Starting /dee2/code/volunteer_pipeline.sh SRR7169572 current disk space = 3057295372288 free memory = 1419066176 SRR7169572 SRAfilesize 38f9778a53dc68798839c0b048225adc SRR7169572.sra SRR7169572.sra file validated SRR7169572 is paired end SRR7169572 is conventional basespace SRR7169572 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169572_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6425 34.0 33.0 34.0 32.0 34.0 2 33.2645 34.0 33.0 34.0 32.0 34.0 3 33.2715 34.0 33.0 34.0 33.0 34.0 4 33.379 34.0 33.0 34.0 33.0 34.0 5 33.273 34.0 33.0 34.0 33.0 34.0 6 36.90825 38.0 37.0 38.0 35.0 38.0 7 37.216 38.0 38.0 38.0 36.0 38.0 8 37.2995 38.0 38.0 38.0 37.0 38.0 9 37.3235 38.0 38.0 38.0 37.0 38.0 10-14 37.4687 38.0 38.0 38.0 37.6 38.0 15-19 37.42315 38.0 38.0 38.0 37.0 38.0 20-24 37.42555 38.0 38.0 38.0 37.4 38.0 25-29 37.339 38.0 38.0 38.0 37.0 38.0 30-34 37.30555 38.0 38.0 38.0 37.0 38.0 35-39 37.2588 38.0 38.0 38.0 37.0 38.0 40-44 37.10235 38.0 38.0 38.0 36.0 38.0 45-49 36.95845 38.0 38.0 38.0 35.8 38.0 50-54 36.9541 38.0 38.0 38.0 35.8 38.0 55-59 36.79485 38.0 38.0 38.0 35.2 38.0 60-64 36.72725 38.0 38.0 38.0 34.8 38.0 65-69 36.697 38.0 38.0 38.0 35.0 38.0 70-74 36.59625 38.0 38.0 38.0 34.6 38.0 75-79 36.4024 38.0 38.0 38.0 34.0 38.0 80-84 36.39490000000001 38.0 38.0 38.0 34.0 38.0 85-89 36.328050000000005 38.0 38.0 38.0 33.8 38.0 90-94 36.097300000000004 38.0 37.8 38.0 33.2 38.0 95-99 35.9713 38.0 37.8 38.0 32.6 38.0 100-104 35.630700000000004 38.0 37.0 38.0 30.6 38.0 105-109 35.4756 38.0 37.0 38.0 30.4 38.0 110-114 35.08285 38.0 36.0 38.0 28.6 38.0 115-119 34.8737 38.0 35.8 38.0 27.4 38.0 120-124 34.7236 38.0 35.8 38.0 27.0 38.0 125-129 34.40025 38.0 35.0 38.0 25.6 38.0 130-134 34.040200000000006 38.0 35.0 38.0 22.6 38.0 135-139 33.75915 38.0 34.6 38.0 21.8 38.0 140-144 33.2827 38.0 34.2 38.0 16.4 38.0 145-149 32.09625 38.0 33.2 38.0 11.4 38.0 150-151 28.777875 36.0 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 2.0 9 1.0 10 0.0 11 2.0 12 1.0 13 2.0 14 7.0 15 4.0 16 3.0 17 9.0 18 10.0 19 7.0 20 9.0 21 11.0 22 20.0 23 14.0 24 12.0 25 15.0 26 27.0 27 21.0 28 37.0 29 38.0 30 54.0 31 79.0 32 104.0 33 117.0 34 158.0 35 312.0 36 682.0 37 2242.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.11042944785276 11.758691206543967 10.608384458077708 38.52249488752556 2 25.650000000000002 13.750000000000002 30.85 29.75 3 21.425 16.400000000000002 25.05 37.125 4 23.200000000000003 22.675 23.5 30.625000000000004 5 23.175 28.4 24.075 24.349999999999998 6 21.0 33.7 23.375 21.925 7 14.499999999999998 28.525 40.575 16.400000000000002 8 18.7 26.525 30.3 24.474999999999998 9 16.825000000000003 24.925 34.35 23.9 10-14 20.095 29.735 27.675 22.495 15-19 19.66 28.194999999999997 27.76 24.385 20-24 20.105 28.71 27.400000000000002 23.785 25-29 19.53 28.794999999999998 27.725 23.95 30-34 20.3 28.854999999999997 27.584999999999997 23.26 35-39 20.13 28.585 27.284999999999997 24.0 40-44 19.88 28.575 27.445000000000004 24.099999999999998 45-49 20.09 28.335 27.544999999999998 24.03 50-54 20.1 28.68 27.55 23.669999999999998 55-59 20.064999999999998 27.36 28.175 24.4 60-64 20.119999999999997 28.53 27.675 23.674999999999997 65-69 20.22 29.005 26.790000000000003 