Starting /dee2/code/volunteer_pipeline.sh SRR7169569 current disk space = 2810367041536 free memory = 1581353024 SRR7169569 SRAfilesize 99ec304b97db41c5df5e5673de4a4a2c SRR7169569.sra SRR7169569.sra file validated SRR7169569 is paired end SRR7169569 is conventional basespace SRR7169569 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169569_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.152 34.0 33.0 34.0 2.0 34.0 2 32.754 34.0 33.0 34.0 28.0 34.0 3 32.92925 34.0 33.0 34.0 30.0 34.0 4 33.27675 34.0 33.0 34.0 32.0 34.0 5 33.243 34.0 33.0 34.0 33.0 34.0 6 36.75325 38.0 37.0 38.0 35.0 38.0 7 37.20575 38.0 38.0 38.0 36.0 38.0 8 37.2875 38.0 38.0 38.0 37.0 38.0 9 37.45975 38.0 38.0 38.0 37.0 38.0 10-14 37.47625 38.0 38.0 38.0 37.0 38.0 15-19 37.433550000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.3981 38.0 38.0 38.0 37.0 38.0 25-29 37.337599999999995 38.0 38.0 38.0 37.0 38.0 30-34 37.271249999999995 38.0 38.0 38.0 37.0 38.0 35-39 37.2152 38.0 38.0 38.0 36.6 38.0 40-44 36.897149999999996 38.0 38.0 38.0 35.8 38.0 45-49 36.7341 38.0 38.0 38.0 34.6 38.0 50-54 36.60055 38.0 38.0 38.0 34.0 38.0 55-59 36.4538 38.0 37.8 38.0 34.0 38.0 60-64 36.3612 38.0 37.4 38.0 34.0 38.0 65-69 36.336 38.0 37.2 38.0 33.6 38.0 70-74 36.2384 38.0 37.0 38.0 33.4 38.0 75-79 36.01055 38.0 37.0 38.0 32.6 38.0 80-84 35.8309 38.0 37.0 38.0 31.8 38.0 85-89 35.664049999999996 38.0 36.6 38.0 30.6 38.0 90-94 35.42865 38.0 36.4 38.0 29.4 38.0 95-99 35.1995 38.0 36.0 38.0 29.0 38.0 100-104 34.779849999999996 38.0 35.4 38.0 26.8 38.0 105-109 34.634550000000004 38.0 35.2 38.0 26.0 38.0 110-114 34.24915 38.0 34.6 38.0 23.2 38.0 115-119 33.94945 38.0 34.0 38.0 22.2 38.0 120-124 33.30955 38.0 33.6 38.0 17.8 38.0 125-129 33.02955 37.8 33.0 38.0 15.0 38.0 130-134 32.9253 38.0 33.6 38.0 15.0 38.0 135-139 32.476150000000004 37.6 32.6 38.0 14.6 38.0 140-144 31.6179 36.0 31.0 38.0 13.8 38.0 145-149 29.96925 35.6 28.6 38.0 6.4 38.0 150-151 25.433875 33.5 13.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 3.0 10 2.0 11 0.0 12 2.0 13 1.0 14 5.0 15 7.0 16 3.0 17 6.0 18 8.0 19 13.0 20 6.0 21 10.0 22 18.0 23 22.0 24 20.0 25 23.0 26 35.0 27 37.0 28 51.0 29 56.0 30 67.0 31 94.0 32 115.0 33 173.0 34 273.0 35 487.0 36 1181.0 37 1281.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.48106904231626 13.891982182628063 9.716035634743875 34.910913140311806 2 25.324999999999996 14.2 29.775000000000002 30.7 3 20.349999999999998 16.85 24.575 38.224999999999994 4 22.75 23.35 23.674999999999997 30.225 5 22.900000000000002 27.925 24.224999999999998 24.95 6 21.15 33.525 24.25 21.075 7 16.7 29.65 36.725 16.925 8 17.8 28.749999999999996 29.599999999999998 23.849999999999998 9 15.4 27.525 34.949999999999996 22.125 10-14 19.38 30.695 27.500000000000004 22.425 15-19 18.945 29.37 27.71 23.974999999999998 20-24 19.46 30.42 26.505000000000003 23.615 25-29 19.71 30.009999999999998 26.815 23.465 30-34 19.585 29.29 26.87 24.255 35-39 19.72 29.970000000000002 