Starting /dee2/code/volunteer_pipeline.sh SRR7169571 current disk space = 3057013747712 free memory = 1066594456 SRR7169571 SRAfilesize 119b1d91e1945261459a5b3d859a33cf SRR7169571.sra SRR7169571.sra file validated SRR7169571 is paired end SRR7169571 is conventional basespace SRR7169571 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169571_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.50025 34.0 33.0 34.0 32.0 34.0 2 33.2065 34.0 33.0 34.0 31.0 34.0 3 33.28 34.0 34.0 34.0 33.0 34.0 4 33.44125 34.0 34.0 34.0 33.0 34.0 5 33.415 34.0 33.0 34.0 33.0 34.0 6 36.92225 38.0 37.0 38.0 35.0 38.0 7 37.3655 38.0 38.0 38.0 37.0 38.0 8 37.4695 38.0 38.0 38.0 37.0 38.0 9 37.48025 38.0 38.0 38.0 38.0 38.0 10-14 37.48055 38.0 38.0 38.0 38.0 38.0 15-19 37.451800000000006 38.0 38.0 38.0 37.4 38.0 20-24 37.366749999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.357949999999995 38.0 38.0 38.0 37.0 38.0 30-34 37.346149999999994 38.0 38.0 38.0 37.0 38.0 35-39 37.2636 38.0 38.0 38.0 36.8 38.0 40-44 37.01325 38.0 38.0 38.0 36.0 38.0 45-49 36.8809 38.0 38.0 38.0 35.4 38.0 50-54 36.8425 38.0 38.0 38.0 35.0 38.0 55-59 36.7769 38.0 38.0 38.0 35.0 38.0 60-64 36.689800000000005 38.0 38.0 38.0 34.6 38.0 65-69 36.5931 38.0 38.0 38.0 34.2 38.0 70-74 36.556149999999995 38.0 38.0 38.0 34.2 38.0 75-79 36.42245 38.0 38.0 38.0 34.0 38.0 80-84 36.30255000000001 38.0 37.8 38.0 33.8 38.0 85-89 36.2094 38.0 37.2 38.0 33.4 38.0 90-94 35.95985 38.0 37.0 38.0 33.0 38.0 95-99 35.93085 38.0 37.0 38.0 32.8 38.0 100-104 35.49885 38.0 36.8 38.0 30.2 38.0 105-109 35.28404999999999 38.0 36.2 38.0 29.4 38.0 110-114 34.923249999999996 38.0 35.8 38.0 28.0 38.0 115-119 34.78340000000001 38.0 36.0 38.0 27.2 38.0 120-124 34.71395 38.0 35.8 38.0 27.4 38.0 125-129 34.18294999999999 38.0 35.0 38.0 23.6 38.0 130-134 34.08135 38.0 35.0 38.0 23.2 38.0 135-139 33.373900000000006 38.0 34.0 38.0 17.4 38.0 140-144 32.97885 38.0 34.0 38.0 14.6 38.0 145-149 32.102250000000005 38.0 33.0 38.0 11.4 38.0 150-151 28.433625 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 2.0 14 1.0 15 6.0 16 8.0 17 7.0 18 9.0 19 7.0 20 8.0 21 16.0 22 11.0 23 13.0 24 20.0 25 16.0 26 30.0 27 26.0 28 39.0 29 46.0 30 57.0 31 67.0 32 88.0 33 115.0 34 186.0 35 319.0 36 842.0 37 2058.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.463320463320464 12.483912483912484 8.931788931788933 38.12097812097812 2 25.0 14.325 33.175 27.500000000000004 3 19.575 16.8 25.374999999999996 38.25 4 23.200000000000003 25.025 24.525 27.250000000000004 5 24.075 29.375 24.25 22.3 6 21.875 34.150000000000006 23.549999999999997 20.424999999999997 7 14.625 27.650000000000002 39.725 18.0 8 17.75 26.775 30.7 24.775 9 17.9 25.324999999999996 33.575 23.200000000000003 10-14 20.325 29.775000000000002 27.224999999999998 22.675 15-19 20.015 28.634999999999998 27.51 23.84 20-24 20.175 28.999999999999996 27.515 23.31 25-29 20.01 29.099999999999998 27.125 23.765 30-34 19.735 28.720000000000002 27.744999999999997 23.799999999999997 35-39 20.0 28.915000000000003 27.13 23.955000000000002 40-44 20.150000000000002 29.145 27.41 23.294999999999998 45-49 20.015 28.625 27.36 24.0 50-54 20.4 28.360000000000003 26.919999999999998 24.32 55-59 20.525 28.285 27.655 23.535 60-64 20.355 28.64 27.384999999999998 23.62 65-69 20.325 28.044999999999998 27.16 24.47 70-74 20.555 27.915 27.775 