23.985 70-74 19.485 29.054999999999996 27.145000000000003 24.315 75-79 20.415 27.595 27.815 24.175 80-84 20.14 28.46 27.165 24.235 85-89 20.335 28.15 27.565 23.95 90-94 20.645 27.93 27.495000000000005 23.93 95-99 20.11 27.825 27.694999999999997 24.37 100-104 20.72865579021119 27.800020018016212 27.354619157241515 24.116705034531076 105-109 20.71 27.62 27.565 24.104999999999997 110-114 21.000951856119432 27.73909122789439 27.453534392064526 23.806422523921647 115-119 20.687928703750064 28.223101186601912 27.452060281379865 23.636909828268163 120-124 21.115059306341024 27.41104048846404 27.396026224913665 24.077873980281268 125-129 20.932326314209973 27.31956184664633 27.529635372380334 24.218476466763367 130-134 20.97 27.965 27.655 23.41 135-139 21.05 27.810000000000002 26.965 24.175 140-144 20.745 27.6 27.395000000000003 24.26 145-149 21.485000000000003 28.194999999999997 26.875 23.445 150-151 21.5 27.5875 27.05 23.8625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 1.5 23 1.5 24 0.5 25 2.5 26 3.5 27 4.5 28 9.5 29 15.0 30 17.0 31 18.0 32 24.0 33 34.0 34 52.5 35 64.0 36 80.5 37 104.0 38 122.5 39 142.5 40 165.5 41 201.0 42 230.5 43 256.5 44 281.0 45 284.5 46 275.0 47 263.5 48 235.0 49 206.5 50 186.5 51 157.0 52 133.0 53 108.5 54 78.5 55 61.0 56 45.5 57 32.0 58 26.5 59 20.0 60 14.5 61 10.0 62 6.5 63 6.0 64 4.5 65 2.0 66 1.5 67 2.0 68 1.5 69 0.5 70 1.0 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.1999999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.09 105-109 0.0 110-114 0.19499999999999998 115-119 0.135 120-124 0.095 125-129 0.034999999999999996 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.07500000000000001 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.425 0.0 0.0 0.0 0.0 108-109 0.48750000000000004 0.0 0.0 0.0 0.0 110-111 0.6 0.0 0.0 0.0 0.0 112-113 0.6875 0.0 0.0 0.0 0.0 114-115 0.8125 0.0 0.0 0.0 0.0 116-117 0.9375 0.0 0.0 0.0 0.0 118-119 1.1125 0.0 0.0 0.0 0.0 120-121 1.2125 0.0 0.0 0.0 0.0 122-123 1.425 0.0 0.0 0.0 0.0 124-125 1.6875 0.0 0.0 0.0 0.0 126-127 1.9125 0.0 0.0 0.0 0.0 128-129 2.0875 0.0 0.0 0.0 0.0 130-131 2.275 0.0 0.0 0.0 0.0 132-133 2.4749999999999996 0.0 0.0 0.0 0.0 134-135 2.625 0.0 0.0 0.0 0.0 136-137 2.9125 0.0 0.0 0.0 0.0 138-139 3.2750000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCCTGT 10 0.0061377296 150.2078 1 >>END_MODULE SRR7169572 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169572_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.375 33.0 33.0 34.0 32.0 34.0 2 32.674 33.0 33.0 34.0 32.0 34.0 3 32.70225 33.0 33.0 34.0 32.0 34.0 4 32.64975 34.0 33.0 34.0 32.0 34.0 5 32.6445 34.0 33.0 34.0 32.0 34.0 6 36.85325 38.0 38.0 38.0 36.0 38.0 7 36.901 38.0 38.0 38.0 36.0 38.0 8 36.83 38.0 38.0 38.0 36.0 38.0 9 36.79075 38.0 38.0 38.0 36.0 38.0 10-14 36.801 38.0 38.0 38.0 36.0 38.0 15-19 36.73175 38.0 38.0 38.0 35.2 38.0 20-24 36.72085 38.0 38.0 38.0 35.4 38.0 25-29 36.736749999999994 38.0 38.0 38.0 35.8 38.0 30-34 36.7242 38.0 38.0 38.0 35.6 38.0 35-39 36.6569 38.0 38.0 38.0 35.2 38.0 40-44 36.574400000000004 38.0 38.0 38.0 34.8 38.0 45-49 36.5173 38.0 38.0 38.0 34.4 38.0 50-54 36.329950000000004 38.0 38.0 38.0 34.2 38.0 55-59 36.06735 38.0 38.0 38.0 34.0 38.0 60-64 