26.525 23.785 40-44 19.564999999999998 30.2 27.0 23.235 45-49 19.91 29.065 27.245 23.78 50-54 19.905 29.354999999999997 26.435 24.305 55-59 19.825 29.45 26.88 23.845 60-64 19.215 28.835 27.54 24.41 65-69 19.64 29.015 27.185 24.16 70-74 19.675 29.470000000000002 27.139999999999997 23.715 75-79 20.16 28.294999999999998 27.36 24.185000000000002 80-84 20.18 28.449999999999996 27.555000000000003 23.815 85-89 20.365 28.825 27.01 23.799999999999997 90-94 20.14 28.444999999999997 26.615 24.8 95-99 20.23 29.145 26.525 24.099999999999998 100-104 20.45 28.29 26.995 24.265 105-109 19.96 28.655 27.134999999999998 24.25 110-114 20.44 28.815 27.05 23.695 115-119 20.3 28.804999999999996 26.900000000000002 23.995 120-124 20.95 28.125 26.729999999999997 24.195 125-129 20.69 28.485 26.784999999999997 24.04 130-134 20.115 28.560000000000002 27.095000000000002 24.23 135-139 20.965 28.02 26.765 24.25 140-144 21.13 28.255000000000003 26.075 24.54 145-149 21.04 28.199999999999996 26.424999999999997 24.335 150-151 20.75 28.1125 26.437500000000004 24.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.0 21 2.0 22 3.0 23 1.5 24 2.5 25 5.0 26 7.0 27 10.0 28 16.0 29 20.5 30 24.5 31 33.5 32 43.0 33 55.5 34 70.5 35 85.0 36 93.0 37 104.0 38 127.0 39 149.5 40 178.5 41 216.0 42 238.0 43 243.5 44 253.5 45 241.5 46 228.5 47 240.0 48 225.0 49 196.5 50 161.0 51 121.0 52 104.0 53 99.0 54 87.5 55 68.0 56 52.5 57 45.5 58 38.5 59 28.5 60 23.0 61 15.5 62 9.0 63 9.0 64 7.0 65 5.0 66 4.0 67 1.5 68 0.5 69 0.0 70 0.5 71 0.5 72 0.5 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 10.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67361285463218 99.25 2 0.3012804418779814 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.025106703489831784 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCAACAATCTCGTATGC 6 0.15 TruSeq Adapter, Index 2 (97% over 36bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.7125 0.0 0.0 0.0 0.0 102-103 0.85 0.0 0.0 0.0 0.0 104-105 0.9 0.0 0.0 0.0 0.0 106-107 1.0499999999999998 0.0 0.0 0.0 0.0 108-109 1.2000000000000002 0.0 0.0 0.0 0.0 110-111 1.5 0.0 0.0 0.0 0.0 112-113 1.6875 0.0 0.0 0.0 0.0 114-115 1.7999999999999998 0.0 0.0 0.0 0.0 116-117 1.9375 0.0 0.0 0.0 0.0 118-119 2.2125000000000004 0.0 0.0 0.0 0.0 120-121 2.4625 0.0 0.0 0.0 0.0 122-123 2.825 0.0 0.0 0.0 0.0 124-125 3.2249999999999996 0.0 0.0 0.0 0.0 126-127 3.625 0.0 0.0 0.0 0.0 128-129 4.0625 0.0 0.0 0.0 0.0 130-131 4.5 0.0 0.0 0.0 0.0 132-133 4.862500000000001 0.0 0.0 0.0 0.0 134-135 5.1875 0.0 0.0 0.0 0.0 136-137 5.5375 0.0 0.0 0.0 0.0 138-139 6.