Starting /dee2/code/volunteer_pipeline.sh SRR7169573 current disk space = 3056943988736 free memory = 1350962264 SRR7169573 SRAfilesize 60b27ac2fed9d0effda0e326f09a8420 SRR7169573.sra SRR7169573.sra file validated SRR7169573 is paired end SRR7169573 is conventional basespace SRR7169573 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169573_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.547 34.0 33.0 34.0 32.0 34.0 2 33.25975 34.0 33.0 34.0 32.0 34.0 3 33.21875 34.0 33.0 34.0 31.0 34.0 4 33.3635 34.0 33.0 34.0 33.0 34.0 5 33.22325 34.0 33.0 34.0 33.0 34.0 6 36.719 38.0 37.0 38.0 34.0 38.0 7 37.0425 38.0 38.0 38.0 36.0 38.0 8 37.1565 38.0 38.0 38.0 36.0 38.0 9 37.234 38.0 38.0 38.0 37.0 38.0 10-14 37.2686 38.0 38.0 38.0 37.0 38.0 15-19 37.318349999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.2836 38.0 38.0 38.0 36.8 38.0 25-29 37.21405 38.0 38.0 38.0 36.6 38.0 30-34 37.15605000000001 38.0 38.0 38.0 36.2 38.0 35-39 37.07795 38.0 38.0 38.0 36.0 38.0 40-44 36.83735 38.0 38.0 38.0 35.2 38.0 45-49 36.64735 38.0 38.0 38.0 34.2 38.0 50-54 36.57245 38.0 38.0 38.0 34.0 38.0 55-59 36.45615 38.0 38.0 38.0 34.0 38.0 60-64 36.3305 38.0 37.6 38.0 34.0 38.0 65-69 36.22430000000001 38.0 37.0 38.0 33.2 38.0 70-74 36.1725 38.0 37.0 38.0 33.0 38.0 75-79 35.8824 38.0 37.0 38.0 31.4 38.0 80-84 35.94695 38.0 37.0 38.0 32.6 38.0 85-89 35.7626 38.0 37.0 38.0 31.0 38.0 90-94 35.55265 38.0 36.8 38.0 29.8 38.0 95-99 35.4367 38.0 36.4 38.0 29.8 38.0 100-104 35.071999999999996 38.0 36.0 38.0 28.8 38.0 105-109 34.896049999999995 38.0 36.0 38.0 27.6 38.0 110-114 34.45225000000001 38.0 35.0 38.0 24.6 38.0 115-119 34.1562 38.0 34.4 38.0 24.2 38.0 120-124 33.860800000000005 38.0 34.0 38.0 22.6 38.0 125-129 33.51675 38.0 34.0 38.0 19.0 38.0 130-134 33.12315 38.0 33.8 38.0 15.0 38.0 135-139 32.71875 38.0 33.0 38.0 15.0 38.0 140-144 32.353750000000005 37.2 33.2 38.0 14.2 38.0 145-149 30.86085 36.0 31.0 38.0 8.8 38.0 150-151 26.753500000000003 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 3.0 10 1.0 11 1.0 12 2.0 13 3.0 14 3.0 15 6.0 16 7.0 17 9.0 18 9.0 19 9.0 20 11.0 21 10.0 22 16.0 23 20.0 24 23.0 25 20.0 26 33.0 27 38.0 28 44.0 29 52.0 30 67.0 31 96.0 32 102.0 33 173.0 34 247.0 35 397.0 36 949.0 37 1648.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.51088348271447 12.112676056338028 10.678617157490397 35.697823303457106 2 24.95 14.424999999999999 30.075000000000003 30.55 3 21.95 17.125 24.45 36.475 4 22.1 24.25 24.55 29.099999999999998 5 22.475 29.599999999999998 23.775 24.15 6 21.325 31.974999999999998 24.75 21.95 7 14.924999999999999 26.625 41.199999999999996 17.25 8 17.775 26.625 29.849999999999998 25.75 9 17.0 24.825 33.900000000000006 24.275 10-14 19.41 29.68 28.050000000000004 22.86 15-19 20.075000000000003 28.54 27.644999999999996 23.74 20-24 19.545 28.675 27.529999999999998 24.25 25-29 20.005 28.810000000000002 27.97 23.215 30-34 20.294999999999998 28.87 26.950000000000003 23.885 35-39 20.03 28.255000000000003 27.465 24.25 40-44 19.845 28.54 27.76 23.855 45-49 20.669999999999998 28.544999999999998 27.150000000000002 23.635 50-54 19.705000000000002 28.205000000000002 27.655 24.435000000000002 55-59 20.535 28.285 26.955000000000002 24.224999999999998 60-64 19.814999999999998 28.544999999999998 27.705000000000002 23.935000000000002 65-69 20.294999999999998 