.13 70-74 0.13999999999999999 75-79 0.16 80-84 0.16 85-89 0.16 90-94 0.15 95-99 0.1 100-104 0.09 105-109 0.06999999999999999 110-114 0.11499999999999999 115-119 0.13999999999999999 120-124 0.15 125-129 0.16999999999999998 130-134 0.155 135-139 0.185 140-144 0.135 145-149 0.095 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62339944765253 99.2 2 0.3263871453678132 0.65 3 0.05021340697966357 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.0125 0.0 0.0 0.025 0.0 82-83 0.05 0.0 0.0 0.025 0.0 84-85 0.0875 0.0 0.0 0.025 0.0 86-87 0.1375 0.0 0.0 0.025 0.0 88-89 0.25 0.0 0.0 0.025 0.0 90-91 0.3 0.0 0.0 0.025 0.0 92-93 0.3875 0.0 0.0 0.025 0.0 94-95 0.525 0.0 0.0 0.025 0.0 96-97 0.6125 0.0 0.0 0.025 0.0 98-99 0.825 0.0 0.0 0.025 0.0 100-101 0.9375 0.0 0.0 0.025 0.0 102-103 1.0125 0.0 0.0 0.025 0.0 104-105 1.175 0.0 0.0 0.025 0.0 106-107 1.3250000000000002 0.0 0.0 0.025 0.0 108-109 1.525 0.0 0.0 0.025 0.0 110-111 1.7625 0.0 0.0 0.025 0.0 112-113 2.0 0.0 0.0 0.025 0.0 114-115 2.2875 0.0 0.0 0.025 0.0 116-117 2.5374999999999996 0.0 0.0 0.025 0.0 118-119 2.875 0.0 0.0 0.025 0.0 120-121 3.0625 0.0 0.0 0.025 0.0 122-123 3.3125 0.0 0.0 0.025 0.0 124-125 3.625 0.0 0.0 0.025 0.0 126-127 3.95 0.0 0.0 0.025 0.0 128-129 4.3625 0.0 0.0 0.025 0.0 130-131 4.75 0.0 0.0 0.025 0.0 132-133 5.300000000000001 0.0 0.0 0.025 0.0 134-135 5.825 0.0 0.0 0.025 0.0 136-137 6.2375 0.0 0.0 0.025 0.0 138-139 6.7875 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTCCAG 10 0.006944766 144.2 145 TGAATGG 10 0.006944766 144.2 8 GAAGAGC 50 0.0013800713 17.304 140-144 GATCGGA 65 0.0074091386 13.445221 135-139 >>END_MODULE Read 872204 spots for SRR7169568.sra Written 872204 spots for SRR7169568.sra Read 872204 spots for SRR7169568.sra Written 872204 spots for SRR7169568.sra Read 872204 spots for SRR7169568.sra Written 872204 spots for SRR7169568.sra Read 872204 spots for SRR7169568.sra Written 872204 spots for SRR7169568.sra Read 872204 spots for SRR7169568.sra Written 872204 spots for SRR7169568.sra Read 872204 spots for SRR7169568.sra Written 872204 spots for SRR7169568.sra Read 872204 spots for SRR7169568.sra Written 872204 spots for SRR7169568.sra Read 872204 spots for SRR7169568.sra Written 872204 spots for SRR7169568.sra Read 872204 spots for SRR7169568.sra Written 872204 spots for SRR7169568.sra Read 872204 spots for SRR7169568.sra Written 872204 spots for SRR7169568.sra Read 872204 spots for SRR7169568.sra Written 872204 spots for SRR7169568.sra Read 872204 spots for SRR7169568.sra Written 872204 spots for SRR7169568.sra Read 872220 spots for SRR7169568.sra Written 872220 spots for SRR7169568.sra Read 872204 spots for SRR7169568.sra Written 872204 spots for SRR7169568.sra Read 872204 spots for SRR7169568.sra Written 872204 spots for SRR7169568.sra Read 872204 spots for SRR7169568.sra Written 872204 spots for SRR7169568.sra Read 872204 spots for SRR7169568.sra Written 872204 spots for SRR7169568.sra Read 872204 spots for SRR7169568.sra Written 872204 spots for SRR7169568.sra Read 872204 spots for SRR7169568.sra Written 872204 spots for SRR7169568.sra Read 872204 spots for SRR7169568.sra Written 872204 spots for SRR7169568.sra SRR ids: ['SRR7169568.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vu57g01o SRR7169568.sra spots: 17444096 blocks: [[1, 872204], [872205, 1744408], [1744409, 2616612], [2616613, 3488816], [3488817, 4361020], [4361021, 5233224], [5233225, 6105428], [6105429, 6977632], [6977633, 7849836], [7849837, 8722040], [8722041, 9594244], [9594245, 10466448], [10466449, 11338652], [11338653, 12210856], [12210857, 13083060], [13083061, 13955264], [13955265, 14827468], [14827469, 15699672], [15699673, 16571876], [16571877, 17444096]] SRR7169568 file size 5889531 SRR7169568 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169568 SRR7169568_1.fastq SRR7169568_2.fastq Input file: SRR7169568_1.fastq Paired file: SRR7169568_2.fastq trimmed: SRR7169568-trimmed-pair1.fastq, SRR7169568-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Apr 10 15:46:11 2025 >> started Thu Apr 10 15:46:30 2025 >> done (19.250s) 17444096 read pairs processed; of these: 16543 ( 0.09%) short read pairs filtered out after trimming by size control 51129 ( 0.29%) empty read pairs filtered out after trimming by size control 17376424 (99.61%) read pairs available; of these: 7417307 (42.69%) trimmed read pairs available after processing 9959117 (57.