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAATTCA 10 0.006843168 144.91249 4 >>END_MODULE SRR7169569 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169569_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7935 33.0 33.0 34.0 32.0 34.0 2 32.793 34.0 33.0 34.0 32.0 34.0 3 32.9045 34.0 33.0 34.0 32.0 34.0 4 32.95975 34.0 33.0 34.0 32.0 34.0 5 32.98875 34.0 33.0 34.0 33.0 34.0 6 37.0965 38.0 38.0 38.0 37.0 38.0 7 36.9805 38.0 38.0 38.0 37.0 38.0 8 37.0495 38.0 38.0 38.0 37.0 38.0 9 37.04675 38.0 38.0 38.0 37.0 38.0 10-14 37.07285 38.0 38.0 38.0 37.2 38.0 15-19 37.02375 38.0 38.0 38.0 37.0 38.0 20-24 36.98545 38.0 38.0 38.0 37.0 38.0 25-29 36.882349999999995 38.0 38.0 38.0 37.0 38.0 30-34 36.762750000000004 38.0 38.0 38.0 36.2 38.0 35-39 36.81275 38.0 38.0 38.0 36.8 38.0 40-44 36.90185 38.0 38.0 38.0 37.0 38.0 45-49 36.745400000000004 38.0 38.0 38.0 36.4 38.0 50-54 36.7977 38.0 38.0 38.0 36.6 38.0 55-59 36.7112 38.0 38.0 38.0 36.0 38.0 60-64 36.64825 38.0 38.0 38.0 36.0 38.0 65-69 36.47330000000001 38.0 38.0 38.0 35.6 38.0 70-74 36.3794 38.0 38.0 38.0 34.8 38.0 75-79 36.3423 38.0 38.0 38.0 34.8 38.0 80-84 36.28325 38.0 38.0 38.0 34.6 38.0 85-89 36.20459999999999 38.0 38.0 38.0 34.2 38.0 90-94 35.95825000000001 38.0 38.0 38.0 33.8 38.0 95-99 35.916399999999996 38.0 38.0 38.0 33.8 38.0 100-104 35.77315 38.0 38.0 38.0 33.0 38.0 105-109 35.67144999999999 38.0 38.0 38.0 32.8 38.0 110-114 35.4738 38.0 38.0 38.0 32.0 38.0 115-119 35.297450000000005 38.0 37.4 38.0 30.6 38.0 120-124 35.151450000000004 38.0 37.2 38.0 30.6 38.0 125-129 34.68599999999999 38.0 36.2 38.0 27.2 38.0 130-134 34.42975 38.0 36.0 38.0 25.2 38.0 135-139 34.1068 38.0 35.2 38.0 22.8 38.0 140-144 33.869 38.0 35.0 38.0 22.8 38.0 145-149 33.1661 38.0 33.2 38.0 16.6 38.0 150-151 28.986874999999998 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 2.0 4 6.0 5 4.0 6 1.0 7 2.0 8 4.0 9 2.0 10 4.0 11 1.0 12 4.0 13 5.0 14 3.0 15 4.0 16 12.0 17 9.0 18 12.0 19 14.0 20 7.0 21 12.0 22 14.0 23 17.0 24 15.0 25 19.0 26 19.0 27 29.0 28 25.0 29 32.0 30 29.0 31 46.0 32 61.0 33 77.0 34 129.0 35 168.0 36 478.0 37 2716.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.86451289757075 23.165539694465316 14.400200350613574 25.569747057350362 2 28.8360450563204 28.185231539424283 27.033792240300375 15.944931163954942 3 21.35168961201502 30.43804755944931 28.010012515644554 20.200250312891114 4 23.35419274092616 34.4180225281602 23.329161451814766 18.89862327909887 5 25.18147684605757 34.993742177722154 23.103879849812266 16.720901126408013 6 22.347347347347345 37.08708708708709 23.14814814814815 17.417417417417415 7 22.74774774774775 21.946946946946948 35.61061061061061 19.694694694694697 8 22.8978978978979 26.926926926926924 26.176176176176174 23.998998998999 9 21.896896896896898 26.076076076076077 29.854854854854857 22.17217217217217 10-14 24.413192532906262 28.482057955057304 25.619338371452884 21.485411140583555 15-19 24.229074889867842 27.968562274729674 26.90228273928714 20.90008009611534 20-24 24.4381038193923 28.172398257996694 26.925964859588525 20.463533063022478 25-29 24.811013767209012 28.275344180225282 26.282853566958696 20.63078848560701 30-34 24.251676844528983 28.361197317048752 26.68935829412354 20.697767544298728 35-39 24.00260299344246 28.14236371827602 26.735746108024227 21.119287180257295 40-44 24.743454973219205 27.992191019672624 