Starting /dee2/code/volunteer_pipeline.sh SRR7169575 current disk space = 3056978923520 free memory = 1266767012 SRR7169575 SRAfilesize 8418fef52238c40e2e39f2ab23aa106e SRR7169575.sra SRR7169575.sra file validated SRR7169575 is paired end SRR7169575 is conventional basespace SRR7169575 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169575_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.13675 34.0 33.0 34.0 33.0 34.0 2 33.43075 34.0 34.0 34.0 33.0 34.0 3 33.5145 34.0 34.0 34.0 33.0 34.0 4 33.434 34.0 34.0 34.0 33.0 34.0 5 33.462 34.0 34.0 34.0 33.0 34.0 6 37.09575 38.0 37.0 38.0 36.0 38.0 7 37.3495 38.0 38.0 38.0 37.0 38.0 8 37.41225 38.0 38.0 38.0 37.0 38.0 9 37.4935 38.0 38.0 38.0 37.0 38.0 10-14 37.51345 38.0 38.0 38.0 37.6 38.0 15-19 37.491400000000006 38.0 38.0 38.0 37.2 38.0 20-24 37.52329999999999 38.0 38.0 38.0 37.6 38.0 25-29 37.5129 38.0 38.0 38.0 37.8 38.0 30-34 37.48825000000001 38.0 38.0 38.0 37.6 38.0 35-39 37.39205 38.0 38.0 38.0 37.0 38.0 40-44 37.34205 38.0 38.0 38.0 37.0 38.0 45-49 37.233999999999995 38.0 38.0 38.0 36.6 38.0 50-54 37.2377 38.0 38.0 38.0 36.8 38.0 55-59 37.14975 38.0 38.0 38.0 36.0 38.0 60-64 37.12765 38.0 38.0 38.0 36.0 38.0 65-69 37.07705 38.0 38.0 38.0 36.0 38.0 70-74 36.998850000000004 38.0 38.0 38.0 36.0 38.0 75-79 36.99735 38.0 38.0 38.0 36.0 38.0 80-84 36.946450000000006 38.0 38.0 38.0 35.8 38.0 85-89 36.95405 38.0 38.0 38.0 35.8 38.0 90-94 36.8128 38.0 38.0 38.0 35.2 38.0 95-99 36.654900000000005 38.0 38.0 38.0 34.2 38.0 100-104 36.425050000000006 38.0 38.0 38.0 34.0 38.0 105-109 36.40495000000001 38.0 38.0 38.0 34.0 38.0 110-114 36.3372 38.0 37.8 38.0 34.0 38.0 115-119 36.114 38.0 37.2 38.0 33.4 38.0 120-124 35.9069 38.0 37.0 38.0 33.0 38.0 125-129 35.88135 38.0 37.0 38.0 32.6 38.0 130-134 35.716150000000006 38.0 36.2 38.0 31.6 38.0 135-139 35.489850000000004 38.0 36.0 38.0 31.2 38.0 140-144 35.12179999999999 38.0 36.0 38.0 29.6 38.0 145-149 34.6012 38.0 35.0 38.0 27.8 38.0 150-151 31.39425 36.5 31.5 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 1.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.0 17 3.0 18 0.0 19 2.0 20 2.0 21 6.0 22 6.0 23 6.0 24 8.0 25 7.0 26 14.0 27 16.0 28 24.0 29 35.0 30 36.0 31 50.0 32 66.0 33 94.0 34 114.0 35 214.0 36 600.0 37 2693.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.710453049860796 12.148823082763856 8.301695773221969 35.83902809415338 2 24.4 14.899999999999999 31.75 28.95 3 20.225 18.425 25.85 35.5 4 23.025000000000002 26.6 23.7 26.674999999999997 5 21.975 31.900000000000002 24.224999999999998 21.9 6 20.075000000000003 33.800000000000004 24.224999999999998 21.9 7 14.075 27.750000000000004 39.95 18.224999999999998 8 18.175 27.150000000000002 30.075000000000003 24.6 9 17.25 24.9 33.324999999999996 24.525 10-14 19.985 30.385 27.089999999999996 22.54 15-19 20.345 29.15 26.895000000000003 23.61 20-24 20.025000000000002 28.265 27.73 23.98 25-29 20.125 29.445 26.755000000000003 23.674999999999997 30-34 19.97 29.310000000000002 26.875 23.845 35-39 19.865 28.615000000000002 27.145000000000003 24.375 40-44 20.365 28.87 27.1 23.665 45-49 20.65 28.615000000000002 26.93 23.805 50-54 20.41 