Starting /dee2/code/volunteer_pipeline.sh SRR7169574 current disk space = 3057019633664 free memory = 1418413600 SRR7169574 SRAfilesize 319338537c994f71578e4e4307ada00f SRR7169574.sra SRR7169574.sra file validated SRR7169574 is paired end SRR7169574 is conventional basespace SRR7169574 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169574_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.869 34.0 33.0 34.0 33.0 34.0 2 33.366 34.0 34.0 34.0 33.0 34.0 3 33.42925 34.0 34.0 34.0 33.0 34.0 4 33.4595 34.0 34.0 34.0 33.0 34.0 5 33.49175 34.0 34.0 34.0 33.0 34.0 6 37.1605 38.0 38.0 38.0 36.0 38.0 7 37.30175 38.0 38.0 38.0 37.0 38.0 8 37.00825 38.0 38.0 38.0 36.0 38.0 9 37.4555 38.0 38.0 38.0 37.0 38.0 10-14 37.49714999999999 38.0 38.0 38.0 37.2 38.0 15-19 37.4909 38.0 38.0 38.0 37.2 38.0 20-24 37.509 38.0 38.0 38.0 37.8 38.0 25-29 37.495050000000006 38.0 38.0 38.0 37.0 38.0 30-34 37.502750000000006 38.0 38.0 38.0 38.0 38.0 35-39 37.33685 38.0 38.0 38.0 36.8 38.0 40-44 37.34425 38.0 38.0 38.0 36.8 38.0 45-49 37.28275 38.0 38.0 38.0 37.0 38.0 50-54 37.29 38.0 38.0 38.0 37.0 38.0 55-59 37.201499999999996 38.0 38.0 38.0 36.4 38.0 60-64 37.1408 38.0 38.0 38.0 36.2 38.0 65-69 37.131899999999995 38.0 38.0 38.0 36.2 38.0 70-74 37.0825 38.0 38.0 38.0 36.0 38.0 75-79 36.99945 38.0 38.0 38.0 36.0 38.0 80-84 36.894549999999995 38.0 38.0 38.0 35.6 38.0 85-89 36.86715 38.0 38.0 38.0 35.4 38.0 90-94 36.7244 38.0 38.0 38.0 35.0 38.0 95-99 36.5899 38.0 38.0 38.0 34.2 38.0 100-104 36.50255 38.0 38.0 38.0 34.0 38.0 105-109 36.3802 38.0 38.0 38.0 34.0 38.0 110-114 36.23675 38.0 38.0 38.0 34.0 38.0 115-119 36.1188 38.0 37.8 38.0 33.4 38.0 120-124 35.9101 38.0 37.2 38.0 33.0 38.0 125-129 35.8067 38.0 37.2 38.0 32.8 38.0 130-134 35.449349999999995 38.0 36.4 38.0 31.0 38.0 135-139 35.13975000000001 38.0 36.0 38.0 29.8 38.0 140-144 34.74625 38.0 35.6 38.0 27.8 38.0 145-149 34.1898 38.0 35.0 38.0 26.4 38.0 150-151 30.5965 36.5 29.5 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 0.0 15 1.0 16 5.0 17 1.0 18 5.0 19 3.0 20 3.0 21 5.0 22 8.0 23 5.0 24 9.0 25 13.0 26 15.0 27 17.0 28 25.0 29 29.0 30 42.0 31 62.0 32 79.0 33 83.0 34 108.0 35 241.0 36 493.0 37 2747.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.6327467482785 15.659270594236164 10.124968120377455 34.58301453710788 2 26.325 14.174999999999999 29.15 30.349999999999998 3 20.7 16.35 24.675 38.275 4 24.125 25.0 22.475 28.4 5 23.724999999999998 28.225 24.0 24.05 6 21.775 33.475 23.75 21.0 7 14.025000000000002 30.2 38.525 17.25 8 18.025 27.35 30.5 24.125 9 16.55 26.125 33.4 23.925 10-14 18.825 30.764999999999997 27.994999999999997 22.415 15-19 20.006000300015 29.411470573528675 26.976348817440872 23.60618030901545 20-24 19.78 29.970000000000002 27.224999999999998 23.025000000000002 25-29 19.705000000000002 29.580000000000002 27.41 23.305 30-34 19.85 29.255 27.075 23.82 35-39 19.97 29.409999999999997 26.605 24.015 40-44 20.025000000000002 29.24 26.91 23.825 45-49 19.86 29.07 26.595000000000002 24.474999999999998 50-54 19.395 29.909999999999997 27.05 23.645 55-59 19.89 29.270000000000003 26.68 24.16 60-64 19.91599579978999 29.24146207310366 27.13135656782839 23.711185559277965 65-69 20.165 29.01 26.8 24.025 70-74 20.235 28.854999999999997 27.13 23.78 75-79 20.265 28.845 26.584999999999997 24.305 80-84 20.325 28.64 27.05 23.985 85-89 20.385 28.485 27.3 23.830000000000002 90-94 20.485 28.92 26.590000000000003 