Starting /dee2/code/volunteer_pipeline.sh SRR7169570 current disk space = 3056962306048 free memory = 1580024880 SRR7169570 SRAfilesize 511bf0464870f93c6e3345100851bde1 SRR7169570.sra SRR7169570.sra file validated SRR7169570 is paired end SRR7169570 is conventional basespace SRR7169570 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169570_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.01225 34.0 33.0 34.0 33.0 34.0 2 33.40725 34.0 34.0 34.0 33.0 34.0 3 33.432 34.0 34.0 34.0 33.0 34.0 4 33.3955 34.0 34.0 34.0 33.0 34.0 5 33.488 34.0 34.0 34.0 33.0 34.0 6 37.04125 38.0 37.0 38.0 36.0 38.0 7 37.29325 38.0 38.0 38.0 37.0 38.0 8 37.3525 38.0 38.0 38.0 37.0 38.0 9 37.49325 38.0 38.0 38.0 37.0 38.0 10-14 37.4661 38.0 38.0 38.0 37.0 38.0 15-19 37.4861 38.0 38.0 38.0 37.0 38.0 20-24 37.4551 38.0 38.0 38.0 37.0 38.0 25-29 37.41515 38.0 38.0 38.0 37.0 38.0 30-34 37.3976 38.0 38.0 38.0 37.0 38.0 35-39 37.3394 38.0 38.0 38.0 37.0 38.0 40-44 37.244299999999996 38.0 38.0 38.0 36.8 38.0 45-49 37.22645 38.0 38.0 38.0 36.4 38.0 50-54 37.16875 38.0 38.0 38.0 36.0 38.0 55-59 37.098200000000006 38.0 38.0 38.0 36.0 38.0 60-64 37.086850000000005 38.0 38.0 38.0 36.0 38.0 65-69 36.996399999999994 38.0 38.0 38.0 36.0 38.0 70-74 36.87515 38.0 38.0 38.0 35.4 38.0 75-79 36.79875 38.0 38.0 38.0 35.0 38.0 80-84 36.70665 38.0 38.0 38.0 35.0 38.0 85-89 36.7832 38.0 38.0 38.0 35.0 38.0 90-94 36.574 38.0 38.0 38.0 34.4 38.0 95-99 36.50015 38.0 38.0 38.0 34.0 38.0 100-104 36.24085 38.0 37.8 38.0 33.8 38.0 105-109 36.137649999999994 38.0 37.4 38.0 33.4 38.0 110-114 36.146249999999995 38.0 37.2 38.0 33.4 38.0 115-119 35.84525 38.0 37.0 38.0 31.6 38.0 120-124 35.713350000000005 38.0 36.6 38.0 31.0 38.0 125-129 35.59635000000001 38.0 36.2 38.0 31.0 38.0 130-134 35.36749999999999 38.0 36.0 38.0 30.6 38.0 135-139 35.12345 38.0 36.0 38.0 28.8 38.0 140-144 34.622749999999996 38.0 35.0 38.0 27.6 38.0 145-149 33.9255 38.0 35.0 38.0 23.0 38.0 150-151 30.945 36.5 31.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 2.0 12 1.0 13 0.0 14 0.0 15 1.0 16 1.0 17 4.0 18 4.0 19 4.0 20 4.0 21 4.0 22 7.0 23 10.0 24 12.0 25 10.0 26 14.0 27 25.0 28 16.0 29 26.0 30 50.0 31 53.0 32 78.0 33 92.0 34 157.0 35 234.0 36 616.0 37 2574.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.4407510784065 13.169246384166456 9.109363105810708 34.280639431616336 2 24.775 15.35 31.825 28.050000000000004 3 18.325 18.75 26.700000000000003 36.225 4 21.825 27.1 24.099999999999998 26.974999999999998 5 22.6 32.125 23.599999999999998 21.675 6 19.0 34.8 25.275 20.925 7 14.374999999999998 26.525 40.25 18.85 8 17.275 26.05 30.049999999999997 26.625 9 16.475 26.375 32.324999999999996 24.825 10-14 19.77 29.065 27.644999999999996 23.52 15-19 19.650000000000002 28.79 27.37 24.19 20-24 20.29 28.625 27.36 23.724999999999998 25-29 19.545 28.875 27.284999999999997 24.295 30-34 20.085 29.044999999999998 27.089999999999996 23.78 35-39 20.32 28.54 27.445000000000004 23.695 40-44 19.744999999999997 28.76 