35.831950000000006 38.0 38.0 38.0 33.2 38.0 65-69 35.77735 38.0 38.0 38.0 33.2 38.0 70-74 35.63799999999999 38.0 38.0 38.0 32.2 38.0 75-79 35.47685 38.0 38.0 38.0 31.0 38.0 80-84 35.526199999999996 38.0 38.0 38.0 31.4 38.0 85-89 35.58045 38.0 38.0 38.0 31.4 38.0 90-94 35.474549999999994 38.0 38.0 38.0 30.6 38.0 95-99 35.3223 38.0 37.8 38.0 29.6 38.0 100-104 35.15915 38.0 37.0 38.0 28.8 38.0 105-109 34.89315 38.0 37.0 38.0 27.0 38.0 110-114 34.8977 38.0 37.0 38.0 27.6 38.0 115-119 34.7664 38.0 37.0 38.0 27.0 38.0 120-124 34.3305 38.0 36.0 38.0 23.2 38.0 125-129 34.1794 38.0 35.8 38.0 23.0 38.0 130-134 33.818749999999994 38.0 35.2 38.0 19.8 38.0 135-139 33.2535 38.0 35.0 38.0 14.6 38.0 140-144 32.8527 38.0 34.8 38.0 13.8 38.0 145-149 31.985149999999997 38.0 33.6 38.0 6.4 38.0 150-151 28.34975 36.0 18.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 4.0 4 0.0 5 1.0 6 3.0 7 4.0 8 0.0 9 4.0 10 5.0 11 7.0 12 12.0 13 16.0 14 26.0 15 5.0 16 8.0 17 6.0 18 8.0 19 13.0 20 13.0 21 15.0 22 21.0 23 19.0 24 22.0 25 35.0 26 30.0 27 33.0 28 45.0 29 56.0 30 52.0 31 77.0 32 78.0 33 125.0 34 127.0 35 216.0 36 450.0 37 2457.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.694011071967786 21.36386512330146 16.431806743834926 28.510317060895822 2 28.925 26.3 26.55 18.224999999999998 3 21.125 29.65 29.549999999999997 19.675 4 24.825 32.574999999999996 24.474999999999998 18.125 5 25.275 35.0 21.425 18.3 6 21.475 38.45 23.150000000000002 16.925 7 20.775 23.0 37.1 19.125 8 21.175 26.625 28.025 24.175 9 21.675 25.4 30.0 22.925 10-14 23.62 29.445 26.08 20.855 15-19 23.830000000000002 27.93 26.815 21.425 20-24 23.49 28.355000000000004 27.105 21.05 25-29 23.075000000000003 27.955000000000002 27.855 21.115000000000002 30-34 23.025000000000002 27.93 28.105000000000004 20.94 35-39 23.385 28.15 27.655 20.810000000000002 40-44 23.990000000000002 28.15 26.69 21.17 45-49 23.105 28.665000000000003 27.065 21.165 50-54 23.59855334538879 27.195097448262008 27.556761101064897 21.649588105284305 55-59 23.767837263434874 28.32203218297743 27.016496306041898 20.893634247545794 60-64 24.10527923433284 27.388891717151147 27.419436949549457 21.086392098966552 65-69 23.425538430131674 28.02388486271308 27.9779524344187 20.572624272736554 70-74 23.817550311574216 27.536009806926142 27.49514761466953 21.151292266830115 75-79 23.71097143441157 27.441361336808217 27.885942051203433 20.961725177576778 80-84 24.284696059464412 27.71102739028612 27.726300784034212 20.277975766215253 85-89 23.99370590325364 27.856453987107255 27.856453987107255 20.29338612253185 90-94 24.150847886610986 28.144773475069602 27.208301695773223 20.49607694254619 95-99 24.69029680942509 28.032563078323303 27.051625625726857 20.22551448652475 100-104 24.551835580467607 27.35444124627582 27.601878503257083 20.491844669999494 105-109 24.076317383403996 27.36725217040178 27.675146375933778 20.88128407026045 110-114 23.342576254096294 28.051424250063018 27.653138391731787 20.952861104108898 115-119 24.487121326679773 27.506426735218508 27.41065577902112 20.5957961590806 120-124 24.22900840167027 27.7556975398702 27.51421240629874 20.50108165216079 125-129 24.333198625985048 28.010709234188724 27.28834107900586 20.367751060820368 