28.42 27.034999999999997 24.135 55-59 19.895 28.799999999999997 26.919999999999998 24.385 60-64 20.185 28.37 27.794999999999998 23.65 65-69 19.895 28.875 27.715 23.515 70-74 20.380000000000003 28.825 26.950000000000003 23.845 75-79 20.405 28.915000000000003 26.695 23.985 80-84 20.419999999999998 29.04 27.08 23.46 85-89 20.34 28.595 27.189999999999998 23.875 90-94 20.51 28.615000000000002 26.674999999999997 24.2 95-99 20.495 27.915 27.650000000000002 23.94 100-104 20.935000000000002 28.199999999999996 27.389999999999997 23.474999999999998 105-109 21.035 27.36 27.689999999999998 23.915 110-114 20.705000000000002 28.560000000000002 27.084999999999997 23.65 115-119 20.39 27.97 27.85 23.79 120-124 20.7 27.779999999999998 27.485 24.035 125-129 21.05 27.415 27.62 23.915 130-134 21.33 28.000000000000004 26.979999999999997 23.69 135-139 21.035 27.625 27.49 23.849999999999998 140-144 20.669999999999998 28.18 27.345000000000002 23.805 145-149 21.135 28.26 26.685 23.919999999999998 150-151 21.1375 28.7 25.624999999999996 24.5375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 3.0 25 4.0 26 4.5 27 5.5 28 8.0 29 11.0 30 14.5 31 18.5 32 24.5 33 36.0 34 47.5 35 66.5 36 77.0 37 99.0 38 135.5 39 163.0 40 198.0 41 211.0 42 228.0 43 236.0 44 247.0 45 274.0 46 263.0 47 255.5 48 250.0 49 223.0 50 186.0 51 158.5 52 131.5 53 102.5 54 79.5 55 60.0 56 45.5 57 31.0 58 25.5 59 21.5 60 16.5 61 11.0 62 5.0 63 3.0 64 3.0 65 3.0 66 3.0 67 2.0 68 2.0 69 1.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.225 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.025 0.0 0.0 0.0 2 0.0 0.025 0.0 0.0 0.0 3 0.0 0.025 0.0 0.0 0.0 4 0.0 0.025 0.0 0.0 0.0 5 0.0 0.025 0.0 0.0 0.0 6 0.0 0.025 0.0 0.0 0.0 7 0.0 0.025 0.0 0.0 0.0 8 0.0 0.025 0.0 0.0 0.0 9 0.0 0.025 0.0 0.0 0.0 10-11 0.0 0.025 0.0 0.0 0.0 12-13 0.0 0.025 0.0 0.0 0.0 14-15 0.0 0.025 0.0 0.0 0.0 16-17 0.0 0.025 0.0 0.0 0.0 18-19 0.0 0.025 0.0 0.0 0.0 20-21 0.0 0.025 0.0 0.0 0.0 22-23 0.0 0.025 0.0 0.0 0.0 24-25 0.0 0.025 0.0 0.0 0.0 26-27 0.0 0.025 0.0 0.0 0.0 28-29 0.0 0.025 0.0 0.0 0.0 30-31 0.0 0.025 0.0 0.0 0.0 32-33 0.0 0.025 0.0 0.0 0.0 34-35 0.0 0.025 0.0 0.0 0.0 36-37 0.0 0.025 0.0 0.0 0.0 38-39 0.0 0.025 0.0 0.0 0.0 40-41 0.0 0.025 0.0 0.0 0.0 42-43 0.0 0.025 0.0 0.0 0.0 44-45 0.0 0.025 0.0 0.0 0.0 46-47 0.0 0.025 0.0 0.0 0.0 48-49 0.0 0.025 0.0 0.0 0.0 50-51 0.0 0.025 0.0 0.0 0.0 52-53 0.0 0.025 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0 0.025 0.0 0.0 0.0 62-63 0.0 0.025 0.0 0.0 0.0 64-65 0.0 0.025 0.0 0.0 0.0 66-67 0.0 0.025 0.0 0.0 0.0 68-69 0.0 0.025 0.0 0.0 0.0 70-71 0.0 0.025 0.0 0.0 0.0 72-73 0.0 0.025 0.0 0.0 0.0 74-75 0.0125 0.025 0.0 0.0 0.0 76-77 0.0625 0.025 0.0 0.0 0.0 78-79 0.075 0.025 0.0 0.0 0.0 80-81 0.075 0.025 0.0 0.0 0.0 82-83 0.075 0.025 0.0 0.0 0.0 84-85 0.1 0.025 0.0 0.0 0.0 86-87 0.125 0.025 0.0 0.0 0.0 88-89 0.1875 0.025 0.0 0.0 0.0 90-91 0.21250000000000002 0.025 0.0 0.0 0.0 92-93 0.275 0.025 0.0 0.0 0.0 94-95 0.325 0.025 0.0 0.0 0.0 96-97 0.325 0.025 0.0 0.0 0.0 98-99 0.4 0.025 0.0 0.0 0.0 100-101 0.48750000000000004 0.025 0.0 0.0 0.0 102-103 0.575 0.025 0.0 0.0 0.0 104-105 0.65 0.025 0.0 0.0 0.0 106-107 