23.755000000000003 75-79 20.39 27.98 27.24 24.39 80-84 20.205000000000002 28.74 27.055 24.0 85-89 20.445 27.805000000000003 28.125 23.625 90-94 20.535 28.57 27.195000000000004 23.7 95-99 20.22 28.044999999999998 27.24 24.495 100-104 20.89178356713427 28.101202404809616 27.500000000000004 23.507014028056112 105-109 20.810000000000002 27.700000000000003 27.85 23.64 110-114 20.45545746388443 28.06480738362761 27.808988764044944 23.670746388443018 115-119 20.559811727004156 28.626508437233987 27.630063592208703 23.18361624355315 120-124 20.634920634920633 28.245956637123832 27.55495468429222 23.56416804366331 125-129 20.885885885885884 28.013013013013012 27.32732732732733 23.773773773773772 130-134 20.905 28.215 27.779999999999998 23.1 135-139 20.415 28.48 27.105 24.0 140-144 20.810000000000002 28.665000000000003 26.69 23.835 145-149 21.05 28.1 27.12 23.73 150-151 20.5875 28.512500000000003 26.5375 24.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 1.0 26 4.0 27 5.5 28 7.5 29 10.5 30 14.5 31 20.0 32 28.5 33 39.5 34 50.5 35 65.0 36 88.0 37 107.0 38 124.5 39 155.0 40 178.5 41 194.5 42 217.5 43 261.0 44 287.0 45 267.0 46 260.5 47 268.0 48 256.5 49 205.5 50 170.0 51 157.5 52 127.5 53 101.5 54 86.0 55 69.0 56 40.5 57 29.0 58 26.0 59 23.5 60 18.0 61 8.5 62 5.5 63 5.5 64 4.5 65 2.5 66 1.0 67 1.0 68 1.0 69 0.5 70 1.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.875 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.2 105-109 0.0 110-114 0.32 115-119 0.145 120-124 0.145 125-129 0.1 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.6125 0.0 0.0 0.0 0.0 108-109 0.775 0.0 0.0 0.0 0.0 110-111 0.8999999999999999 0.0 0.0 0.0 0.0 112-113 1.025 0.0 0.0 0.0 0.0 114-115 1.1124999999999998 0.0 0.0 0.0 0.0 116-117 1.275 0.0 0.0 0.0 0.0 118-119 1.5375 0.0 0.0 0.0 0.0 120-121 1.75 0.0 0.0 0.0 0.0 122-123 1.9749999999999999 0.0 0.0 0.0 0.0 124-125 2.2125 0.0 0.0 0.0 0.0 126-127 2.5125 0.0 0.0 0.0 0.0 128-129 2.7625 0.0 0.0 0.0 0.0 130-131 2.9125 0.0 0.0 0.0 0.0 132-133 3.2249999999999996 0.0 0.0 0.0 0.0 134-135 3.475 0.0 0.0 0.0 0.0 136-137 3.75 0.0 0.0 0.0 0.0 138-139 3.9875000000000003 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTCAT 10 0.006832588 144.9875 145 >>END_MODULE SRR7169571 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169571_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.45075 33.0 33.0 34.0 32.0 34.0 2 32.79525 33.0 33.0 34.0 32.0 34.0 3 32.77075 34.0 33.0 34.0 32.0 34.0 4 32.67125 34.0 33.0 34.0 32.0 34.0 5 32.6945 34.0 33.0 34.0 32.0 34.0 6 36.8835 38.0 38.0 38.0 36.0 38.0 7 36.908 38.0 38.0 38.0 36.0 38.0 8 37.00875 38.0 38.0 38.0 36.0 38.0 9 36.87775 38.0 38.0 38.0 36.0 38.0 10-14 36.9001 38.0 38.0 38.0 36.0 38.0 15-19 36.91775 38.0 38.0 38.0 36.0 38.0 20-24 36.8578 38.0 38.0 38.0 36.0 38.0 25-29 36.87075 38.0 38.0 38.0 36.0 38.0 30-34 36.82365 38.0 38.0 38.0 36.0 38.0 35-39 36.78185 38.0 38.0 38.0 36.0 38.0 40-44 36.715250000000005 38.0 38.0 38.0 35.8 38.0 45-49 36.75245 38.0 38.0 38.0 36.0 38.0 50-54 36.5113 38.0 38.0 38.0 34.8 38.0 55-59 36.25665 38.0 38.0 38.0 34.6 38.0 60-64 36.035199999999996 38.0 38.0 38.0 34.0 38.0 65-69 35.812 38.0 38.0 38.0 33.6 38.0 70-74 35.673649999999995 38.0 38.0 38.0 33.2 38.0 75-79 35.5976 38.0 38.0 38.0 32.6 38.0 80-84 35.704899999999995 38.0 38.0 38.0 33.0 38.0 85-89 35.7351 38.0 38.0 38.0 32.6 38.0 90-94 