27.82 23.674999999999997 45-49 20.25 28.37 27.155 24.224999999999998 50-54 20.235 28.215 27.54 24.01 55-59 19.955000000000002 28.34 27.445000000000004 24.26 60-64 19.945 28.544999999999998 27.29 24.22 65-69 19.700985049252463 28.576428821441073 27.811390569528477 23.91119555977799 70-74 20.535 27.775 27.27 24.42 75-79 20.085 28.015 27.889999999999997 24.01 80-84 20.47 27.96 27.305 24.265 85-89 19.689999999999998 28.115000000000002 27.73 24.465 90-94 20.47 27.805000000000003 27.375 24.349999999999998 95-99 20.200000000000003 28.449999999999996 27.375 23.974999999999998 100-104 20.3 28.275 27.295 24.13 105-109 20.655 27.415 27.700000000000003 24.23 110-114 20.48 28.115000000000002 27.169999999999998 24.235 115-119 20.849999999999998 27.815 26.724999999999998 24.610000000000003 120-124 20.669999999999998 27.785 27.229999999999997 24.315 125-129 20.89 27.83 26.935 24.345 130-134 20.815 27.589999999999996 27.51 24.085 135-139 21.154999999999998 28.205000000000002 26.61 24.03 140-144 21.0 27.925 27.145000000000003 23.93 145-149 20.865000000000002 27.88 26.884999999999998 24.37 150-151 21.224999999999998 27.4125 26.900000000000002 24.462500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 3.0 25 3.5 26 3.5 27 5.0 28 7.5 29 11.0 30 21.5 31 29.0 32 31.0 33 48.0 34 54.5 35 61.5 36 81.0 37 99.0 38 118.0 39 142.0 40 177.0 41 199.0 42 217.0 43 248.0 44 274.0 45 272.0 46 279.5 47 269.0 48 234.0 49 204.5 50 171.5 51 146.5 52 128.0 53 116.0 54 84.0 55 61.0 56 49.0 57 37.5 58 30.0 59 24.0 60 17.0 61 9.0 62 7.0 63 4.0 64 4.5 65 4.0 66 2.0 67 1.0 68 1.5 69 2.5 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4749999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.005 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37075257991442 98.7 2 0.5789076264787314 1.15 3 0.05033979360684621 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.6875 0.0 0.0 0.0 0.0 104-105 0.9375 0.0 0.0 0.0 0.0 106-107 1.175 0.0 0.0 0.0 0.0 108-109 1.3125 0.0 0.0 0.0 0.0 110-111 1.675 0.0 0.0 0.0 0.0 112-113 1.8875 0.0 0.0 0.0 0.0 114-115 2.2249999999999996 0.0 0.0 0.0 0.0 116-117 2.3375 0.0 0.0 0.0 0.0 118-119 2.775 0.0 0.0 0.0 0.0 120-121 3.1125 0.0 0.0 0.0 0.0 122-123 3.425 0.0 0.0 0.0 0.0 124-125 3.8375000000000004 0.0 0.0 0.0 0.0 126-127 4.2875 0.0 0.0 0.0 0.0 128-129 4.7 0.0 0.0 0.0 0.0 130-131 5.137499999999999 0.0 0.0 0.0 0.0 132-133 5.575 0.0 0.0 0.0 0.0 134-135 6.125 0.0 0.0 0.0 0.0 136-137 6.625 0.0 0.0 0.0 0.0 138-139 7.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATATATC 10 0.006832588 144.9875 8 >>END_MODULE SRR7169570 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169570_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8445 33.0 33.0 34.0 32.0 34.0 2 32.913 33.0 33.0 34.0 32.0 34.0 3 32.96025 34.0 33.0 34.0 32.0 34.0 4 32.9455 34.0 33.0 34.0 32.0 34.0 5 32.97175 34.0 33.0 34.0 33.0 34.0 6 37.14975 38.0 38.0 38.0 37.0 38.0 7 37.13275 38.0 38.0 38.0 37.0 38.0 8 37.13375 38.0 38.0 38.0 37.0 38.0 9 37.11675 38.0 38.0 38.0 37.0 38.0 