130-134 24.41719035069937 27.898844516521386 27.06770727751875 20.616257855260493 135-139 24.615776081424936 27.8117048346056 27.267175572519083 20.30534351145038 140-144 24.624548185104107 27.638344448404013 27.36852822888561 20.36857913760627 145-149 25.108534654476735 28.203687624495632 26.82976658664896 19.85801113437867 150-151 24.58616707301424 27.90966251764404 28.448607724881303 19.055562684460416 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 1.0 18 1.0 19 1.5 20 3.0 21 2.5 22 4.0 23 7.5 24 7.5 25 6.0 26 6.5 27 6.5 28 5.5 29 6.0 30 9.5 31 14.5 32 24.0 33 31.5 34 38.0 35 47.5 36 65.5 37 96.0 38 129.0 39 162.0 40 201.0 41 224.5 42 244.0 43 265.5 44 278.0 45 286.0 46 283.0 47 259.5 48 224.0 49 216.0 50 195.0 51 158.5 52 127.5 53 91.5 54 67.0 55 48.5 56 39.0 57 32.5 58 22.0 59 17.0 60 10.5 61 5.0 62 5.0 63 5.0 64 5.5 65 3.0 66 1.0 67 1.0 68 0.0 69 1.5 70 2.0 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.65 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.45999999999999996 55-59 1.1900000000000002 60-64 1.7850000000000001 65-69 2.03 70-74 2.11 75-79 2.155 80-84 1.79 85-89 1.4949999999999999 90-94 1.225 95-99 1.115 100-104 0.985 105-109 0.9400000000000001 110-114 0.8250000000000001 115-119 0.8049999999999999 120-124 0.615 125-129 1.02 130-134 1.34 135-139 1.7500000000000002 140-144 1.7850000000000001 145-149 2.105 150-151 2.5875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77443609022556 99.52499999999999 2 0.20050125313283207 0.4 3 0.02506265664160401 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.575 0.0 0.0 0.0 0.0 112-113 0.6625000000000001 0.0 0.0 0.0 0.0 114-115 0.7875 0.0 0.0 0.0 0.0 116-117 0.9125 0.0 0.0 0.0 0.0 118-119 1.075 0.0 0.0 0.0 0.0 120-121 1.1875 0.0 0.0 0.0 0.0 122-123 1.35 0.0 0.0 0.0 0.0 124-125 1.6125 0.0 0.0 0.0 0.0 126-127 1.8375 0.0 0.0 0.0 0.0 128-129 2.0 0.0 0.0 0.0 0.0 130-131 2.175 0.0 0.0 0.0 0.0 132-133 2.375 0.0 0.0 0.0 0.0 134-135 2.5250000000000004 0.0 0.0 0.0 0.0 136-137 2.7875 0.0 0.0 0.0 0.0 138-139 3.0999999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGAATT 10 0.0071503306 142.8 2 CAAAAAT 10 0.0071503306 142.8 2 >>END_MODULE Read 825061 spots for SRR7169572.sra Written 825061 spots for SRR7169572.sra Read 825061 spots for SRR7169572.sra Written 825061 spots for SRR7169572.sra Read 825061 spots for SRR7169572.sra Written 825061 spots for SRR7169572.sra Read 825061 spots for SRR7169572.sra Written 825061 spots for SRR7169572.sra Read 825061 spots for SRR7169572.sra Written 825061 spots for SRR7169572.sra Read 825061 spots for SRR7169572.sra Written 825061 spots for SRR7169572.sra Read 825061 spots for SRR7169572.sra Written 825061 spots for SRR7169572.sra Read 825061 spots for SRR7169572.sra Written 825061 spots for SRR7169572.sra Read 825061 spots for SRR7169572.sra Written 825061 spots for SRR7169572.sra Read 825061 spots for SRR7169572.sra Written 825061 spots for SRR7169572.sra Read 825061 spots for SRR7169572.sra Written 825061 spots for SRR7169572.sra Read 825061 spots for SRR7169572.sra Written 825061 spots for SRR7169572.sra Read 825061 spots for SRR7169572.sra Written 825061 spots for SRR7169572.sra Read 825061 spots for SRR7169572.sra Written 825061 