35.80305 38.0 38.0 38.0 33.0 38.0 95-99 35.568200000000004 38.0 38.0 38.0 31.6 38.0 100-104 35.3953 38.0 37.4 38.0 29.8 38.0 105-109 35.3731 38.0 37.0 38.0 30.2 38.0 110-114 35.2466 38.0 37.0 38.0 29.0 38.0 115-119 35.144850000000005 38.0 37.0 38.0 28.6 38.0 120-124 34.9584 38.0 36.8 38.0 28.0 38.0 125-129 34.724250000000005 38.0 36.0 38.0 27.6 38.0 130-134 34.1843 38.0 35.6 38.0 23.0 38.0 135-139 33.62365 38.0 35.0 38.0 17.4 38.0 140-144 33.1804 38.0 34.8 38.0 14.4 38.0 145-149 32.21405 38.0 34.0 38.0 6.6 38.0 150-151 28.46275 36.0 18.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 3.0 4 3.0 5 0.0 6 1.0 7 1.0 8 2.0 9 3.0 10 2.0 11 4.0 12 10.0 13 23.0 14 13.0 15 4.0 16 6.0 17 7.0 18 7.0 19 8.0 20 7.0 21 13.0 22 12.0 23 17.0 24 19.0 25 35.0 26 40.0 27 40.0 28 48.0 29 51.0 30 52.0 31 73.0 32 75.0 33 104.0 34 132.0 35 208.0 36 466.0 37 2506.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.51800554016621 24.074540418030725 13.246033744648702 29.16142029715437 2 29.875 26.200000000000003 28.025 15.9 3 20.150000000000002 28.7 30.975 20.175 4 22.875 34.925 23.775 18.425 5 23.825 35.099999999999994 22.325 18.75 6 20.349999999999998 38.1 22.75 18.8 7 19.025 23.724999999999998 37.75 19.5 8 21.975 26.174999999999997 28.175 23.674999999999997 9 21.775 26.875 28.499999999999996 22.85 10-14 22.705000000000002 29.310000000000002 26.5 21.485000000000003 15-19 22.97 28.095 27.860000000000003 21.075 20-24 22.875 28.115000000000002 27.425 21.584999999999997 25-29 23.41 28.000000000000004 27.52 21.07 30-34 22.66 27.860000000000003 28.65 20.830000000000002 35-39 22.695 27.935 27.965 21.404999999999998 40-44 22.835 28.48 27.755000000000003 20.93 45-49 22.615 27.925 28.025 21.435000000000002 50-54 23.161912414624346 28.50040176777822 28.12876657292085 20.208919244676576 55-59 24.011127971674252 27.486090035407184 28.042488619119876 20.460293373798685 60-64 23.087104821055846 27.62816270427124 28.121977294710582 21.16275517996233 65-69 23.202865182911232 27.71041187004349 28.089025326170376 20.997697620874902 70-74 23.165231652316525 27.51640016400164 28.392783927839275 20.92558425584256 75-79 22.729836435420193 27.32912885197149 28.385376608726865 21.555658103881452 80-84 23.597738040654136 28.126751235416986 27.897498599011666 20.378012124917213 85-89 23.45879134795603 27.962109315637505 27.729091738007195 20.85000759839927 90-94 24.0711722185715 27.786483344285497 27.67022190769853 20.472122529444473 95-99 23.742170135380885 27.99050313194585 27.788442109517074 20.478884623156194 100-104 24.186797115336123 27.65646275656866 27.7018508245499 20.45488930354531 105-109 23.815285339786247 27.80298447267594 27.515628150836864 20.866102036700948 110-114 24.129591374011188 28.251121076233183 27.288759006398948 20.330528543356678 115-119 23.907131345688963 27.805197421434325 27.538275584206286 20.749395648670426 120-124 23.842860740367666 27.962729790984636 27.6555023923445 20.538907076303197 125-129 23.959856775429923 27.85818750315195 27.81784255383529 20.364113167582833 130-134 24.182775022770976 28.180346118813887 26.682522011942112 20.95435684647303 135-139 24.55648450244698 27.605016313213703 27.48266721044046 20.35583197389886 140-144 24.589996423644816 28.048842793644308 27.027027027027028 20.33413375568385 145-149 24.538556193601313 28.25061525840853 26.8714109926169 20.339417555373256 