24.005000000000003 95-99 20.235 28.735 26.884999999999998 24.145 100-104 19.91 29.099999999999998 26.805 24.185000000000002 105-109 20.282028202820282 28.637863786378638 27.13271327132713 23.94739473947395 110-114 20.44 28.235 27.224999999999998 24.099999999999998 115-119 20.19 28.884999999999998 26.91 24.015 120-124 20.46 28.84 26.915 23.785 125-129 20.794999999999998 27.994999999999997 26.6 24.610000000000003 130-134 21.044999999999998 28.15 27.185 23.62 135-139 21.15 27.584999999999997 27.275 23.990000000000002 140-144 20.811040552027603 27.91639581979099 26.89134456722836 24.381219060953047 145-149 20.9 27.584999999999997 27.21 24.305 150-151 21.075 28.225 26.2125 24.4875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 2.0 22 1.0 23 0.5 24 2.0 25 5.0 26 6.0 27 9.0 28 16.0 29 19.5 30 20.5 31 26.5 32 37.0 33 47.5 34 63.0 35 78.5 36 87.5 37 108.5 38 128.0 39 143.5 40 170.5 41 196.0 42 231.0 43 254.5 44 250.5 45 245.5 46 246.0 47 247.5 48 239.0 49 209.5 50 172.0 51 144.5 52 127.0 53 111.0 54 92.5 55 68.0 56 50.0 57 38.5 58 21.5 59 14.5 60 14.5 61 11.0 62 7.5 63 5.0 64 6.0 65 6.5 66 3.0 67 1.5 68 2.0 69 3.5 70 3.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.975 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.005 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.005 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.01 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44681921046015 98.875 2 0.5280362081971335 1.05 3 0.025144581342720643 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.425 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.5375 0.0 0.0 0.0 0.0 108-109 0.7 0.0 0.0 0.0 0.0 110-111 0.8125 0.0 0.0 0.0 0.0 112-113 1.0625 0.0 0.0 0.0 0.0 114-115 1.225 0.0 0.0 0.0 0.0 116-117 1.325 0.0 0.0 0.0 0.0 118-119 1.5625 0.0 0.0 0.0 0.0 120-121 1.75 0.0 0.0 0.0 0.0 122-123 1.9249999999999998 0.0 0.0 0.0 0.0 124-125 2.175 0.0 0.0 0.0 0.0 126-127 2.525 0.0 0.0 0.0 0.0 128-129 3.0125 0.0 0.0 0.0 0.0 130-131 3.35 0.0 0.0 0.0 0.0 132-133 3.7249999999999996 0.0 0.0 0.0 0.0 134-135 3.9375 0.0 0.0 0.0 0.0 136-137 4.2625 0.0 0.0 0.0 0.0 138-139 4.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169574 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169574_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.93575 33.0 33.0 34.0 32.0 34.0 2 33.01925 34.0 33.0 34.0 32.0 34.0 3 33.05775 34.0 33.0 34.0 32.0 34.0 4 32.99475 34.0 33.0 34.0 32.0 34.0 5 33.06525 34.0 33.0 34.0 32.0 34.0 6 37.0915 38.0 38.0 38.0 37.0 38.0 7 37.18525 38.0 38.0 38.0 37.0 38.0 8 37.1305 38.0 38.0 38.0 37.0 38.0 9 37.1205 38.0 38.0 38.0 37.0 38.0 10-14 37.109049999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.0893 38.0 38.0 38.0 37.0 38.0 20-24 37.0687 38.0 38.0 38.0 37.0 38.0 25-29 36.9294 38.0 38.0 38.0 36.6 38.0 30-34 36.9122 38.0 38.0 38.0 36.8 38.0 35-39 36.96039999999999 38.0 38.0 38.0 36.4 38.0 40-44 36.9867 38.0 38.0 38.0 36.8 38.0 45-49 36.959199999999996 38.0 38.0 38.0 36.4 38.0 50-54 36.930949999999996 38.0 38.0 38.0 36.2 38.0 55-59 36.9195 38.0 38.0 38.0 36.6 38.0 60-64 36.86560000000001 38.0 38.0 38.0 36.2 38.0 65-69 36.75675 38.0 38.0 38.0 36.0 38.0 70-74 36.691050000000004 38.0 38.0 38.0 35.8 38.0 75-79 36.52380000000001 38.0 38.0 38.0 35.0 38.0 80-84 36.43665 38.0 38.0 38.0 34.6 38.0 85-89 36.3232 38.0 38.0 38.0 34.0 38.0 90-94 36.3207 38.0 38.0 38.0 34.2 38.0 95-99 36.2797 38.0 38.0 38.0 34.0 38.0 100-104 36.110949999999995 38.0 