10-14 37.084 38.0 38.0 38.0 37.0 38.0 15-19 37.08355 38.0 38.0 38.0 37.0 38.0 20-24 36.9637 38.0 38.0 38.0 37.0 38.0 25-29 36.949400000000004 38.0 38.0 38.0 36.6 38.0 30-34 36.878249999999994 38.0 38.0 38.0 36.4 38.0 35-39 36.919200000000004 38.0 38.0 38.0 36.6 38.0 40-44 36.9778 38.0 38.0 38.0 37.0 38.0 45-49 36.9468 38.0 38.0 38.0 37.0 38.0 50-54 36.94905 38.0 38.0 38.0 36.6 38.0 55-59 36.935 38.0 38.0 38.0 36.4 38.0 60-64 36.820350000000005 38.0 38.0 38.0 36.0 38.0 65-69 36.77945 38.0 38.0 38.0 36.0 38.0 70-74 36.682 38.0 38.0 38.0 36.0 38.0 75-79 36.6089 38.0 38.0 38.0 35.6 38.0 80-84 36.41555 38.0 38.0 38.0 34.6 38.0 85-89 36.42495 38.0 38.0 38.0 34.8 38.0 90-94 36.40075 38.0 38.0 38.0 34.8 38.0 95-99 36.303399999999996 38.0 38.0 38.0 34.2 38.0 100-104 36.25619999999999 38.0 38.0 38.0 34.0 38.0 105-109 36.153 38.0 38.0 38.0 34.0 38.0 110-114 36.057900000000004 38.0 38.0 38.0 34.0 38.0 115-119 35.814800000000005 38.0 38.0 38.0 32.8 38.0 120-124 35.5774 38.0 37.2 38.0 31.8 38.0 125-129 35.34835 38.0 37.0 38.0 31.0 38.0 130-134 35.065000000000005 38.0 36.0 38.0 29.4 38.0 135-139 34.9303 38.0 36.0 38.0 28.2 38.0 140-144 34.447250000000004 38.0 35.2 38.0 26.8 38.0 145-149 33.9436 38.0 35.0 38.0 21.6 38.0 150-151 30.154000000000003 36.5 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 3.0 4 4.0 5 1.0 6 0.0 7 0.0 8 2.0 9 2.0 10 2.0 11 2.0 12 2.0 13 3.0 14 0.0 15 4.0 16 11.0 17 7.0 18 1.0 19 0.0 20 5.0 21 7.0 22 6.0 23 7.0 24 15.0 25 12.0 26 21.0 27 23.0 28 27.0 29 32.0 30 46.0 31 51.0 32 55.0 33 77.0 34 104.0 35 196.0 36 486.0 37 2766.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.602204408817634 24.749498997995993 12.324649298597194 24.32364729458918 2 27.730460921843687 28.256513026052104 27.70541082164329 16.30761523046092 3 20.86673346693387 29.734468937875754 29.534068136272545 19.864729458917836 4 23.021042084168336 34.4939879759519 23.597194388777556 18.887775551102205 5 23.196392785571142 35.99699398797595 22.77054108216433 18.03607214428858 6 22.369739478957914 35.22044088176352 23.547094188376754 18.862725450901806 7 21.082978190022562 22.536976685886188 36.85134118826774 19.528703935823515 8 22.712459262973177 26.046628227625973 27.074454750564055 24.166457758836803 9 23.389320631737277 26.247179744296815 27.450488844321885 22.913010779644022 10-14 23.976344409362003 28.386708765599156 25.765549040244572 21.871397784794265 15-19 23.87251954299459 27.926438163960714 26.884145119262374 21.31689717378232 20-24 24.01383389303794 28.850684176231766 25.958598566487893 21.176883364242393 25-29 23.853211009174313 28.95172206346819 26.43505289015892 20.760014037198577 30-34 23.63554352728913 27.930636996942816 27.188893900666567 21.24492557510149 35-39 23.681043129388165 28.51554663991976 26.800401203610836 21.003009027081244 40-44 24.18618648743542 28.018257511160154 26.724181170687665 21.071374830716756 45-49 23.80403169190653 27.775549092367868 26.99829505566142 21.422124160064186 50-54 24.061168212584608 