26.65565400210242 20.608700005005755 45-49 24.625782227784732 27.659574468085108 26.60325406758448 21.111389236545683 50-54 24.017620263302796 27.852029834309455 27.001051208890225 21.12929869349752 55-59 24.81602002503129 27.183979974968707 27.414267834793492 20.585732165206508 60-64 24.055068836045056 27.879849812265334 27.028785982478098 21.036295369211512 65-69 24.705882352941178 27.774718397997493 26.728410513141426 20.7909887359199 70-74 24.46558197747184 27.55944931163955 27.449311639549435 20.52565707133917 75-79 24.055068836045056 27.739674593241553 27.414267834793492 20.7909887359199 80-84 24.72590738423029 27.499374217772214 27.01877346683354 20.755944931163956 85-89 24.782216881946532 27.69600480624812 27.37058175628317 20.15119655552218 90-94 24.588111572938054 27.482598026941762 27.3523962141319 20.57689418598828 95-99 24.048477564102562 27.493990384615387 28.26522435897436 20.192307692307693 100-104 24.46057571964956 28.545682102628284 26.888610763454317 20.105131414267834 105-109 24.355444305381727 27.909887359198997 27.2090112640801 20.52565707133917 110-114 24.898613127722424 27.171681770390027 28.017824062484355 19.911881039403195 115-119 25.117676514772157 27.911867801702556 26.649974962443668 20.320480721081623 120-124 25.133957634333214 28.00340527818118 27.262256497571236 19.60038058991437 125-129 24.83349191246432 28.283839951925483 27.056938254294156 19.82572988131604 130-134 25.42449286250939 27.62334084648134 27.167543200601052 19.784623090408214 135-139 25.141483447688685 27.805879701507486 27.49035909250263 19.562277758301196 140-144 24.833458552466816 27.963936889556724 27.528174305033808 19.67443025294265 145-149 25.29426496368645 28.059103431004257 27.142499373904332 19.50413223140496 150-151 26.23545602402102 28.299762292005504 26.585762542224444 18.879019141749033 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 4.0 1 2.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.5 21 0.5 22 0.0 23 0.5 24 1.5 25 3.0 26 4.0 27 4.0 28 6.0 29 9.5 30 8.5 31 7.0 32 14.0 33 27.5 34 39.5 35 42.0 36 52.0 37 77.0 38 108.0 39 140.5 40 163.0 41 192.5 42 237.0 43 273.0 44 285.5 45 303.5 46 298.5 47 270.5 48 250.0 49 220.0 50 187.0 51 150.5 52 129.0 53 106.5 54 83.0 55 75.5 56 59.5 57 40.5 58 33.0 59 22.5 60 15.0 61 16.5 62 12.0 63 6.5 64 5.0 65 3.0 66 2.0 67 3.0 68 2.0 69 0.0 70 0.5 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.125 3 0.125 4 0.125 5 0.125 6 0.1 7 0.1 8 0.1 9 0.1 10-14 0.095 15-19 0.12 20-24 0.11499999999999999 25-29 0.125 30-34 0.11 35-39 0.11499999999999999 40-44 0.11499999999999999 45-49 0.125 50-54 0.11499999999999999 55-59 0.125 60-64 0.125 65-69 0.125 70-74 0.125 75-79 0.125 80-84 0.125 85-89 0.13 90-94 0.155 95-99 0.16 100-104 0.125 105-109 0.125 110-114 0.135 115-119 0.15 120-124 0.155 125-129 0.155 130-134 0.17500000000000002 135-139 0.165 140-144 0.17500000000000002 145-149 0.17500000000000002 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59788891681328 