38.0 38.0 33.8 38.0 105-109 36.05455 38.0 38.0 38.0 33.8 38.0 110-114 35.828149999999994 38.0 37.6 38.0 32.6 38.0 115-119 35.69875 38.0 37.2 38.0 32.0 38.0 120-124 35.40065 38.0 37.2 38.0 30.2 38.0 125-129 35.1213 38.0 36.2 38.0 29.2 38.0 130-134 34.736149999999995 38.0 36.0 38.0 27.2 38.0 135-139 34.64965 38.0 35.6 38.0 27.4 38.0 140-144 34.0072 38.0 34.2 38.0 23.8 38.0 145-149 33.49235 38.0 33.6 38.0 21.0 38.0 150-151 28.785249999999998 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 4.0 4 2.0 5 2.0 6 3.0 7 1.0 8 1.0 9 4.0 10 1.0 11 1.0 12 2.0 13 3.0 14 4.0 15 2.0 16 2.0 17 9.0 18 4.0 19 5.0 20 6.0 21 4.0 22 9.0 23 12.0 24 20.0 25 14.0 26 26.0 27 24.0 28 28.0 29 36.0 30 35.0 31 70.0 32 71.0 33 92.0 34 126.0 35 187.0 36 515.0 37 2664.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.47294589178357 22.92084168336673 14.779559118236474 25.826653306613228 2 28.857715430861724 28.2064128256513 26.427855711422843 16.50801603206413 3 22.26953907815631 29.834669338677354 27.429859719438877 20.465931863727455 4 24.04809619238477 32.890781563126254 23.622244488977955 19.438877755511022 5 24.273547094188377 35.19539078156313 22.54509018036072 17.985971943887776 6 23.04609218436874 36.09719438877755 22.294589178356713 18.562124248496996 7 22.26953907815631 22.26953907815631 35.445891783567134 20.01503006012024 8 22.294589178356713 27.630260521042082 25.951903807615228 24.123246492985974 9 22.970941883767534 25.450901803607213 29.70941883767535 21.8687374749499 10-14 24.529058116232466 28.872745490981966 25.501002004008015 21.097194388777556 15-19 24.4188376753507 27.81563126252505 26.34769539078156 21.417835671342687 20-24 23.832665330661325 28.2064128256513 26.993987975951907 20.96693386773547 25-29 24.008016032064127 28.21142284569138 26.973947895791582 20.806613226452907 30-34 23.842685370741485 28.371743486973948 26.908817635270545 20.87675350701403 35-39 23.96793587174349 28.341683366733466 26.63827655310621 21.052104208416832 40-44 24.27476326469262 28.117641164386992 26.694724184578384 20.912871386342 45-49 24.504008016032063 27.665330661322646 27.219438877755508 20.61122244488978 50-54 23.582164328657313 28.166332665330664 26.908817635270545 21.34268537074148 55-59 23.96793587174349 28.101202404809616 27.349699398797593 20.5811623246493 60-64 24.043086172344687 28.251503006012022 27.18937875751503 20.516032064128257 65-69 24.343687374749496 27.750501002004007 27.374749498997996 20.531062124248496 70-74 24.433867735470944 27.349699398797593 27.61523046092184 20.60120240480962 75-79 24.19839679358717 27.51503006012024 27.605210420841686 20.681362725450903 80-84 23.992985971943888 27.86573146292585 27.550100200400802 20.59118236472946 85-89 24.584168336673347 26.973947895791582 27.860721442885772 20.5811623246493 90-94 24.293587174348698 27.23446893787575 27.76553106212425 20.706412825651302 95-99 24.13188354963171 27.669489402214765 27.514155434183497 20.684471613970036 100-104 24.808376333851008 26.972596563298435 27.954511297029207 20.26451580582135 105-109 24.784569138276552 27.384769539078157 27.404809619238478 20.425851703406813 110-114 24.40881763527054 27.284569138276556 28.161322645290582 20.145290581162325 115-119 25.100200400801604 27.640280561122243 27.364729458917836 19.894789579158317 120-124 24.794589178356713 26.748496993987974 27.90581162324649 20.551102204408817 125-129 24.51147409560076 27.587934662791863 27.70818719310552 20.192404048501857 130-134 24.98997995991984 26.918837675350705 27.900801603206414 20.19038076152305 135-139 24.961170399318604 27.83205571421414 27.20076156120046 20.0060123252668 140-144 24.759519038076153 27.790581162324653 27.214428857715433 20.23547094188377 145-149 24.769539078156313 27.660320641282567 27.329659318637272 20.240480961923847 150-151 24.458359423919852 27.90231684408265 27.827175954915468 19.81214777708203 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 8.0 1 4.