28.23 27.169999999999998 24.305 70-74 20.455000000000002 28.43 27.605 23.51 75-79 20.365 27.725 27.715 24.195 80-84 20.215 28.555000000000003 27.11 24.12 85-89 20.945 28.050000000000004 27.445000000000004 23.56 90-94 20.630000000000003 28.050000000000004 27.005000000000003 24.315 95-99 20.05 27.62 28.144999999999996 24.185000000000002 100-104 20.625312656328166 28.154077038519258 27.878939469734863 23.34167083541771 105-109 20.455000000000002 27.994999999999997 27.71 23.84 110-114 20.942801381173997 28.579292398538758 26.987939748786467 23.489966471500775 115-119 20.511281204662566 28.080444244334384 27.825303917154436 23.582970633848614 120-124 20.86543271635818 28.30415207603802 27.018509254627315 23.81190595297649 125-129 20.56602830141507 27.986399319965997 27.151357567878392 24.296214810740537 130-134 20.560000000000002 28.175 27.365000000000002 23.9 135-139 21.42 27.725 26.584999999999997 24.27 140-144 20.535 28.08 27.084999999999997 24.3 145-149 21.349999999999998 27.389999999999997 27.515 23.745 150-151 21.349999999999998 27.762500000000003 27.325 23.5625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 2.0 23 2.5 24 2.5 25 2.5 26 5.5 27 8.5 28 9.0 29 12.0 30 15.0 31 25.0 32 33.5 33 34.5 34 53.5 35 66.5 36 73.5 37 97.5 38 112.5 39 142.5 40 170.0 41 197.5 42 223.5 43 231.5 44 262.0 45 280.0 46 282.0 47 278.0 48 247.0 49 213.0 50 184.0 51 157.0 52 121.0 53 101.0 54 92.5 55 65.5 56 48.5 57 37.5 58 29.0 59 19.0 60 10.0 61 10.0 62 9.0 63 8.0 64 5.5 65 1.5 66 2.0 67 1.5 68 2.5 69 2.5 70 0.5 71 0.5 72 1.5 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.375 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.05 105-109 0.0 110-114 0.08499999999999999 115-119 0.055 120-124 0.05 125-129 0.005 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.3875 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.725 0.0 0.0 0.0 0.0 110-111 0.8375 0.0 0.0 0.0 0.0 112-113 0.9375 0.0 0.0 0.0 0.0 114-115 1.1124999999999998 0.0 0.0 0.0 0.0 116-117 1.35 0.0 0.0 0.0 0.0 118-119 1.475 0.0 0.0 0.0 0.0 120-121 1.5750000000000002 0.0 0.0 0.0 0.0 122-123 1.6875 0.0 0.0 0.0 0.0 124-125 1.7999999999999998 0.0 0.0 0.0 0.0 126-127 2.0375 0.0 0.0 0.0 0.0 128-129 2.3125 0.0 0.0 0.0 0.0 130-131 2.75 0.0 0.0 0.0 0.0 132-133 2.9749999999999996 0.0 0.0 0.0 0.0 134-135 3.2375 0.0 0.0 0.0 0.0 136-137 3.5125 0.0 0.0 0.0 0.0 138-139 3.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169573 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169573_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.426 33.0 33.0 34.0 32.0 34.0 2 32.69025 33.0 33.0 34.0 32.0 34.0 3 32.716 33.0 33.0 34.0 32.0 34.0 4 32.6715 33.0 33.0 34.0 32.0 34.0 5 32.72425 34.0 33.0 34.0 32.0 34.0 6 36.881 38.0 38.0 38.0 36.0 38.0 7 36.9945 38.0 38.0 38.0 36.0 38.0 8 36.8095 38.0 38.0 38.0 36.0 38.0 9 36.91175 38.0 38.0 38.0 36.0 38.0 10-14 36.81765 38.0 38.0 38.0 36.0 38.0 15-19 36.7967 38.0 38.0 38.0 36.0 38.0 20-24 36.790800000000004 38.0 38.0 38.0 35.8 38.0 25-29 36.8087 38.0 38.0 38.0 36.0 38.0 30-34 36.73655 38.0 38.0 38.0 35.8 38.0 35-39 36.663399999999996 38.0 38.0 38.0 35.8 38.0 40-44 36.5965 38.0 38.0 38.0 34.8 38.0 45-49 36.554700000000004 38.0 38.0 38.0 34.8 38.0 50-54 36.370999999999995 38.0 38.0 38.0 34.6 38.0 55-59 36.048500000000004 38.0 38.0 38.0 34.0 38.0 60-64 35.825 38.0 38.0 38.0 33.4 