0.7124999999999999 0.025 0.0 0.0 0.0 108-109 0.7625 0.025 0.0 0.0 0.0 110-111 0.875 0.025 0.0 0.0 0.0 112-113 0.975 0.025 0.0 0.0 0.0 114-115 1.125 0.025 0.0 0.0 0.0 116-117 1.1875 0.025 0.0 0.0 0.0 118-119 1.35 0.025 0.0 0.0 0.0 120-121 1.55 0.025 0.0 0.0 0.0 122-123 1.8375 0.025 0.0 0.0 0.0 124-125 2.0875000000000004 0.025 0.0 0.0 0.0 126-127 2.3875 0.025 0.0 0.0 0.0 128-129 2.55 0.025 0.0 0.0 0.0 130-131 2.7 0.025 0.0 0.0 0.0 132-133 2.9375 0.025 0.0 0.0 0.0 134-135 3.3125 0.025 0.0 0.0 0.0 136-137 3.675 0.025 0.0 0.0 0.0 138-139 4.0625 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATGTTG 10 0.006832588 144.9875 2 ATTGCAT 10 0.006832588 144.9875 5 >>END_MODULE SRR7169575 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169575_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82775 33.0 33.0 34.0 32.0 34.0 2 32.965 33.0 33.0 34.0 32.0 34.0 3 32.958 34.0 33.0 34.0 32.0 34.0 4 32.92625 34.0 33.0 34.0 32.0 34.0 5 32.9885 34.0 33.0 34.0 32.0 34.0 6 37.15175 38.0 38.0 38.0 37.0 38.0 7 37.21775 38.0 38.0 38.0 37.0 38.0 8 37.102 38.0 38.0 38.0 37.0 38.0 9 37.1035 38.0 38.0 38.0 37.0 38.0 10-14 37.138000000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.11185 38.0 38.0 38.0 37.0 38.0 20-24 37.0294 38.0 38.0 38.0 37.0 38.0 25-29 36.977199999999996 38.0 38.0 38.0 36.6 38.0 30-34 36.8848 38.0 38.0 38.0 36.0 38.0 35-39 36.94765 38.0 38.0 38.0 36.6 38.0 40-44 37.018299999999996 38.0 38.0 38.0 36.8 38.0 45-49 37.05135 38.0 38.0 38.0 36.6 38.0 50-54 37.01685 38.0 38.0 38.0 36.6 38.0 55-59 37.0124 38.0 38.0 38.0 36.4 38.0 60-64 36.9105 38.0 38.0 38.0 36.0 38.0 65-69 36.8433 38.0 38.0 38.0 36.0 38.0 70-74 36.79975 38.0 38.0 38.0 36.0 38.0 75-79 36.736599999999996 38.0 38.0 38.0 35.8 38.0 80-84 36.53575000000001 38.0 38.0 38.0 35.0 38.0 85-89 36.57185 38.0 38.0 38.0 34.8 38.0 90-94 36.4497 38.0 38.0 38.0 34.2 38.0 95-99 36.421099999999996 38.0 38.0 38.0 34.2 38.0 100-104 36.31230000000001 38.0 38.0 38.0 34.0 38.0 105-109 36.26185 38.0 38.0 38.0 34.0 38.0 110-114 36.07665 38.0 38.0 38.0 33.8 38.0 115-119 35.9199 38.0 38.0 38.0 33.2 38.0 120-124 35.65115 38.0 37.0 38.0 31.8 38.0 125-129 35.3779 38.0 36.4 38.0 31.0 38.0 130-134 35.176300000000005 38.0 36.0 38.0 30.0 38.0 135-139 34.9961 38.0 36.0 38.0 28.4 38.0 140-144 34.522000000000006 38.0 35.4 38.0 27.4 38.0 145-149 34.07715 38.0 35.0 38.0 25.8 38.0 150-151 30.330750000000002 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 0.0 4 2.0 5 0.0 6 1.0 7 0.0 8 2.0 9 0.0 10 0.0 11 2.0 12 3.0 13 4.0 14 2.0 15 1.0 16 3.0 17 6.0 18 3.0 19 2.0 20 2.0 21 10.0 22 14.0 23 9.0 24 14.0 25 9.0 26 19.0 27 19.0 28 26.0 29 29.0 30 44.0 31 43.0 32 58.0 33 98.0 34 134.0 35 223.0 36 504.0 37 2698.