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 1.5 27 1.5 28 2.0 29 5.5 30 5.0 31 6.5 32 15.5 33 23.5 34 33.5 35 47.5 36 70.0 37 82.0 38 106.5 39 143.0 40 174.5 41 207.5 42 241.0 43 272.5 44 282.0 45 288.0 46 292.5 47 286.5 48 261.5 49 221.5 50 194.5 51 163.0 52 132.5 53 108.0 54 80.5 55 65.0 56 51.0 57 34.5 58 22.5 59 20.0 60 15.0 61 8.5 62 5.0 63 2.5 64 4.5 65 5.0 66 2.5 67 1.0 68 1.5 69 1.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.2 3 0.2 4 0.2 5 0.2 6 0.2 7 0.2 8 0.2 9 0.2 10-14 0.2 15-19 0.2 20-24 0.2 25-29 0.2 30-34 0.2 35-39 0.2 40-44 0.20500000000000002 45-49 0.2 50-54 0.2 55-59 0.2 60-64 0.2 65-69 0.2 70-74 0.2 75-79 0.2 80-84 0.2 85-89 0.2 90-94 0.2 95-99 0.215 100-104 0.19499999999999998 105-109 0.2 110-114 0.2 115-119 0.2 120-124 0.2 125-129 0.21 130-134 0.2 135-139 0.20500000000000002 140-144 0.2 145-149 0.2 150-151 0.1875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49647532729104 98.8 2 0.42799597180261834 0.8500000000000001 3 0.050352467270896276 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025176233635448138 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 8 0.2 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.5125 0.0 0.0 0.0 0.0 108-109 0.675 0.0 0.0 0.0 0.0 110-111 0.7875 0.0 0.0 0.0 0.0 112-113 1.0375 0.0 0.0 0.0 0.0 114-115 1.2 0.0 0.0 0.0 0.0 116-117 1.325 0.0 0.0 0.0 0.0 118-119 1.525 0.0 0.0 0.0 0.0 120-121 1.7000000000000002 0.0 0.0 0.0 0.0 122-123 1.85 0.0 0.0 0.0 0.0 124-125 2.025 0.0 0.0 0.0 0.0 126-127 2.375 0.0 0.0 0.0 0.0 128-129 2.8625 0.0 0.0 0.0 0.0 130-131 3.2125000000000004 0.0 0.0 0.0 0.0 132-133 3.6125 0.0 0.0 0.0 0.0 134-135 3.8375 0.0 0.0 0.0 0.0 136-137 4.1625 0.0 0.0 0.0 0.0 138-139 4.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 95 5.161005E-4 12.210526 50-54 >>END_MODULE Read 1524041 spots for SRR7169574.sra Written 1524041 spots for SRR7169574.sra Read 1524041 spots for SRR7169574.sra Written 1524041 spots for SRR7169574.sra Read 1524041 spots for SRR7169574.sra Written 1524041 spots for SRR7169574.sra Read 1524041 spots for SRR7169574.sra Written 1524041 spots for SRR7169574.sra Read 1524041 spots for SRR7169574.sra Written 1524041 spots for SRR7169574.sra Read 1524041 spots for SRR7169574.sra Written 1524041 spots for SRR7169574.sra Read 1524041 spots for SRR7169574.sra Written 1524041 spots for SRR7169574.sra Read 1524041 spots for SRR7169574.sra Written 1524041 spots for SRR7169574.sra Read 1524041 spots for SRR7169574.sra Written 1524041 spots for SRR7169574.sra Read 1524041 spots for SRR7169574.sra Written 1524041 spots for SRR7169574.sra Read 1524041 spots for SRR7169574.sra Written 1524041 spots for SRR7169574.sra Read 1524041 spots for SRR7169574.sra Written 1524041 spots for SRR7169574.sra Read 1524041 spots for SRR7169574.sra Written 1524041 spots for SRR7169574.sra Read 1524041 spots for SRR7169574.sra Written 1524041 spots for SRR7169574.sra Read 1524041 spots for SRR7169574.sra Written 1524041 spots for SRR7169574.sra Read 1524051 spots for SRR7169574.sra Written 1524051 spots for SRR7169574.sra Read 1524041 spots for SRR7169574.sra Written 1524041 spots for SRR7169574.sra Read 1524041 spots for SRR7169574.sra Written 1524041 spots for SRR7169574.sra Read 1524041 spots for SRR7169574.sra Written 1524041 spots for SRR7169574.sra Read 1524041 spots for SRR7169574.sra Written 1524041 spots for SRR7169574.sra SRR ids: ['SRR7169574.