150-151 24.7166409067491 27.93663060278207 27.266872746007216 20.079855744461618 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 1.5 18 2.0 19 1.5 20 2.0 21 3.5 22 6.5 23 7.5 24 6.5 25 8.0 26 9.5 27 9.0 28 7.5 29 10.0 30 13.5 31 18.5 32 22.5 33 29.5 34 51.5 35 58.0 36 71.5 37 106.5 38 139.0 39 177.5 40 188.5 41 213.5 42 271.5 43 299.5 44 285.5 45 274.0 46 276.0 47 265.5 48 248.0 49 214.0 50 168.5 51 131.5 52 105.0 53 78.5 54 58.0 55 40.0 56 22.5 57 18.0 58 18.5 59 14.5 60 9.0 61 6.0 62 7.5 63 7.0 64 3.0 65 2.5 66 4.0 67 3.0 68 1.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7250000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.44 55-59 1.15 60-64 1.7850000000000001 65-69 2.275 70-74 2.44 75-79 2.485 80-84 1.855 85-89 1.295 90-94 1.085 95-99 1.02 100-104 0.855 105-109 0.8200000000000001 110-114 0.765 115-119 0.72 120-124 0.7250000000000001 125-129 0.855 130-134 1.1900000000000002 135-139 1.92 140-144 2.1350000000000002 145-149 2.48 150-151 2.9499999999999997 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.3875 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.5874999999999999 0.0 0.0 0.0 0.0 108-109 0.75 0.0 0.0 0.0 0.0 110-111 0.875 0.0 0.0 0.0 0.0 112-113 1.0 0.0 0.0 0.0 0.0 114-115 1.0875 0.0 0.0 0.0 0.0 116-117 1.225 0.0 0.0 0.0 0.0 118-119 1.4625 0.0 0.0 0.0 0.0 120-121 1.7 0.0 0.0 0.0 0.0 122-123 1.9 0.0 0.0 0.0 0.0 124-125 2.1375 0.0 0.0 0.0 0.0 126-127 2.4375 0.0 0.0 0.0 0.0 128-129 2.675 0.0 0.0 0.0 0.0 130-131 2.8375 0.0 0.0 0.0 0.0 132-133 3.1500000000000004 0.0 0.0 0.0 0.0 134-135 3.4124999999999996 0.0 0.0 0.0 0.0 136-137 3.6375 0.0 0.0 0.0 0.0 138-139 3.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCACCAG 10 0.00664379 146.32912 145 >>END_MODULE Read 957250 spots for SRR7169571.sra Written 957250 spots for SRR7169571.sra Read 957250 spots for SRR7169571.sra Written 957250 spots for SRR7169571.sra Read 957264 spots for SRR7169571.sra Written 957264 spots for SRR7169571.sra Read 957250 spots for SRR7169571.sra Written 957250 spots for SRR7169571.sra Read 957250 spots for SRR7169571.sra Written 957250 spots for SRR7169571.sra Read 957250 spots for SRR7169571.sra Written 957250 spots for SRR7169571.sra Read 957250 spots for SRR7169571.sra Written 957250 spots for SRR7169571.sra Read 957250 spots for SRR7169571.sra Written 957250 spots for SRR7169571.sra Read 957250 spots for SRR7169571.sra Written 957250 spots for SRR7169571.sra Read 957250 spots for SRR7169571.sra Written 957250 spots for SRR7169571.sra Read 957250 spots for SRR7169571.sra Written 957250 spots for SRR7169571.sra Read 957250 spots for SRR7169571.sra Written 957250 spots for SRR7169571.sra Read 957250 spots for SRR7169571.sra Written 957250 spots for SRR7169571.sra Read 957250 spots for SRR7169571.sra Written 957250 spots for SRR7169571.sra Read 957250 spots for SRR7169571.sra Written 957250 spots for SRR7169571.sra Read 957250 spots for SRR7169571.sra Written 957250 spots for SRR7169571.sra Read 957250 spots for SRR7169571.sra Written 957250 spots for SRR7169571.sra Read 957250 spots for SRR7169571.sra Written 957250 spots for SRR7169571.sra Read 957250 spots for SRR7169571.sra Written 957250 spots for SRR7169571.sra Read 957250 spots for SRR7169571.sra Written 957250 spots for SRR7169571.sra SRR ids: ['SRR7169571.