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.17396745932415 24.705882352941178 12.665832290362955 23.454317897371716 2 30.64596895343015 25.81372058087131 26.114171256885328 17.426139208813222 3 20.99198396793587 28.306613226452903 31.613226452905813 19.08817635270541 4 22.13319979969955 34.376564847270906 23.760640961442164 19.729594391587383 5 24.86229344016024 33.50025037556335 22.8092138207311 18.828242363545318 6 21.618236472945892 37.399799599198396 21.64328657314629 19.338677354709418 7 20.932564552519427 21.96039107545751 37.80396089245425 19.303083479568812 8 22.11080471296064 25.846076710955128 25.89621459012284 26.146903985961394 9 22.236149410879918 24.868388067184757 29.43093507144648 23.464527450488845 10-14 23.532064128256515 28.121242484969937 26.492985971943888 21.85370741482966 15-19 23.555043574075928 28.152859861765002 26.90073124311329 21.39136532104578 20-24 23.18179539872688 28.49982457019698 27.20665630795449 21.11172372312165 25-29 23.561259274112693 28.26849809504712 26.779627030278725 21.39061560056146 30-34 24.018036072144287 27.990981963927858 26.753507014028056 21.2374749498998 35-39 23.167919799498744 28.37092731829574 27.358395989974937 21.102756892230577 40-44 23.073451992980697 27.856605665580346 27.620957633492104 21.448984707946853 45-49 22.97087281295433 28.09946357848298 27.056700255677548 21.872963352885147 50-54 22.995939238983308 28.01423772998446 27.638241339549808 21.35158169148243 55-59 23.6909355113494 27.704564814350853 27.218519817607856 21.385979856691886 60-64 23.926011328888666 27.685598275602786 27.97132688355306 20.417063511955487 65-69 23.741728494084622 27.486464808502102 27.757168638459994 21.014638058953278 70-74 23.34302617066078 27.409004311641432 27.3638824827033 21.884087034994483 75-79 23.805465028829282 27.24993732765104 27.570819754324393 21.373777889195285 80-84 23.43326982853705 27.68474882181891 27.985561014739798 20.896420334904242 85-89 23.19995988768552 27.371640593662256 27.93822703569996 21.490172482952268 90-94 23.504937590856684 27.600380971477268 28.00641636172239 20.888265075943657 95-99 23.832431348967727 27.335137302064545 27.83122870314692 21.001202645820804 100-104 23.834820086198256 27.578430389896763 27.35792322341385 21.22882630049113 105-109 23.798305849330863 27.341987870282193 27.78306851786878 21.076637762518168 110-114 24.500025061400432 26.99614054433362 27.517417673299583 20.986416720966368 115-119 24.12531328320802 27.518796992481203 27.79949874686717 20.55639097744361 120-124 24.61646445402587 27.42404492128748 27.348841873057257 20.610648751629398 125-129 24.141388819252946 27.505640511406366 27.35522687390323 20.997743795437454 130-134 24.707888270397675 27.10495963091119 27.581365026829147 20.605787071861993 135-139 24.141388819252946 27.550764602657306 27.59588869390825 20.711957884181498 140-144 24.29559811491026 27.724857114208362 27.724857114208362 20.254687656673017 145-149 25.10779103579665 27.308733580667806 27.414017848190113 20.169457535345433 150-151 24.18325197146076 28.063587432719988 27.42520966328702 20.327950932532232 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 4.0 1 2.0 2 0.5 3 0.5 4 0.0 5 0.5 6 1.0 7 0.5 8 0.5 9 1.0 10 0.5 11 0.5 12 1.5 13 1.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 0.5 25 1.0 26 1.0 27 1.5 28 2.0 29 3.5 30 7.0 31 9.5 32 11.5 33 20.5 34 30.0 35 42.5 36 58.5 37 88.0 38 134.5 39 162.0 40 174.5 41 211.5 42 256.5 43 275.0 44 283.5 45 289.5 46 286.0 47 278.0 48 267.0 49 234.0 50 184.0 51 148.5 52 129.0 53 102.5 54 70.0 55 53.5 56 50.0 57 38.0 58 24.0 59 18.0 60 10.0 61 5.0 62 4.5 63 2.5 64 1.5 65 4.0 66 4.0 67 2.5 68 1.5 69 1.0 70 1.