38.0 65-69 35.73375 38.0 38.0 38.0 33.4 38.0 70-74 35.6221 38.0 38.0 38.0 32.6 38.0 75-79 35.534749999999995 38.0 38.0 38.0 31.4 38.0 80-84 35.54195 38.0 38.0 38.0 31.8 38.0 85-89 35.5344 38.0 38.0 38.0 31.2 38.0 90-94 35.44259999999999 38.0 38.0 38.0 30.2 38.0 95-99 35.4148 38.0 37.8 38.0 31.0 38.0 100-104 35.11345 38.0 37.0 38.0 28.8 38.0 105-109 34.8931 38.0 37.0 38.0 27.8 38.0 110-114 34.7828 38.0 37.0 38.0 27.0 38.0 115-119 34.59775 38.0 36.8 38.0 25.8 38.0 120-124 34.285000000000004 38.0 36.0 38.0 23.0 38.0 125-129 34.10535 38.0 35.6 38.0 23.0 38.0 130-134 33.7128 38.0 35.0 38.0 17.8 38.0 135-139 33.18685 38.0 35.0 38.0 14.2 38.0 140-144 32.8421 38.0 34.6 38.0 13.8 38.0 145-149 31.928400000000003 38.0 33.6 38.0 6.4 38.0 150-151 28.036625 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 5.0 4 4.0 5 2.0 6 1.0 7 2.0 8 2.0 9 1.0 10 3.0 11 3.0 12 8.0 13 27.0 14 28.0 15 3.0 16 4.0 17 12.0 18 10.0 19 7.0 20 15.0 21 16.0 22 18.0 23 24.0 24 19.0 25 21.0 26 24.0 27 46.0 28 41.0 29 43.0 30 62.0 31 53.0 32 93.0 33 106.0 34 150.0 35 242.0 36 486.0 37 2409.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.12969025434399 21.9843868043314 15.336187358348022 27.54973558297658 2 28.325 27.150000000000002 26.85 17.675 3 21.25 29.65 29.099999999999998 20.0 4 25.0 34.025 22.225 18.75 5 23.974999999999998 35.675000000000004 23.05 17.299999999999997 6 21.925 36.575 23.05 18.45 7 20.349999999999998 23.200000000000003 36.525 19.925 8 22.35 26.5 25.6 25.55 9 22.225 25.75 28.95 23.075000000000003 10-14 23.263142099734907 29.440304106437253 26.244185464912718 21.05236832891512 15-19 23.630000000000003 27.860000000000003 26.840000000000003 21.67 20-24 23.95 28.395 26.465 21.19 25-29 23.919999999999998 27.71 26.765 21.605 30-34 23.400000000000002 28.249999999999996 27.04 21.310000000000002 35-39 23.055 28.09 27.38 21.475 40-44 24.005000000000003 28.33 26.974999999999998 20.69 45-49 23.615 28.27 26.889999999999997 21.224999999999998 50-54 23.49718536389224 28.030759951749097 26.925010052271816 21.547044632086852 55-59 24.019260010136847 28.2159148504815 26.984287886467307 20.780537252914343 60-64 23.681931638734653 27.86409250674953 27.34960012225562 21.1043757322602 65-69 24.01409889660809 27.56436452799346 27.64609726195341 20.775439313445034 70-74 24.27804753386149 27.794531050345007 27.196524405826732 20.730897009966778 75-79 24.335106382978726 27.010024549918164 27.83858428805237 20.816284779050736 80-84 23.9504789076829 27.95496229875688 27.31811697574893 20.77644181781129 85-89 24.390367811420443 27.479170900223533 27.33692338955497 20.793537898801056 90-94 24.196491939572137 27.912399878333165 27.59302443475616 20.298083747338538 95-99 23.886947272450996 28.14161981461784 27.214709010788635 20.756723902142532 100-104 24.597631339204373 27.735600769308633 26.849883591456624 20.816884300030367 105-109 23.441926345609065 28.20720356131121 27.17523269931202 21.175637393767705 110-114 24.406505707647234 27.694716638044248 27.866451156682494 20.032326497626023 115-119 24.636510500807756 27.93315831987076 26.984046849757675 20.446284329563813 120-124 24.541607898448518 27.352407817852104 27.71509167842031 20.390892605279063 125-129 24.129730823719893 28.562031977332524 26.968225055656745 20.34001214329083 130-134 24.179392217543505 28.04525391913145 27.045811983156614 