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kthxtbg8 SRR7169571.sra spots: 19145014 blocks: [[1, 957250], [957251, 1914500], [1914501, 2871750], [2871751, 3829000], [3829001, 4786250], [4786251, 5743500], [5743501, 6700750], [6700751, 7658000], [7658001, 8615250], [8615251, 9572500], [9572501, 10529750], [10529751, 11487000], [11487001, 12444250], [12444251, 13401500], [13401501, 14358750], [14358751, 15316000], [15316001, 16273250], [16273251, 17230500], [17230501, 18187750], [18187751, 19145014]] SRR7169571 file size 6465916 SRR7169571 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169571 SRR7169571_1.fastq SRR7169571_2.fastq Input file: SRR7169571_1.fastq Paired file: SRR7169571_2.fastq trimmed: SRR7169571-trimmed-pair1.fastq, SRR7169571-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 03:01:23 2025 >> started Tue Feb 11 03:06:26 2025 >> done (302.562s) 19145014 read pairs processed; of these: 18048 ( 0.09%) short read pairs filtered out after trimming by size control 20724 ( 0.11%) empty read pairs filtered out after trimming by size control 19106242 (99.80%) read pairs available; of these: 8821620 (46.17%) trimmed read pairs available after processing 10284622 (53.83%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 2 0.00% 21 7 0.00% 22 5 0.00% 23 9 0.00% 24 2 0.00% 25 7 0.00% 26 9 0.00% 27 13 0.00% 28 15 0.00% 29 13 0.00% 30 11 0.00% 31 19 0.00% 32 18 0.00% 33 13 0.00% 34 18 0.00% 35 25 0.00% 36 26 0.00% 37 27 0.00% 38 21 0.00% 39 16 0.00% 40 19 0.00% 41 31 0.00% 42 37 0.00% 43 40 0.00% 44 43 0.00% 45 51 0.00% 46 54 0.00% 47 63 0.00% 48 76 0.00% 49 83 0.00% 50 97 0.00% 51 104 0.00% 52 107 0.00% 53 124 0.00% 54 143 0.00% 55 134 0.00% 56 162 0.00% 57 202 0.00% 58 220 0.00% 59 256 0.00% 60 241 0.00% 61 365 0.00% 62 356 0.00% 63 434 0.00% 64 436 0.00% 65 550 0.00% 66 617 0.00% 67 680 0.00% 68 797 0.00% 69 1038 0.01% 70 1207 0.01% 71 1311 0.01% 72 1385 0.01% 73 1763 0.01% 74 2223 0.01% 75 3125 0.02% 76 2500 0.01% 77 1446 0.01% 78 1943 0.01% 79 3212 0.02% 80 6042 0.03% 81 2190 0.01% 82 2672 0.01% 83 2962 0.02% 84 4052 0.02% 85 4786 0.03% 86 5646 0.03% 87 5858 0.03% 88 5681 0.03% 89 6086 0.03% 90 6590 0.03% 91 7192 0.04% 92 7641 0.04% 93 8334 0.04% 94 9226 0.05% 95 10020 0.05% 96 10837 0.06% 97 12441 0.07% 98 14999 0.08% 99 20789 0.11% 100 25903 0.14% 101 17726 0.09% 102 13393 0.07% 103 13864 0.07% 104 14648 0.08% 105 15454 0.08% 106 16449 0.09% 107 17145 0.09% 108 18080 0.09% 109 18931 0.10% 110 19596 0.10% 111 20796 0.11% 112 21806 0.11% 113 23239 0.12% 114 24450 0.13% 115 25678 0.13% 116 26961 0.14% 117 28282 0.15% 118 29582 0.15% 119 30450 0.16% 120 32118 0.17% 121 33612 0.18% 122 35203 0.18% 123 36824 0.19% 124 39784 0.21% 125 41392 0.22% 126 43571 0.23% 127 45788 0.24% 128 47875 0.25% 129 50252 0.26% 130 53184 0.28% 131 55909 0.29% 132 58704 0.31% 133 63495 0.33% 134 66366 0.35% 135 71724 0.38% 136 76328 0.40% 137 81844 0.43% 138 88861 0.47% 139 96510 0.51% 140 105746 0.55% 141 114213 0.60% 142 126241 0.66% 143 139076 0.73% 144 162580 0.85% 145 191709 1.00% 146 240609 1.26% 147 324468 1.70% 148 485900 2.54% 149 936803 4.90% 150 4270495 22.35% 151 10284622 53.83% 19106242 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.62 fanout-score-rank=35 prefix-density=0.22 prefix-fanout=2.4 