99.075 2 0.3518471977883891 0.7000000000000001 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.0 0.0 6 0.025131942699170642 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 6 0.15 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.42500000000000004 0.0 0.0 0.0 0.0 98-99 0.5375000000000001 0.0 0.0 0.0 0.0 100-101 0.6625 0.0 0.0 0.0 0.0 102-103 0.8 0.0 0.0 0.0 0.0 104-105 0.85 0.0 0.0 0.0 0.0 106-107 0.9875 0.0 0.0 0.0 0.0 108-109 1.125 0.0 0.0 0.0 0.0 110-111 1.4 0.0 0.0 0.0 0.0 112-113 1.5875 0.0 0.0 0.0 0.0 114-115 1.7000000000000002 0.0 0.0 0.0 0.0 116-117 1.8624999999999998 0.0 0.0 0.0 0.0 118-119 2.1624999999999996 0.0 0.0 0.0 0.0 120-121 2.4000000000000004 0.0 0.0 0.0 0.0 122-123 2.725 0.0 0.0 0.0 0.0 124-125 3.1500000000000004 0.0 0.0 0.0 0.0 126-127 3.4875 0.0 0.0 0.0 0.0 128-129 3.925 0.0 0.0 0.0 0.0 130-131 4.3625 0.0 0.0 0.0 0.0 132-133 4.725 0.0 0.0 0.0 0.0 134-135 5.025 0.0 0.0 0.0 0.0 136-137 5.425000000000001 0.0 0.0 0.0 0.0 138-139 6.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCAACC 10 0.006830828 145.0 7 >>END_MODULE Read 975654 spots for SRR7169569.sra Written 975654 spots for SRR7169569.sra Read 975654 spots for SRR7169569.sra Written 975654 spots for SRR7169569.sra Read 975654 spots for SRR7169569.sra Written 975654 spots for SRR7169569.sra Read 975654 spots for SRR7169569.sra Written 975654 spots for SRR7169569.sra Read 975654 spots for SRR7169569.sra Written 975654 spots for SRR7169569.sra Read 975654 spots for SRR7169569.sra Written 975654 spots for SRR7169569.sra Read 975654 spots for SRR7169569.sra Written 975654 spots for SRR7169569.sra Read 975654 spots for SRR7169569.sra Written 975654 spots for SRR7169569.sra Read 975654 spots for SRR7169569.sra Written 975654 spots for SRR7169569.sra Read 975654 spots for SRR7169569.sra Written 975654 spots for SRR7169569.sra Read 975654 spots for SRR7169569.sra Written 975654 spots for SRR7169569.sra Read 975654 spots for SRR7169569.sra Written 975654 spots for SRR7169569.sra Read 975654 spots for SRR7169569.sra Written 975654 spots for SRR7169569.sra Read 975672 spots for SRR7169569.sra Written 975672 spots for SRR7169569.sra Read 975654 spots for SRR7169569.sra Written 975654 spots for SRR7169569.sra Read 975654 spots for SRR7169569.sra Written 975654 spots for SRR7169569.sra Read 975654 spots for SRR7169569.sra Written 975654 spots for SRR7169569.sra Read 975654 spots for SRR7169569.sra Written 975654 spots for SRR7169569.sra Read 975654 spots for SRR7169569.sra Written 975654 spots for SRR7169569.sra Read 975654 spots for SRR7169569.sra Written 975654 spots for SRR7169569.sra SRR ids: ['SRR7169569.