spots for SRR7169572.sra Read 825061 spots for SRR7169572.sra Written 825061 spots for SRR7169572.sra Read 825061 spots for SRR7169572.sra Written 825061 spots for SRR7169572.sra Read 825067 spots for SRR7169572.sra Written 825067 spots for SRR7169572.sra Read 825061 spots for SRR7169572.sra Written 825061 spots for SRR7169572.sra Read 825061 spots for SRR7169572.sra Written 825061 spots for SRR7169572.sra Read 825061 spots for SRR7169572.sra Written 825061 spots for SRR7169572.sra SRR ids: ['SRR7169572.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_589oz24d SRR7169572.sra spots: 16501226 blocks: [[1, 825061], [825062, 1650122], [1650123, 2475183], [2475184, 3300244], [3300245, 4125305], [4125306, 4950366], [4950367, 5775427], [5775428, 6600488], [6600489, 7425549], [7425550, 8250610], [8250611, 9075671], [9075672, 9900732], [9900733, 10725793], [10725794, 11550854], [11550855, 12375915], [12375916, 13200976], [13200977, 14026037], [14026038, 14851098], [14851099, 15676159], [15676160, 16501226]] SRR7169572 file size 5570023 SRR7169572 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169572 SRR7169572_1.fastq SRR7169572_2.fastq Input file: SRR7169572_1.fastq Paired file: SRR7169572_2.fastq trimmed: SRR7169572-trimmed-pair1.fastq, SRR7169572-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 01:01:26 2025 >> started Tue Feb 11 01:01:54 2025 >> done (28.007s) 16501226 read pairs processed; of these: 18104 ( 0.11%) short read pairs filtered out after trimming by size control 28650 ( 0.17%) empty read pairs filtered out after trimming by size control 16454472 (99.72%) read pairs available; of these: 7483351 (45.48%) trimmed read pairs available after processing 8971121 (54.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 2 0.00% 21 7 0.00% 22 7 0.00% 23 3 0.00% 24 4 0.00% 25 3 0.00% 26 12 0.00% 27 7 0.00% 28 8 0.00% 29 7 0.00% 30 11 0.00% 31 10 0.00% 32 9 0.00% 33 8 0.00% 34 10 0.00% 35 14 0.00% 36 14 0.00% 37 17 0.00% 38 19 0.00% 39 17 0.00% 40 19 0.00% 41 31 0.00% 42 29 0.00% 43 26 0.00% 44 33 0.00% 45 44 0.00% 46 50 0.00% 47 42 0.00% 48 42 0.00% 49 45 0.00% 50 60 0.00% 51 62 0.00% 52 80 0.00% 53 85 0.00% 54 110 0.00% 55 104 0.00% 56 114 0.00% 57 119 0.00% 58 142 0.00% 59 182 0.00% 60 190 0.00% 61 219 0.00% 62 262 0.00% 63 315 0.00% 64 327 0.00% 65 322 0.00% 66 447 0.00% 67 537 0.00% 68 608 0.00% 69 703 0.00% 70 921 0.01% 71 882 0.01% 72 1005 0.01% 73 1144 0.01% 74 1355 0.01% 75 1851 0.01% 76 1500 0.01% 77 1154 0.01% 78 1767 0.01% 79 3206 0.02% 80 5378 0.03% 81 1735 0.01% 82 1981 0.01% 83 2300 0.01% 84 3167 0.02% 85 3898 0.02% 86 4342 0.03% 87 4545 0.03% 88 4614 0.03% 89 4936 0.03% 90 5225 0.03% 91 5616 0.03% 92 6074 0.04% 93 6684 0.04% 94 7345 0.04% 95 8113 0.05% 96 8705 0.05% 97 9781 0.06% 98 11212 0.07% 99 14242 0.09% 100 18149 0.11% 101 15552 0.09% 102 10962 0.07% 103 11160 0.07% 104 11782 0.07% 105 12645 0.08% 106 13337 0.08% 107 14144 0.09% 108 14859 0.09% 109 15398 0.09% 110 16498 0.10% 111 17076 0.10% 112 17902 0.11% 113 19097 0.12% 114 19888 0.12% 115 21234 0.13% 116 22155 0.13% 117 23579 0.14% 118 24366 0.15% 119 25491 0.15% 120 26636 0.16% 121 28037 0.17% 122 28956 0.18% 123 30825 0.19% 124 32145 0.20% 125 34107 0.21% 