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.15 3 0.2 4 0.15 5 0.15 6 0.2 7 0.27499999999999997 8 0.27499999999999997 9 0.27499999999999997 10-14 0.2 15-19 0.16999999999999998 20-24 0.245 25-29 0.26 30-34 0.2 35-39 0.25 40-44 0.27499999999999997 45-49 0.265 50-54 0.265 55-59 0.215 60-64 0.255 65-69 0.26 70-74 0.27 75-79 0.27499999999999997 80-84 0.27 85-89 0.27999999999999997 90-94 0.255 95-99 0.22 100-104 0.22999999999999998 105-109 0.245 110-114 0.245 115-119 0.25 120-124 0.27 125-129 0.27499999999999997 130-134 0.295 135-139 0.27499999999999997 140-144 0.27 145-149 0.27 150-151 0.13749999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49723479135244 98.95 2 0.47762694821518353 0.95 3 0.0 0.0 4 0.025138260432378077 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.525 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.6625000000000001 0.0 0.0 0.0 0.0 108-109 0.7125 0.0 0.0 0.0 0.0 110-111 0.825 0.0 0.0 0.0 0.0 112-113 0.925 0.0 0.0 0.0 0.0 114-115 1.075 0.0 0.0 0.0 0.0 116-117 1.1375 0.0 0.0 0.0 0.0 118-119 1.3 0.0 0.0 0.0 0.0 120-121 1.5 0.0 0.0 0.0 0.0 122-123 1.7875 0.0 0.0 0.0 0.0 124-125 2.0125 0.0 0.0 0.0 0.0 126-127 2.325 0.0 0.0 0.0 0.0 128-129 2.5 0.0 0.0 0.0 0.0 130-131 2.6625 0.0 0.0 0.0 0.0 132-133 2.875 0.0 0.0 0.0 0.0 134-135 3.2125000000000004 0.0 0.0 0.0 0.0 136-137 3.55 0.0 0.0 0.0 0.0 138-139 3.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 998579 spots for SRR7169575.sra Written 998579 spots for SRR7169575.sra Read 998579 spots for SRR7169575.sra Written 998579 spots for SRR7169575.sra Read 998579 spots for SRR7169575.sra Written 998579 spots for SRR7169575.sra Read 998579 spots for SRR7169575.sra Written 998579 spots for SRR7169575.sra Read 998579 spots for SRR7169575.sra Written 998579 spots for SRR7169575.sra Read 998579 spots for SRR7169575.sra Written 998579 spots for SRR7169575.sra Read 998579 spots for SRR7169575.sra Written 998579 spots for SRR7169575.sra Read 998579 spots for SRR7169575.sra Written 998579 spots for SRR7169575.sra Read 998579 spots for SRR7169575.sra Written 998579 spots for SRR7169575.sra Read 998579 spots for SRR7169575.sra Written 998579 spots for SRR7169575.sra Read 998579 spots for SRR7169575.sra Written 998579 spots for SRR7169575.sra Read 998579 spots for SRR7169575.sra Written 998579 spots for SRR7169575.sra Read 998579 spots for SRR7169575.sra Written 998579 spots for SRR7169575.sra Read 998579 spots for SRR7169575.sra Written 998579 spots for SRR7169575.sra Read 998579 spots for SRR7169575.sra Written 998579 spots for SRR7169575.sra Read 998579 spots for SRR7169575.sra Written 998579 spots for SRR7169575.sra Read 998589 spots for SRR7169575.sra Written 998589 spots for SRR7169575.sra Read 998579 spots for SRR7169575.sra Written 998579 spots for SRR7169575.sra Read 998579 spots for SRR7169575.sra Written 998579 spots for SRR7169575.sra Read 998579 spots for SRR7169575.sra Written 998579 spots for SRR7169575.sra SRR ids: ['SRR7169575.