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 6 0.00% 20 4 0.00% 21 4 0.00% 22 7 0.00% 23 6 0.00% 24 6 0.00% 25 6 0.00% 26 4 0.00% 27 14 0.00% 28 9 0.00% 29 9 0.00% 30 8 0.00% 31 9 0.00% 32 10 0.00% 33 11 0.00% 34 17 0.00% 35 14 0.00% 36 12 0.00% 37 25 0.00% 38 14 0.00% 39 23 0.00% 40 20 0.00% 41 31 0.00% 42 23 0.00% 43 27 0.00% 44 40 0.00% 45 41 0.00% 46 49 0.00% 47 43 0.00% 48 52 0.00% 49 68 0.00% 50 77 0.00% 51 89 0.00% 52 92 0.00% 53 133 0.00% 54 113 0.00% 55 125 0.00% 56 170 0.00% 57 173 0.00% 58 193 0.00% 59 209 0.00% 60 279 0.00% 61 333 0.00% 62 333 0.00% 63 416 0.00% 64 481 0.00% 65 524 0.00% 66 594 0.00% 67 722 0.00% 68 934 0.01% 69 1374 0.01% 70 1633 0.01% 71 1347 0.01% 72 1349 0.01% 73 1421 0.01% 74 1578 0.01% 75 1789 0.01% 76 1856 0.01% 77 2077 0.01% 78 2387 0.01% 79 2525 0.01% 80 2986 0.02% 81 3377 0.02% 82 3865 0.02% 83 4355 0.03% 84 5280 0.03% 85 6294 0.04% 86 6669 0.04% 87 7102 0.04% 88 7646 0.04% 89 8247 0.05% 90 8678 0.05% 91 9285 0.05% 92 10148 0.06% 93 10710 0.06% 94 11489 0.07% 95 12443 0.07% 96 13153 0.08% 97 13900 0.08% 98 14492 0.08% 99 15373 0.09% 100 15670 0.09% 101 16612 0.10% 102 17849 0.10% 103 18807 0.11% 104 19897 0.11% 105 21016 0.12% 106 22028 0.13% 107 22645 0.13% 108 23646 0.14% 109 24371 0.14% 110 25361 0.15% 111 26465 0.15% 112 27800 0.16% 113 28879 0.17% 114 30508 0.18% 115 32122 0.18% 116 33207 0.19% 117 34161 0.20% 118 35608 0.20% 119 36297 0.21% 120 37466 0.22% 121 38812 0.22% 122 39981 0.23% 123 42009 0.24% 124 43642 0.25% 125 45952 0.26% 126 47458 0.27% 127 49268 0.28% 128 51601 0.30% 129 52426 0.30% 130 54604 0.31% 131 57215 0.33% 132 59278 0.34% 133 62283 0.36% 134 64988 0.37% 135 69173 0.40% 136 72442 0.42% 137 76045 0.44% 138 80851 0.47% 139 84908 0.49% 140 88792 0.51% 141 94868 0.55% 142 102705 0.59% 143 113621 0.65% 144 129203 0.74% 145 149098 0.86% 146 180310 1.04% 147 237246 1.37% 148 346808 2.00% 149 656412 3.78% 150 3473462 19.99% 151 9959117 57.31% 17376424 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=35 prefix-density=0.18 prefix-fanout=2.0 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.10 sequence-density-rank=13 fanout-score=287.66 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=29.6 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.62 fanout-score-rank=37 prefix-density=0.32 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=21 fanout-score=323.31 fanout-score-rank=1 prefix-density=1.03 prefix-fanout=29.4 sequence=AAGAAGAAGAAG SRR7169568 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 10 15:47:14 Started mapping on | Apr 10 15:47:14 Finished on | Apr 10 15:48:54 Mapping speed, Million of reads per hour | 625.55 Number of input reads | 17376424 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 16266634 Uniquely mapped reads % | 93.61% Average mapped length | 293.60 Number of splices: Total | 15952833 Number of splices: Annotated (sjdb) | 15693266 Number of splices: GT/AG | 15713147 Number of splices: GC/AG | 195761 Number of splices: AT/AC | 12681 Number of splices: Non-canonical | 31244 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 323407 % of reads mapped to multiple loci | 1.86% Number of reads mapped to too many loci | 383956 % of reads mapped to too many loci | 2.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.05% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 801872 801872 801872 N_multimapping 323407 323407 323407 N_noFeature 390592 16079654 494332 N_ambiguous 145940 1275 61737 UnstrandedReadsAssigned:15730102 PositiveStrandReadsAssigned:185705 NegativeStrandReadsAssigned:15710565 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169568 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169568-trimmed-pair1.fastq SRR7169568-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,376,424 reads, 15,833,803 reads pseudoaligned [quant] estimated average fragment length: 238.397 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 980 rounds 52401 SRR7169568.ke.tsv 34699 SRR7169568.se.tsv 87100 total ==> SRR7169568.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1780.6 274 9.51333 Potri.005G024800.1.v4.1 1035 797.603 34 2.63537 Potri.004G059700.1.v4.1 961 723.634 8 0.683471 Potri.007G009000.2.v4.1 1416 1178.6 0 0 Potri.003G141000.2.v4.1 2943 2705.6 344 7.86038 Potri.016G087400.1.v4.1 270 82.6456 1334.46 998.24 Potri.015G069301.1.v4.1 564 331.881 0 0 Potri.010G195200.1.v4.1 1773 1535.6 25 1.00649 Potri.012G127500.1.v4.1 977 739.616 6165 515.319 ==> SRR7169568.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 872 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 304 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169568 completed mapping pipeline successfully