20.729541880168433 135-139 24.80146609651802 27.98309916513948 26.506821421299126 20.708613317043373 140-144 24.983442865148504 27.372764786795052 26.83274746548474 20.811044882571707 145-149 24.89011550649085 28.099764898292957 27.31779617704181 19.692323418174386 150-151 25.10905824993585 26.99512445470875 27.16191942519887 20.733897870156532 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 1.0 15 1.5 16 1.0 17 1.0 18 1.5 19 4.0 20 7.5 21 6.5 22 3.5 23 4.5 24 7.0 25 6.5 26 4.5 27 5.0 28 7.0 29 8.0 30 10.0 31 11.0 32 17.0 33 23.5 34 27.5 35 47.0 36 67.0 37 78.0 38 98.0 39 144.5 40 191.0 41 234.5 42 258.5 43 270.0 44 281.0 45 276.0 46 284.5 47 269.5 48 248.5 49 220.5 50 178.5 51 159.5 52 135.0 53 102.0 54 80.5 55 59.5 56 38.5 57 31.5 58 23.5 59 12.5 60 7.5 61 8.0 62 8.0 63 3.5 64 6.0 65 6.0 66 2.0 67 1.0 68 2.0 69 2.5 70 1.0 71 0.5 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7250000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.034999999999999996 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.52 55-59 1.35 60-64 1.8450000000000002 65-69 2.12 70-74 2.175 75-79 2.2399999999999998 80-84 1.8599999999999999 85-89 1.58 90-94 1.37 95-99 1.2850000000000001 100-104 1.21 105-109 1.16 110-114 1.01 115-119 0.96 120-124 0.74 125-129 1.18 130-134 1.4449999999999998 135-139 1.78 140-144 1.855 145-149 2.17 150-151 2.5749999999999997 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74931060416145 99.47500000000001 2 0.22562045625470042 0.44999999999999996 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.30000000000000004 0.0 0.0 0.0 0.0 102-103 0.3875 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.575 0.0 0.0 0.0 0.0 108-109 0.6875 0.0 0.0 0.0 0.0 110-111 0.8125 0.0 0.0 0.0 0.0 112-113 0.975 0.0 0.0 0.0 0.0 114-115 1.1625 0.0 0.0 0.0 0.0 116-117 1.4 0.0 0.0 0.0 0.0 118-119 1.5499999999999998 0.0 0.0 0.0 0.0 120-121 1.6625 0.0 0.0 0.0 0.0 122-123 1.7875 0.0 0.0 0.0 0.0 124-125 1.9 0.0 0.0 0.0 0.0 126-127 2.1375 0.0 0.0 0.0 0.0 128-129 2.4125 0.0 0.0 0.0 0.0 130-131 2.8499999999999996 0.0 0.0 0.0 0.0 132-133 3.075 0.0 0.0 0.0 0.0 134-135 3.35 0.0 0.0 0.0 0.0 136-137 3.625 0.0 0.0 0.0 0.0 138-139 3.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 853788 spots for SRR7169573.sra Written 853788 spots for SRR7169573.sra Read 853788 spots for SRR7169573.sra Written 853788 spots for SRR7169573.sra Read 853788 spots for SRR7169573.sra Written 853788 spots for SRR7169573.sra Read 853788 spots for SRR7169573.sra Written 853788 spots for SRR7169573.sra Read 853788 spots for SRR7169573.sra Written 853788 spots for SRR7169573.sra Read 853788 spots for SRR7169573.sra Written 853788 spots for SRR7169573.sra Read 853788 spots for SRR7169573.sra Written 853788 spots for SRR7169573.sra Read 853788 spots for SRR7169573.sra Written 853788 spots for SRR7169573.sra Read 853788 spots for SRR7169573.sra Written 853788 spots for SRR7169573.sra Read 853788 spots for SRR7169573.sra Written 853788 spots for SRR7169573.sra Read 853788 spots for SRR7169573.sra Written 853788 spots for SRR7169573.sra Read 853788 spots for SRR7169573.sra Read 853789 spots for SRR7169573.sra Written 853789 spots for SRR7169573.sra Written 853788 spots for SRR7169573.sra Read 853788 spots for SRR7169573.sra Written 853788 spots for SRR7169573.sra Read 853788 spots for SRR7169573.sra Written 853788 spots for SRR7169573.sra Read 853788 spots for SRR7169573.sra Written 853788 spots for SRR7169573.sra Read 853788 spots for SRR7169573.sra Written 853788 spots for SRR7169573.sra Read 853788 spots for SRR7169573.sra Written 853788 spots for SRR7169573.sra Read 853788 spots for SRR7169573.sra Written 853788 spots for SRR7169573.sra Read 853788 spots for SRR7169573.sra Written 853788 spots for SRR7169573.sra SRR ids: ['SRR7169573.