sequence=CTGGCCATTCAATGTGACATCCTCTTGAGTGGCTTTCAAAAGCCTGATAAAAACGCTGAACTGACCACCTTTTTCTAGGACTTTGGTGACATTGGTTGGACCGGGTGGTGCTGGGGCTGCAGCTGGTGACTGAGCTAGGGTTGGAGGGCAATGAAGAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=36 fanout-score=95.29 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=18.7 sequence=CAAAATCATAGCCCACTTAAAAAAACGAGAGCAATCCATGCAATAACCTCATCAAAACCTTCTGTGTCACAAAGAATATATTGCTGCAACCATGCAAACTCCAAAGAACACAACATTGTTCAGAACAGTAAAGCTTACTGCCCCAGAAGTATCCGCAGGAGATTCTGGACTCGCTGCAGCTTTGGATCTCTTCTTTGGCTTTTCAGGTGCTGGTGCTGGAGTAGGAGGTTTAGGTGTAAAGATATCAAGAGGAAGAAGCACCTTGTCAACCTGATAAACAGCTAACTGGCTATCAGTGTAGATAGTGCCGGATACGCTTGTATTTGTAAGCCCTGTAGTTATATTCACAGAGTTTCCTGTGGTGGTTACGTTAAGCTCTAACCTGCCACCTGATCCTGCTTGTGTGGTCAGAGGGTTGCTCACAGTCTGGAACTGGGAACTTGATAGAAATTGTGGTATAATGTGAAACTGTACTAGCTCAGCCTTTTCTTGATCGCTTAGGGAGTTGAGG criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.51 fanout-score-rank=39 prefix-density=0.36 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=132.71 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=9.8 sequence=AAAGCAATTTCTTCATCCTCTTCTGTGATAATCACTCCTACCTTTTTGCTTCTTACAGTTTTCTTTTGTATCCCAGCTGTGCTTTATTTTCCTTCTAGTTCCAATGGCCACTGTTGAGGTTG SRR7169571 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 04:22:00 Started mapping on | Feb 11 04:22:04 Finished on | Feb 11 06:27:21 Mapping speed, Million of reads per hour | 9.15 Number of input reads | 19106242 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 18243855 Uniquely mapped reads % | 95.49% Average mapped length | 294.52 Number of splices: Total | 17320212 Number of splices: Annotated (sjdb) | 17017027 Number of splices: GT/AG | 17062292 Number of splices: GC/AG | 198753 Number of splices: AT/AC | 14962 Number of splices: Non-canonical | 44205 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 324497 % of reads mapped to multiple loci | 1.70% Number of reads mapped to too many loci | 23936 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.65% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 555839 555839 555839 N_multimapping 324497 324497 324497 N_noFeature 437296 18021934 543692 N_ambiguous 194534 1417 77865 UnstrandedReadsAssigned:17612025 PositiveStrandReadsAssigned:220504 NegativeStrandReadsAssigned:17622298 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169571 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169571-trimmed-pair1.fastq SRR7169571-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,106,242 reads, 17,486,652 reads pseudoaligned [quant] estimated average fragment length: 257.291 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 961 rounds 52401 SRR7169571.ke.tsv 34699 SRR7169571.se.tsv 87100 total ==> SRR7169571.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1761.71 283 9.3597 Potri.005G024800.1.v4.1 1035 778.709 36 2.69362 Potri.004G059700.1.v4.1 961 704.781 3 0.248014 Potri.007G009000.2.v4.1 1416 1159.71 0 0 Potri.003G141000.2.v4.1 2943 2686.71 309.091 6.70308 Potri.016G087400.1.v4.1 270 74.5139 1623.57 1269.53 Potri.015G069301.1.v4.1 564 314.829 0 0 Potri.010G195200.1.v4.1 1773 1516.71 24 0.921974 Potri.012G127500.1.v4.1 977 720.732 6673 539.457 ==> SRR7169571.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1502 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 364 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 23 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 0 SRR7169571 completed mapping pipeline successfully