28.824266733517174 26.919027325144146 20.195537728754072 55-59 24.354668938900307 27.352012430454614 27.326951030023555 20.96636760062152 60-64 24.062374649017247 28.309265944645006 27.040713999197752 20.58764540713999 65-69 24.056154424667834 27.711205815993985 27.24993732765104 20.982702431687137 70-74 24.383149448345034 27.091273821464394 27.738214643931798 20.787362086258774 75-79 23.69489995486686 27.521187503134247 28.052755629105864 20.731156912893034 80-84 23.874235282318722 27.329254839033197 27.449603851168387 21.346906027479694 85-89 24.22478675363773 27.37581535373808 27.651781234320122 20.747616658304064 90-94 23.829104402768028 27.294153043827095 27.92097081536456 20.955771738040315 95-99 24.38461924098862 27.813706321752647 27.542988920639694 20.25868551661904 100-104 24.02867599137715 27.362510653231066 28.219782423422068 20.38903093196972 105-109 24.41726402325931 27.449997493608702 27.37480575467442 20.75793272845757 110-114 24.687829095832704 28.027681660899656 27.425906423950654 19.858582819316986 115-119 24.775655487040655 28.209755853010478 26.29468090439665 20.719907755552214 120-124 25.188083057478185 27.710903801785534 26.41187681813622 20.68913632260006 125-129 25.168122051590885 28.038743350396466 26.738934056007224 20.05420054200542 130-134 25.377704161019928 28.16844852682829 26.752999046328362 19.70084826582342 135-139 25.397621795193416 27.519943806131153 27.188801364708244 19.893633033967188 140-144 25.380023077308984 28.06903125470326 26.64927507148949 19.90167059649827 145-149 25.697091273821464 27.99899699097292 26.68505516549649 19.618856569709127 150-151 26.11090249092502 27.400175240956315 27.12479659531856 19.3641256728001 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 8.0 1 4.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.5 12 0.5 13 1.0 14 1.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 0.5 23 0.0 24 0.5 25 1.0 26 1.5 27 2.0 28 2.5 29 4.0 30 5.5 31 6.5 32 12.0 33 20.0 34 28.5 35 46.0 36 62.5 37 80.5 38 113.0 39 141.5 40 178.5 41 228.5 42 259.5 43 273.5 44 284.0 45 281.5 46 291.5 47 289.5 48 252.0 49 223.0 50 182.5 51 154.5 52 141.5 53 111.0 54 82.5 55 62.0 56 44.5 57 28.0 58 19.5 59 19.0 60 14.0 61 9.0 62 6.5 63 5.0 64 6.0 65 3.5 66 1.5 67 0.5 68 0.5 69 1.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.2 3 0.2 4 0.2 5 0.2 6 0.2 7 0.27499999999999997 8 0.27499999999999997 9 0.27499999999999997 10-14 0.23500000000000001 15-19 0.22 20-24 0.245 25-29 0.265 30-34 0.23500000000000001 35-39 0.3 40-44 0.315 45-49 0.29 50-54 0.27499999999999997 55-59 0.245 60-64 0.27999999999999997 65-69 0.27499999999999997 70-74 0.3 75-79 0.295 80-84 0.29 85-89 0.35000000000000003 90-94 0.29 95-99 0.265 100-104 0.265 105-109 0.255 110-114 0.295 115-119 0.265 120-124 0.31 125-129 0.37 130-134 0.385 135-139 0.345 140-144 0.335 145-149 0.3 150-151 0.13749999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39485627836612 98.55000000000001 2 0.5042864346949066 1.0 3 0.05042864346949068 0.15 4 