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tnw6omeb SRR7169573.sra spots: 17075761 blocks: [[1, 853788], [853789, 1707576], [1707577, 2561364], [2561365, 3415152], [3415153, 4268940], [4268941, 5122728], [5122729, 5976516], [5976517, 6830304], [6830305, 7684092], [7684093, 8537880], [8537881, 9391668], [9391669, 10245456], [10245457, 11099244], [11099245, 11953032], [11953033, 12806820], [12806821, 13660608], [13660609, 14514396], [14514397, 15368184], [15368185, 16221972], [16221973, 17075761]] SRR7169573 file size 5764714 SRR7169573 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169573 SRR7169573_1.fastq SRR7169573_2.fastq Input file: SRR7169573_1.fastq Paired file: SRR7169573_2.fastq trimmed: SRR7169573-trimmed-pair1.fastq, SRR7169573-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 03:17:44 2025 >> started Tue Feb 11 03:24:09 2025 >> done (385.195s) 17075761 read pairs processed; of these: 20241 ( 0.12%) short read pairs filtered out after trimming by size control 17247 ( 0.10%) empty read pairs filtered out after trimming by size control 17038273 (99.78%) read pairs available; of these: 8750540 (51.36%) trimmed read pairs available after processing 8287733 (48.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 3 0.00% 20 3 0.00% 21 12 0.00% 22 8 0.00% 23 5 0.00% 24 6 0.00% 25 2 0.00% 26 11 0.00% 27 8 0.00% 28 14 0.00% 29 10 0.00% 30 18 0.00% 31 16 0.00% 32 21 0.00% 33 11 0.00% 34 21 0.00% 35 17 0.00% 36 22 0.00% 37 29 0.00% 38 26 0.00% 39 24 0.00% 40 28 0.00% 41 31 0.00% 42 35 0.00% 43 41 0.00% 44 40 0.00% 45 40 0.00% 46 54 0.00% 47 59 0.00% 48 64 0.00% 49 88 0.00% 50 80 0.00% 51 70 0.00% 52 99 0.00% 53 104 0.00% 54 119 0.00% 55 139 0.00% 56 137 0.00% 57 167 0.00% 58 197 0.00% 59 210 0.00% 60 225 0.00% 61 271 0.00% 62 299 0.00% 63 355 0.00% 64 404 0.00% 65 449 0.00% 66 535 0.00% 67 660 0.00% 68 759 0.00% 69 1035 0.01% 70 1017 0.01% 71 959 0.01% 72 1113 0.01% 73 1321 0.01% 74 1520 0.01% 75 2069 0.01% 76 1777 0.01% 77 1379 0.01% 78 1886 0.01% 79 3318 0.02% 80 5381 0.03% 81 2117 0.01% 82 2479 0.01% 83 2678 0.02% 84 3903 0.02% 85 4565 0.03% 86 5086 0.03% 87 5458 0.03% 88 5632 0.03% 89 6008 0.04% 90 6351 0.04% 91 6797 0.04% 92 7381 0.04% 93 7870 0.05% 94 8744 0.05% 95 9603 0.06% 96 10294 0.06% 97 11826 0.07% 98 13367 0.08% 99 17149 0.10% 100 20927 0.12% 101 15632 0.09% 102 13597 0.08% 103 13752 0.08% 104 14660 0.09% 105 15663 0.09% 106 16930 0.10% 107 17356 0.10% 108 18121 0.11% 109 18970 0.11% 110 19845 0.12% 111 20992 0.12% 112 22068 0.13% 113 23572 0.14% 114 24625 0.14% 115 25838 0.15% 116 27243 0.16% 117 28183 0.17% 118 29673 0.17% 119 30521 0.18% 120 31908 0.19% 121 33433 0.20% 122 34917 0.20% 123 36896 0.22% 124 38609 0.23% 125 41046 0.24% 126 42958 0.25% 127 45222 0.27% 128 47152 0.28% 129 50098 0.29% 130 52480 0.31% 131 54872 0.32% 132 58125 0.34% 133 61395 0.36% 134 66285 0.39% 135 71132 0.42% 