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3u_40nk3 SRR7169574.sra spots: 30480830 blocks: [[1, 1524041], [1524042, 3048082], [3048083, 4572123], [4572124, 6096164], [6096165, 7620205], [7620206, 9144246], [9144247, 10668287], [10668288, 12192328], [12192329, 13716369], [13716370, 15240410], [15240411, 16764451], [16764452, 18288492], [18288493, 19812533], [19812534, 21336574], [21336575, 22860615], [22860616, 24384656], [24384657, 25908697], [25908698, 27432738], [27432739, 28956779], [28956780, 30480830]] SRR7169574 file size 10307252 SRR7169574 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169574 SRR7169574_1.fastq SRR7169574_2.fastq Input file: SRR7169574_1.fastq Paired file: SRR7169574_2.fastq trimmed: SRR7169574-trimmed-pair1.fastq, SRR7169574-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 03:05:36 2025 >> started Tue Feb 11 03:15:05 2025 >> done (568.971s) 30480830 read pairs processed; of these: 40144 ( 0.13%) short read pairs filtered out after trimming by size control 126348 ( 0.41%) empty read pairs filtered out after trimming by size control 30314338 (99.45%) read pairs available; of these: 14112197 (46.55%) trimmed read pairs available after processing 16202141 (53.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 11 0.00% 20 10 0.00% 21 14 0.00% 22 17 0.00% 23 11 0.00% 24 13 0.00% 25 19 0.00% 26 16 0.00% 27 23 0.00% 28 13 0.00% 29 20 0.00% 30 23 0.00% 31 14 0.00% 32 16 0.00% 33 19 0.00% 34 19 0.00% 35 19 0.00% 36 23 0.00% 37 23 0.00% 38 30 0.00% 39 47 0.00% 40 51 0.00% 41 45 0.00% 42 55 0.00% 43 58 0.00% 44 60 0.00% 45 61 0.00% 46 71 0.00% 47 73 0.00% 48 89 0.00% 49 90 0.00% 50 110 0.00% 51 122 0.00% 52 136 0.00% 53 125 0.00% 54 153 0.00% 55 166 0.00% 56 186 0.00% 57 208 0.00% 58 233 0.00% 59 278 0.00% 60 250 0.00% 61 328 0.00% 62 344 0.00% 63 413 0.00% 64 466 0.00% 65 490 0.00% 66 639 0.00% 67 875 0.00% 68 1432 0.00% 69 3758 0.01% 70 3032 0.01% 71 1464 0.00% 72 1268 0.00% 73 1325 0.00% 74 1392 0.00% 75 1546 0.01% 76 1603 0.01% 77 1894 0.01% 78 1999 0.01% 79 2290 0.01% 80 2564 0.01% 81 2920 0.01% 82 3383 0.01% 83 3909 0.01% 84 5657 0.02% 85 6861 0.02% 86 7258 0.02% 87 7874 0.03% 88 8405 0.03% 89 8879 0.03% 90 9526 0.03% 91 9870 0.03% 92 10691 0.04% 93 11700 0.04% 94 12197 0.04% 95 13433 0.04% 96 14109 0.05% 97 15405 0.05% 98 16124 0.05% 99 16394 0.05% 100 17906 0.06% 101 19138 0.06% 102 20341 0.07% 103 21596 0.07% 104 22787 0.08% 105 24593 0.08% 106 26262 0.09% 107 27179 0.09% 108 28491 0.09% 109 30065 0.10% 110 31266 0.10% 111 32606 0.11% 112 34881 0.12% 113 37273 0.12% 114 38795 0.13% 115 41294 0.14% 116 43278 0.14% 117 45315 0.15% 118 47204 0.16% 119 48808 0.16% 120 50458 0.17% 121 53310 0.18% 122 55747 0.18% 123 59415 0.20% 124 62370 0.21% 125 65955 0.22% 126 68802 0.23% 127 72520 0.24% 128 75363 0.25% 129 79060 0.26% 130 83422 0.28% 131 87988 0.29% 132 93030 0.31% 133 98432 0.32% 134 104778 0.35% 135 113373 0.37% 136 119974 0.40% 137 128570 0.42% 138 