0.02521432173474534 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.02521432173474534 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 8 0.2 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.38749999999999996 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.575 0.0 0.0 0.0 0.0 102-103 0.6875 0.0 0.0 0.0 0.0 104-105 0.9375 0.0 0.0 0.0 0.0 106-107 1.2 0.0 0.0 0.0 0.0 108-109 1.3375 0.0 0.0 0.0 0.0 110-111 1.7 0.0 0.0 0.0 0.0 112-113 1.9 0.0 0.0 0.0 0.0 114-115 2.2249999999999996 0.0 0.0 0.0 0.0 116-117 2.3125 0.0 0.0 0.0 0.0 118-119 2.7125 0.0 0.0 0.0 0.0 120-121 3.0125 0.0 0.0 0.0 0.0 122-123 3.325 0.0 0.0 0.0 0.0 124-125 3.7375 0.0 0.0 0.0 0.0 126-127 4.1625 0.0 0.0 0.0 0.0 128-129 4.5875 0.0 0.0 0.0 0.0 130-131 5.050000000000001 0.0 0.0 0.0 0.0 132-133 5.525 0.0 0.0 0.0 0.0 134-135 6.0625 0.0 0.0 0.0 0.0 136-137 6.5875 0.0 0.0 0.0 0.0 138-139 7.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1152031 spots for SRR7169570.sra Written 1152031 spots for SRR7169570.sra Read 1152031 spots for SRR7169570.sra Written 1152031 spots for SRR7169570.sra Read 1152031 spots for SRR7169570.sra Written 1152031 spots for SRR7169570.sra Read 1152031 spots for SRR7169570.sra Written 1152031 spots for SRR7169570.sra Read 1152031 spots for SRR7169570.sra Written 1152031 spots for SRR7169570.sra Read 1152031 spots for SRR7169570.sra Written 1152031 spots for SRR7169570.sra Read 1152046 spots for SRR7169570.sra Written 1152046 spots for SRR7169570.sra Read 1152031 spots for SRR7169570.sra Written 1152031 spots for SRR7169570.sra Read 1152031 spots for SRR7169570.sra Written 1152031 spots for SRR7169570.sra Read 1152031 spots for SRR7169570.sra Written 1152031 spots for SRR7169570.sra Read 1152031 spots for SRR7169570.sra Written 1152031 spots for SRR7169570.sra Read 1152031 spots for SRR7169570.sra Written 1152031 spots for SRR7169570.sra Read 1152031 spots for SRR7169570.sra Written 1152031 spots for SRR7169570.sra Read 1152031 spots for SRR7169570.sra Written 1152031 spots for SRR7169570.sra Read 1152031 spots for SRR7169570.sra Written 1152031 spots for SRR7169570.sra Read 1152031 spots for SRR7169570.sra Written 1152031 spots for SRR7169570.sra Read 1152031 spots for SRR7169570.sra Written 1152031 spots for SRR7169570.sra Read 1152031 spots for SRR7169570.sra Written 1152031 spots for SRR7169570.sra Read 1152031 spots for SRR7169570.sra Written 1152031 spots for SRR7169570.sra Read 1152031 spots for SRR7169570.sra Written 1152031 spots for SRR7169570.sra SRR ids: ['SRR7169570.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_852s0tyg SRR7169570.sra spots: 23040635 blocks: [[1, 1152031], [1152032, 2304062], [2304063, 3456093], [3456094, 4608124], [4608125, 5760155], [5760156, 6912186], [6912187, 8064217], [8064218, 9216248], [9216249, 10368279], [10368280, 11520310], [11520311, 12672341], [12672342, 13824372], [13824373, 14976403], [14976404, 16128434], [16128435, 17280465], [17280466, 18432496], [18432497, 19584527], [19584528, 