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mjkdwl_s SRR7169569.sra spots: 19513098 blocks: [[1, 975654], [975655, 1951308], [1951309, 2926962], [2926963, 3902616], [3902617, 4878270], [4878271, 5853924], [5853925, 6829578], [6829579, 7805232], [7805233, 8780886], [8780887, 9756540], [9756541, 10732194], [10732195, 11707848], [11707849, 12683502], [12683503, 13659156], [13659157, 14634810], [14634811, 15610464], [15610465, 16586118], [16586119, 17561772], [17561773, 18537426], [18537427, 19513098]] SRR7169569 file size 6590648 SRR7169569 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169569 SRR7169569_1.fastq SRR7169569_2.fastq Input file: SRR7169569_1.fastq Paired file: SRR7169569_2.fastq trimmed: SRR7169569-trimmed-pair1.fastq, SRR7169569-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Apr 11 12:21:17 2025 >> started Fri Apr 11 12:21:47 2025 >> done (30.351s) 19513098 read pairs processed; of these: 41729 ( 0.21%) short read pairs filtered out after trimming by size control 164545 ( 0.84%) empty read pairs filtered out after trimming by size control 19306824 (98.94%) read pairs available; of these: 10387230 (53.80%) trimmed read pairs available after processing 8919594 (46.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 16 0.00% 20 9 0.00% 21 9 0.00% 22 12 0.00% 23 21 0.00% 24 20 0.00% 25 11 0.00% 26 16 0.00% 27 30 0.00% 28 15 0.00% 29 26 0.00% 30 24 0.00% 31 22 0.00% 32 22 0.00% 33 30 0.00% 34 31 0.00% 35 44 0.00% 36 31 0.00% 37 43 0.00% 38 43 0.00% 39 36 0.00% 40 55 0.00% 41 63 0.00% 42 67 0.00% 43 60 0.00% 44 67 0.00% 45 95 0.00% 46 114 0.00% 47 89 0.00% 48 148 0.00% 49 124 0.00% 50 145 0.00% 51 168 0.00% 52 198 0.00% 53 257 0.00% 54 234 0.00% 55 250 0.00% 56 260 0.00% 57 267 0.00% 58 326 0.00% 59 346 0.00% 60 392 0.00% 61 398 0.00% 62 487 0.00% 63 539 0.00% 64 565 0.00% 65 708 0.00% 66 1059 0.01% 67 1991 0.01% 68 2137 0.01% 69 2269 0.01% 70 3554 0.02% 71 2965 0.02% 72 2283 0.01% 73 1880 0.01% 74 1886 0.01% 75 1971 0.01% 76 2020 0.01% 77 2163 0.01% 78 2514 0.01% 79 2720 0.01% 80 3039 0.02% 81 3536 0.02% 82 3906 0.02% 83 4495 0.02% 84 6436 0.03% 85 7310 0.04% 86 7883 0.04% 87 8448 0.04% 88 9198 0.05% 89 9747 0.05% 90 10170 0.05% 91 10559 0.05% 92 11447 0.06% 93 12377 0.06% 94 13022 0.07% 95 13870 0.07% 96 14962 0.08% 97 15746 0.08% 98 16446 0.09% 99 16692 0.09% 100 18217 0.09% 101 19251 0.10% 102 20376 0.11% 103 21195 0.11% 104 22713 0.12% 105 24297 0.13% 106 25684 0.13% 107 25892 0.13% 108 27684 0.14% 109 29059 0.15% 110 29960 0.16% 111 31167 0.16% 112 32838 0.17% 113 35144 0.18% 114 36055 0.19% 115 38815 0.20% 116 39855 0.21% 117 41689 0.22% 118 43136 0.22% 119 44278 0.23% 120 45990 0.24% 121 47257 0.24% 122 49021 0.25% 123 52012 0.27% 124 54781 0.28% 125 56944 0.29% 126 60338 0.31% 127 62513 0.32% 128 65632 0.34% 129 67904 0.35% 130 70331 0.36% 131 72996 0.38% 132 76477 0.40% 133 81387 0.42% 134 85672 0.44% 135 90950 0.47% 136 96293 0.50% 137 102410 0.53% 138 108344 0.56% 139 116020 0.60% 140 124040 0.64% 141 135171 0.70% 142 150463 0.78% 143 170868 0.89% 144 193785 1.00% 145 229581 1.19% 146 285619 1.48% 147 389524 2.02% 148 592090 3.07% 149 1162462 6.02% 150 4645409 24.06% 151 8919594 46.20% 19306824 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.85 fanout-score-rank=39 