138426 0.46% 139 149424 0.49% 140 160757 0.53% 141 176187 0.58% 142 193736 0.64% 143 217842 0.72% 144 251253 0.83% 145 294247 0.97% 146 360671 1.19% 147 485435 1.60% 148 737957 2.43% 149 1516426 5.00% 150 7101448 23.43% 151 16202141 53.45% 30314338 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=14.33 fanout-score-rank=16 prefix-density=0.38 prefix-fanout=6.2 sequence=GGTGCTGGTGCTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=46 fanout-score=119.33 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=10.5 sequence=AAGAAGGAATAGAGAAAATTAACAATAGGGCTCCAATCCTTGTATTTTTTTTATTACAATACCAAAGATCACACGTACCAACAGACATGGTCTGAGCAAACTCATAGCAGCCAAACAAAAACACAAAAGGAAGTACACTTCCTACTATCAGTACTCATCTCCTTCATCACCATCCTCTCCATCGGGAGATTCAGCCCCAACCTCCTCATAATCCTTCTCCAGGGCAGCAAGATCCTCACGAGCCTCTGAGAACTCTCCTTCCTCCATACCCTCGCCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=7.34 fanout-score-rank=19 prefix-density=0.35 prefix-fanout=3.6 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.03 sequence-density-rank=42 fanout-score=173.86 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=14.0 sequence=AGAAAGAAATGAGAATTCTCATGGTGGGTCTTGATGCTGCTGGTAAGACCACCATCTTGTACAAGCTCAA SRR7169574 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 03:50:21 Started mapping on | Feb 11 03:50:24 Finished on | Feb 11 04:49:50 Mapping speed, Million of reads per hour | 30.60 Number of input reads | 30314338 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 28704912 Uniquely mapped reads % | 94.69% Average mapped length | 295.00 Number of splices: Total | 24939909 Number of splices: Annotated (sjdb) | 24516484 Number of splices: GT/AG | 24568553 Number of splices: GC/AG | 290226 Number of splices: AT/AC | 21463 Number of splices: Non-canonical | 59667 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 565421 % of reads mapped to multiple loci | 1.87% Number of reads mapped to too many loci | 47935 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.24% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1075800 1075800 1075800 N_multimapping 565421 565421 565421 N_noFeature 568313 28341632 718464 N_ambiguous 335220 2277 120383 UnstrandedReadsAssigned:27801379 PositiveStrandReadsAssigned:361003 NegativeStrandReadsAssigned:27866065 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169574 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169574-trimmed-pair1.fastq SRR7169574-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,314,338 reads, 27,749,521 reads pseudoaligned [quant] estimated average fragment length: 243.414 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,071 rounds 52401 SRR7169574.ke.tsv 34699 SRR7169574.se.tsv 87100 total ==> SRR7169574.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1775.59 487 8.28132 Potri.005G024800.1.v4.1 1035 792.586 80 3.04759 Potri.004G059700.1.v4.1 961 718.595 4 0.168069 Potri.007G009000.2.v4.1 1416 1173.59 0 0 Potri.003G141000.2.v4.1 2943 2700.59 413 4.61747 Potri.016G087400.1.v4.1 270 74.2638 2789.03 1133.94 Potri.015G069301.1.v4.1 564 324.508 0 0 Potri.010G195200.1.v4.1 1773 1530.59 103 2.03185 Potri.012G127500.1.v4.1 977 734.586 14618 600.838 ==> SRR7169574.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3655 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 580 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 34 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169574 completed mapping pipeline successfully