20736558], [20736559, 21888589], [21888590, 23040635]] SRR7169570 file size 7786014 SRR7169570 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169570 SRR7169570_1.fastq SRR7169570_2.fastq Input file: SRR7169570_1.fastq Paired file: SRR7169570_2.fastq trimmed: SRR7169570-trimmed-pair1.fastq, SRR7169570-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 04:10:24 2025 >> started Tue Feb 11 04:18:24 2025 >> done (480.928s) 23040635 read pairs processed; of these: 38637 ( 0.17%) short read pairs filtered out after trimming by size control 82917 ( 0.36%) empty read pairs filtered out after trimming by size control 22919081 (99.47%) read pairs available; of these: 11633487 (50.76%) trimmed read pairs available after processing 11285594 (49.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 11 0.00% 20 14 0.00% 21 12 0.00% 22 14 0.00% 23 13 0.00% 24 10 0.00% 25 15 0.00% 26 17 0.00% 27 20 0.00% 28 26 0.00% 29 20 0.00% 30 29 0.00% 31 14 0.00% 32 21 0.00% 33 26 0.00% 34 29 0.00% 35 33 0.00% 36 30 0.00% 37 24 0.00% 38 29 0.00% 39 34 0.00% 40 33 0.00% 41 41 0.00% 42 62 0.00% 43 50 0.00% 44 54 0.00% 45 67 0.00% 46 65 0.00% 47 91 0.00% 48 90 0.00% 49 131 0.00% 50 122 0.00% 51 119 0.00% 52 161 0.00% 53 162 0.00% 54 195 0.00% 55 195 0.00% 56 200 0.00% 57 229 0.00% 58 267 0.00% 59 300 0.00% 60 366 0.00% 61 372 0.00% 62 466 0.00% 63 461 0.00% 64 580 0.00% 65 659 0.00% 66 707 0.00% 67 862 0.00% 68 1183 0.01% 69 2516 0.01% 70 3344 0.01% 71 1945 0.01% 72 1723 0.01% 73 1720 0.01% 74 1930 0.01% 75 2008 0.01% 76 2218 0.01% 77 2576 0.01% 78 2762 0.01% 79 3174 0.01% 80 3497 0.02% 81 4091 0.02% 82 4659 0.02% 83 5488 0.02% 84 7659 0.03% 85 8660 0.04% 86 9140 0.04% 87 9772 0.04% 88 10234 0.04% 89 10932 0.05% 90 11540 0.05% 91 12371 0.05% 92 13589 0.06% 93 14360 0.06% 94 15652 0.07% 95 16806 0.07% 96 17672 0.08% 97 18304 0.08% 98 19118 0.08% 99 20124 0.09% 100 21384 0.09% 101 22773 0.10% 102 24458 0.11% 103 26092 0.11% 104 27883 0.12% 105 29758 0.13% 106 30923 0.13% 107 31769 0.14% 108 32792 0.14% 109 34577 0.15% 110 36025 0.16% 111 37659 0.16% 112 39865 0.17% 113 42285 0.18% 114 44806 0.20% 115 46953 0.20% 116 48031 0.21% 117 49845 0.22% 118 51284 0.22% 119 52337 0.23% 120 54091 0.24% 121 56209 0.25% 122 58346 0.25% 123 62041 0.27% 124 65820 0.29% 125 68755 0.30% 126 71476 0.31% 127 74276 0.32% 128 76546 0.33% 129 79830 0.35% 130 83360 0.36% 131 86021 0.38% 132 90704 0.40% 133 96066 0.42% 134 100223 0.44% 135 107450 0.47% 136 112723 0.49% 137 119410 0.52% 138 125501 0.55% 139 133872 0.58% 140 141280 0.62% 141 153535 0.67% 142 168842 0.74% 143 187993 0.82% 144 217209 0.95% 145 254888 1.11% 146 313579 1.37% 147 417870 1.82% 148 638761 2.79% 149 1177425 5.14% 150 5239563 22.86% 151 11285594 49.24% 22919081 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=40 prefix-density=0.26 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=102.75 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=9.4 