136 76192 0.45% 137 82361 0.48% 138 89434 0.52% 139 98086 0.58% 140 106848 0.63% 141 116814 0.69% 142 130038 0.76% 143 146568 0.86% 144 170271 1.00% 145 206572 1.21% 146 256462 1.51% 147 349133 2.05% 148 525366 3.08% 149 990451 5.81% 150 4055113 23.80% 151 8287733 48.64% 17038273 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=36 prefix-density=0.24 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.10 sequence-density-rank=17 fanout-score=95.30 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=14.6 sequence=CCACCACCATGGGCTCCCCAGCCACC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.34 fanout-score-rank=37 prefix-density=0.24 prefix-fanout=2.2 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.05 sequence-density-rank=38 fanout-score=61.19 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=14.0 sequence=TTCTTTTCTTTTCACCTTCTTCAACCTTTTGTTTCCTTAAAGAATTCAATCTTGATCAAGATGGGTTCGACAGGTGAAACTCAGATGACTCCAACTCAGGTATCAGATGAAGAGGCACACCTCTTTGCCATGCAACTAGCCAGTGCTTCAGTTCTACCAATGATCCTCAAAACAGCCATTGAACTCGACCTTCTTGAAATCATGGCTAAAGCTGGCCCTGGTGCTTTCTTGTCCACATCT SRR7169573 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 04:21:35 Started mapping on | Feb 11 04:21:49 Finished on | Feb 11 06:35:01 Mapping speed, Million of reads per hour | 7.67 Number of input reads | 17038273 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 15830514 Uniquely mapped reads % | 92.91% Average mapped length | 293.81 Number of splices: Total | 14603260 Number of splices: Annotated (sjdb) | 14347388 Number of splices: GT/AG | 14385821 Number of splices: GC/AG | 168775 Number of splices: AT/AC | 13505 Number of splices: Non-canonical | 35159 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.02% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 313795 % of reads mapped to multiple loci | 1.84% Number of reads mapped to too many loci | 15832 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.12% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 914847 914847 914847 N_multimapping 313795 313795 313795 N_noFeature 326183 15635122 418307 N_ambiguous 168899 1452 64486 UnstrandedReadsAssigned:15335432 PositiveStrandReadsAssigned:193940 NegativeStrandReadsAssigned:15347721 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169573 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169573-trimmed-pair1.fastq SRR7169573-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,038,273 reads, 15,281,882 reads pseudoaligned [quant] estimated average fragment length: 251.98 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,062 rounds 52401 SRR7169573.ke.tsv 34699 SRR7169573.se.tsv 87100 total ==> SRR7169573.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1767.02 305 10.5201 Potri.005G024800.1.v4.1 1035 784.02 45 3.49823 Potri.004G059700.1.v4.1 961 710.036 1 0.0858385 Potri.007G009000.2.v4.1 1416 1165.02 0 0 Potri.003G141000.2.v4.1 2943 2692.02 216 4.89033 Potri.016G087400.1.v4.1 270 75.1395 1189.96 965.223 Potri.015G069301.1.v4.1 564 318.044 0 0 Potri.010G195200.1.v4.1 1773 1522.02 28 1.12124 Potri.012G127500.1.v4.1 977 726.025 6722 564.299 ==> SRR7169573.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1606 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 320 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169573 completed mapping pipeline successfully