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_85bfmuit SRR7169575.sra spots: 19971590 blocks: [[1, 998579], [998580, 1997158], [1997159, 2995737], [2995738, 3994316], [3994317, 4992895], [4992896, 5991474], [5991475, 6990053], [6990054, 7988632], [7988633, 8987211], [8987212, 9985790], [9985791, 10984369], [10984370, 11982948], [11982949, 12981527], [12981528, 13980106], [13980107, 14978685], [14978686, 15977264], [15977265, 16975843], [16975844, 17974422], [17974423, 18973001], [18973002, 19971590]] SRR7169575 file size 6746016 SRR7169575 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169575 SRR7169575_1.fastq SRR7169575_2.fastq Input file: SRR7169575_1.fastq Paired file: SRR7169575_2.fastq trimmed: SRR7169575-trimmed-pair1.fastq, SRR7169575-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 03:12:18 2025 >> started Tue Feb 11 03:26:25 2025 >> done (846.803s) 19971590 read pairs processed; of these: 24649 ( 0.12%) short read pairs filtered out after trimming by size control 58258 ( 0.29%) empty read pairs filtered out after trimming by size control 19888683 (99.58%) read pairs available; of these: 9650818 (48.52%) trimmed read pairs available after processing 10237865 (51.48%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 5 0.00% 20 5 0.00% 21 3 0.00% 22 11 0.00% 23 4 0.00% 24 10 0.00% 25 10 0.00% 26 10 0.00% 27 12 0.00% 28 15 0.00% 29 10 0.00% 30 8 0.00% 31 16 0.00% 32 15 0.00% 33 14 0.00% 34 20 0.00% 35 9 0.00% 36 15 0.00% 37 21 0.00% 38 23 0.00% 39 25 0.00% 40 23 0.00% 41 27 0.00% 42 19 0.00% 43 31 0.00% 44 30 0.00% 45 29 0.00% 46 47 0.00% 47 35 0.00% 48 58 0.00% 49 60 0.00% 50 65 0.00% 51 59 0.00% 52 71 0.00% 53 101 0.00% 54 98 0.00% 55 91 0.00% 56 119 0.00% 57 138 0.00% 58 166 0.00% 59 154 0.00% 60 184 0.00% 61 213 0.00% 62 240 0.00% 63 232 0.00% 64 277 0.00% 65 345 0.00% 66 372 0.00% 67 436 0.00% 68 518 0.00% 69 992 0.00% 70 1045 0.01% 71 767 0.00% 72 826 0.00% 73 864 0.00% 74 1031 0.01% 75 1086 0.01% 76 1214 0.01% 77 1302 0.01% 78 1473 0.01% 79 1698 0.01% 80 1802 0.01% 81 2118 0.01% 82 2415 0.01% 83 2911 0.01% 84 4201 0.02% 85 4662 0.02% 86 4789 0.02% 87 4948 0.02% 88 5298 0.03% 89 5752 0.03% 90 6111 0.03% 91 6723 0.03% 92 7150 0.04% 93 7311 0.04% 94 8020 0.04% 95 8511 0.04% 96 9022 0.05% 97 9353 0.05% 98 9917 0.05% 99 10253 0.05% 100 11333 0.06% 101 12107 0.06% 102 13060 0.07% 103 14039 0.07% 104 14989 0.08% 105 16280 0.08% 106 16923 0.09% 107 17420 0.09% 108 18143 0.09% 109 18870 0.09% 110 19808 0.10% 111 21071 0.11% 112 22570 0.11% 113 24389 0.12% 114 25401 0.13% 115 27018 0.14% 116 28594 0.14% 117 29842 0.15% 118 31160 0.16% 119 31691 0.16% 120 33637 0.17% 121 35045 0.18% 122 37256 0.19% 123 39447 0.20% 124 42312 0.21% 125 44663 0.22% 126 47252 0.24% 127 49925 0.25% 128 52441 0.26% 129 54466 0.27% 130 57806 0.29% 131 60797 0.31% 132 64786 0.33% 133 69123 0.35% 134 74263 0.37% 135 79483 0.40% 136 85289 0.43% 137 89923 0.45% 138 96690 0.49% 139 104720 0.53% 140 112099 0.56% 141 122230 0.61% 142 137172 0.69% 143 154587 0.78% 144 179608 0.90% 145 215250 1.08% 146 268140 1.35% 147 365206 1.84% 148 564426 2.84% 149 1053087 5.29% 150 4706909 23.67% 151 10237865 51.48% 19888683 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=43 prefix-density=0.28 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=69.03 