prefix-density=0.14 prefix-fanout=2.8 sequence=GTGGACTCCTTCTGGATATTGTAGTCTGCCAGGGTGCGCCCATCTTCCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=47 fanout-score=253.84 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=15.0 sequence=AAACATAAAACACCCAGATCCTAGACCACTAAAACACACCCAAATACTAGATAAGATCCAACATCAAAGACACGGCCAGACGACATGTCAATCAATGCCCTCTAAGAGAGTTGACCACAGTCCGCAATAGCAACAGGCTTGGAAGTCTTGCCGCTTCCAGATCCA criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=4.67 fanout-score-rank=26 prefix-density=0.53 prefix-fanout=3.1 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.11 sequence-density-rank=8 fanout-score=267.79 fanout-score-rank=1 prefix-density=1.12 prefix-fanout=27.2 sequence=AAGAAGAAGAAG SRR7169569 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 11 12:22:34 Started mapping on | Apr 11 12:22:35 Finished on | Apr 11 12:25:09 Mapping speed, Million of reads per hour | 451.33 Number of input reads | 19306824 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 17812764 Uniquely mapped reads % | 92.26% Average mapped length | 292.82 Number of splices: Total | 15195092 Number of splices: Annotated (sjdb) | 14899755 Number of splices: GT/AG | 14952958 Number of splices: GC/AG | 189335 Number of splices: AT/AC | 14094 Number of splices: Non-canonical | 38705 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.34 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 376225 % of reads mapped to multiple loci | 1.95% Number of reads mapped to too many loci | 37870 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.48% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1146243 1146243 1146243 N_multimapping 376225 376225 376225 N_noFeature 443901 17605176 540033 N_ambiguous 183931 1688 71244 UnstrandedReadsAssigned:17184932 PositiveStrandReadsAssigned:205900 NegativeStrandReadsAssigned:17201487 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7169569 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169569-trimmed-pair1.fastq SRR7169569-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,306,824 reads, 17,183,783 reads pseudoaligned [quant] estimated average fragment length: 232.213 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,072 rounds 52401 SRR7169569.ke.tsv 34699 SRR7169569.se.tsv 87100 total ==> SRR7169569.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1786.79 326 8.65996 Potri.005G024800.1.v4.1 1035 803.787 120 7.08617 Potri.004G059700.1.v4.1 961 729.799 3 0.195114 Potri.007G009000.2.v4.1 1416 1184.79 0 0 Potri.003G141000.2.v4.1 2943 2711.79 333 5.82854 Potri.016G087400.1.v4.1 270 79.5359 2015 1202.49 Potri.015G069301.1.v4.1 564 334.895 0 0 Potri.010G195200.1.v4.1 1773 1541.79 124 3.81741 Potri.012G127500.1.v4.1 977 745.793 17349 1104.15 ==> SRR7169569.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1469 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 548 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7169569 completed mapping pipeline successfully