126 35848 0.22% 127 38420 0.23% 128 40157 0.24% 129 41614 0.25% 130 44401 0.27% 131 45730 0.28% 132 49473 0.30% 133 52684 0.32% 134 55442 0.34% 135 59715 0.36% 136 63841 0.39% 137 69226 0.42% 138 74763 0.45% 139 81558 0.50% 140 88911 0.54% 141 97081 0.59% 142 107178 0.65% 143 119272 0.72% 144 137656 0.84% 145 164866 1.00% 146 199459 1.21% 147 270886 1.65% 148 402869 2.45% 149 771417 4.69% 150 3704682 22.51% 151 8971121 54.52% 16454472 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=46 prefix-density=0.15 prefix-fanout=1.9 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.15 sequence-density-rank=3 fanout-score=74.29 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=15.3 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.92 fanout-score-rank=35 prefix-density=0.26 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.08 sequence-density-rank=33 fanout-score=73.33 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=13.2 sequence=AGAAAATGGAAACCTTTCTATTCAC SRR7169572 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 01:02:49 Started mapping on | Feb 11 01:02:49 Finished on | Feb 11 01:05:04 Mapping speed, Million of reads per hour | 438.79 Number of input reads | 16454472 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 15565770 Uniquely mapped reads % | 94.60% Average mapped length | 294.90 Number of splices: Total | 14820627 Number of splices: Annotated (sjdb) | 14562425 Number of splices: GT/AG | 14595800 Number of splices: GC/AG | 177040 Number of splices: AT/AC | 12881 Number of splices: Non-canonical | 34906 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 279983 % of reads mapped to multiple loci | 1.70% Number of reads mapped to too many loci | 27168 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.49% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 626651 626651 626651 N_multimapping 279983 279983 279983 N_noFeature 321939 15387989 409990 N_ambiguous 155499 829 65190 UnstrandedReadsAssigned:15088332 PositiveStrandReadsAssigned:176952 NegativeStrandReadsAssigned:15090590 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169572 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169572-trimmed-pair1.fastq SRR7169572-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,454,472 reads, 15,015,767 reads pseudoaligned [quant] estimated average fragment length: 254.701 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,270 rounds 52401 SRR7169572.ke.tsv 34699 SRR7169572.se.tsv 87100 total ==> SRR7169572.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1764.3 373 13.6136 Potri.005G024800.1.v4.1 1035 781.299 60 4.94506 Potri.004G059700.1.v4.1 961 707.324 2 0.182075 Potri.007G009000.2.v4.1 1416 1162.3 0 0 Potri.003G141000.2.v4.1 2943 2689.3 281.041 6.72927 Potri.016G087400.1.v4.1 270 71.7301 1151.97 1034.14 Potri.015G069301.1.v4.1 564 315.331 0 0 Potri.010G195200.1.v4.1 1773 1519.3 62 2.62776 Potri.012G127500.1.v4.1 977 723.305 10082 897.559 ==> SRR7169572.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1997 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 495 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 7 Potri.001G452600.v4.1 1 SRR7169572 completed mapping pipeline successfully