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=9.0 sequence=AAAAAAAGAGGGATCTAGCAGAGCACTGCCTCTATCCTGGCAATTCATGAGAAAACCATCACAAAAACGGCGACACAAGTACCGGCTAAAGCCACAAATGGGGAAATATTGATCCCTAAGGATGAATCGGGTACGTTGTTGGATGAAGGCTTGTAATTGGTGACGTTACTACCGGCCGGAGAAGTGGTAGTGCCATCAGAAGATGGAGTTCCGGAGGAGGGACTTGTGCTCGATCCTGCTGCTGCAACAGTGACTGCAACCTTCATGCCACTCCCACAGTGGCCAGGAACACCACAAATGAAATAATGAGTTCCGGCAGTCTTGAGGGCTATTGTGGTAGCACCACTGCTATCTGAAGTGATTGCATTGCCTGTAGTGCATGTGCTGTAGTCACTGGCTCTCACTTCATCTACCGTGTGGCCTCCTCCGTAGTTAAACACAAGGCTGTCGCCAACTGAAAAGGTCTTGCCACTAGTCCAGGTGCTATAATCCATACCAATTGCCCAGCCTG criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=44 prefix-density=0.30 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.15 sequence-density-rank=15 fanout-score=45.27 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=12.1 sequence=TGTTGGTGGTGGTACTGGA SRR7169575 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 04:14:04 Started mapping on | Feb 11 04:14:28 Finished on | Feb 11 06:02:11 Mapping speed, Million of reads per hour | 11.08 Number of input reads | 19888683 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 18845632 Uniquely mapped reads % | 94.76% Average mapped length | 294.77 Number of splices: Total | 16614472 Number of splices: Annotated (sjdb) | 16333879 Number of splices: GT/AG | 16389958 Number of splices: GC/AG | 177068 Number of splices: AT/AC | 13459 Number of splices: Non-canonical | 33987 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 354004 % of reads mapped to multiple loci | 1.78% Number of reads mapped to too many loci | 20910 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.33% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 710972 710972 710972 N_multimapping 354004 354004 354004 N_noFeature 415661 18575432 512919 N_ambiguous 253465 959 79872 UnstrandedReadsAssigned:18176506 PositiveStrandReadsAssigned:269241 NegativeStrandReadsAssigned:18252841 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169575 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169575-trimmed-pair1.fastq SRR7169575-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,888,683 reads, 18,144,648 reads pseudoaligned [quant] estimated average fragment length: 242.391 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,151 rounds 52401 SRR7169575.ke.tsv 34699 SRR7169575.se.tsv 87100 total ==> SRR7169575.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.61 281 8.14431 Potri.005G024800.1.v4.1 1035 793.609 28 1.81673 Potri.004G059700.1.v4.1 961 719.609 1 0.0715555 Potri.007G009000.2.v4.1 1416 1174.61 0 0 Potri.003G141000.2.v4.1 2943 2701.61 274.054 5.22341 Potri.016G087400.1.v4.1 270 76.4995 1340.5 902.294 Potri.015G069301.1.v4.1 564 326.281 0 0 Potri.010G195200.1.v4.1 1773 1531.61 11 0.369815 Potri.012G127500.1.v4.1 977 735.609 3448 241.357 ==> SRR7169575.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2100 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 272 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 14 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1752 Potri.001G452600.v4.1 0 SRR7169575 completed mapping pipeline successfully