sequence=ATATTCATCATAACTCAATTACATTATTCTCACCCAGAACATCTCTTCCAGCAATAGATACAAACCATGGCAATTAACTAGAGCAGAACATCATTTCACAAGGTTTATAAGGAAAGAGACCTCCTTGACTTGGACAAACACTCGTCTATAAGAAACACCCAAATTTCCAACTATTCGGCTGTTTATTTCATTAATAACTGGAGAGCAGGAGATGCCAGTGCCTCAGACAAACTGATCAAGGTACTCTTCCACGGTGGTATATTTGACATCTGGATATAGCTCAGAGGCCTCAAGCCCCCATGATGGGTCAATCTCAAAGTTGGTCATGTCACCATTAACGAGGGCTGAGTGGTTGATTGACAGAACAATATTAATCGGAATCGGAGACTCTTGGATGTCCTTCAGAAGTTTCTCTTCAGGAACAAAGGTTTTTTCGAGGGTTTTGCCAATCTTTTTCTCCCATAGATCAATAAGCTCATTGAATGAGTAGGTGTTTTTAGGAGGCTTGATT criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=43 prefix-density=0.26 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.13 sequence-density-rank=13 fanout-score=50.77 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=13.0 sequence=TGTTGGTGGTGG SRR7169570 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 05:26:51 Started mapping on | Feb 11 05:27:06 Finished on | Feb 11 06:41:12 Mapping speed, Million of reads per hour | 18.56 Number of input reads | 22919081 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 21621569 Uniquely mapped reads % | 94.34% Average mapped length | 292.79 Number of splices: Total | 19955028 Number of splices: Annotated (sjdb) | 19619652 Number of splices: GT/AG | 19672758 Number of splices: GC/AG | 224674 Number of splices: AT/AC | 17730 Number of splices: Non-canonical | 39866 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.44 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 410070 % of reads mapped to multiple loci | 1.79% Number of reads mapped to too many loci | 26575 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.72% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 921506 921506 921506 N_multimapping 410070 410070 410070 N_noFeature 400721 21356192 508912 N_ambiguous 237078 1586 78690 UnstrandedReadsAssigned:20983770 PositiveStrandReadsAssigned:263791 NegativeStrandReadsAssigned:21033967 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169570 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169570-trimmed-pair1.fastq SRR7169570-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,919,081 reads, 20,944,471 reads pseudoaligned [quant] estimated average fragment length: 231.336 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,249 rounds 52401 SRR7169570.ke.tsv 34699 SRR7169570.se.tsv 87100 total ==> SRR7169570.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1787.66 360 8.57736 Potri.005G024800.1.v4.1 1035 804.664 30 1.58797 Potri.004G059700.1.v4.1 961 730.713 10 0.582895 Potri.007G009000.2.v4.1 1416 1185.66 0 0 Potri.003G141000.2.v4.1 2943 2712.66 382 5.99797 Potri.016G087400.1.v4.1 270 82.814 2657.59 1366.85 Potri.015G069301.1.v4.1 564 337.18 0 0 Potri.010G195200.1.v4.1 1773 1542.66 25 0.690249 Potri.012G127500.1.v4.1 977 746.692 7569 431.751 ==> SRR7169570.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1695 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 384 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169570 completed mapping pipeline successfully