Starting /dee2/code/volunteer_pipeline.sh SRR7169576 current disk space = 3056987029504 free memory = 1509209940 SRR7169576 SRAfilesize 9c3891c3dcec1e1e00ded636816a5aa4 SRR7169576.sra SRR7169576.sra file validated SRR7169576 is paired end SRR7169576 is conventional basespace SRR7169576 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169576_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.829 34.0 33.0 34.0 33.0 34.0 2 33.39625 34.0 34.0 34.0 33.0 34.0 3 33.4825 34.0 34.0 34.0 33.0 34.0 4 33.50825 34.0 34.0 34.0 33.0 34.0 5 33.52675 34.0 34.0 34.0 33.0 34.0 6 37.108 38.0 37.0 38.0 36.0 38.0 7 37.43475 38.0 38.0 38.0 37.0 38.0 8 37.44025 38.0 38.0 38.0 37.0 38.0 9 37.509 38.0 38.0 38.0 38.0 38.0 10-14 37.53425 38.0 38.0 38.0 38.0 38.0 15-19 37.46925 38.0 38.0 38.0 37.4 38.0 20-24 37.48225 38.0 38.0 38.0 37.8 38.0 25-29 37.487449999999995 38.0 38.0 38.0 37.6 38.0 30-34 37.4303 38.0 38.0 38.0 37.4 38.0 35-39 37.261199999999995 38.0 38.0 38.0 37.0 38.0 40-44 37.304700000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.26405 38.0 38.0 38.0 37.0 38.0 50-54 37.18395 38.0 38.0 38.0 36.6 38.0 55-59 37.13725 38.0 38.0 38.0 36.2 38.0 60-64 37.153800000000004 38.0 38.0 38.0 36.4 38.0 65-69 37.07385 38.0 38.0 38.0 36.0 38.0 70-74 37.01049999999999 38.0 38.0 38.0 36.0 38.0 75-79 37.004400000000004 38.0 38.0 38.0 36.0 38.0 80-84 36.85665 38.0 38.0 38.0 35.6 38.0 85-89 36.863150000000005 38.0 38.0 38.0 35.8 38.0 90-94 36.7596 38.0 38.0 38.0 35.0 38.0 95-99 36.56175 38.0 38.0 38.0 34.4 38.0 100-104 36.489149999999995 38.0 38.0 38.0 34.0 38.0 105-109 36.4936 38.0 38.0 38.0 34.0 38.0 110-114 36.233799999999995 38.0 38.0 38.0 34.0 38.0 115-119 36.1126 38.0 37.4 38.0 33.6 38.0 120-124 35.979699999999994 38.0 37.0 38.0 33.0 38.0 125-129 35.746500000000005 38.0 37.0 38.0 32.0 38.0 130-134 35.712599999999995 38.0 36.6 38.0 31.8 38.0 135-139 35.33765 38.0 36.0 38.0 31.0 38.0 140-144 34.941950000000006 38.0 36.0 38.0 28.4 38.0 145-149 34.3119 38.0 35.0 38.0 26.8 38.0 150-151 31.25575 36.5 31.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 1.0 13 1.0 14 1.0 15 2.0 16 2.0 17 5.0 18 3.0 19 2.0 20 5.0 21 6.0 22 5.0 23 5.0 24 8.0 25 8.0 26 13.0 27 29.0 28 29.0 29 26.0 30 44.0 31 50.0 32 60.0 33 80.0 34 115.0 35 195.0 36 575.0 37 2729.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.73413204180474 12.337496813663012 9.023706347183278 37.90466479734897 2 23.35 13.750000000000002 32.7 30.2 3 19.625 17.375 26.6 36.4 4 23.45 26.375 22.425 27.750000000000004 5 23.625 30.575000000000003 23.974999999999998 21.825 6 20.225 33.925 24.725 21.125 7 14.325 28.125 40.300000000000004 17.25 8 16.950000000000003 27.175 30.275000000000002 25.6 9 17.375 24.85 32.675 25.1 10-14 19.615 30.064999999999998 27.339999999999996 22.98 15-19 19.645000000000003 28.34 27.685 24.33 20-24 19.71 27.744999999999997 28.48 24.065 25-29 19.345000000000002 28.610000000000003 27.775 24.27 30-34 19.675 28.970000000000002 27.334999999999997 24.02 35-39 19.74394878975795 27.515503100620126 27.925585117023406 24.81496299259852 40-44 20.165 28.595 27.32 23.919999999999998 45-49 19.6 28.405 27.939999999999998 24.055 50-54 20.044999999999998 28.365000000000002 27.279999999999998 24.310000000000002 55-59 20.49 28.560000000000002 26.810000000000002 24.14 60-64 20.419999999999998 28.24 27.389999999999997 23.95 65-69 19.965 28.825 27.12 24.09 70-74 19.915 28.610000000000003 27.355 24.12 75-79 20.445 27.83 27.55 24.175 80-84 20.745 27.96 27.805000000000003 23.49 85-89 20.07 27.605 27.455000000000002 24.87 90-94 20.599999999999998 28.199999999999996 28.044999999999998 23.155 95-99 20.44 27.785 27.389999999999997 24.385 100-104 21.125 28.16 27.150000000000002 23.565 105-109 20.544999999999998 27.87 27.465 24.12 110-114 20.65 28.185 26.775 24.39 115-119 21.075 27.88 27.529999999999998 23.515 120-124 20.765 28.470000000000002 26.75 24.015 125-129 21.08 28.015 26.935 23.97 130-134 20.74 28.355000000000004 26.979999999999997 23.925 135-139 20.94 27.49 27.215 24.355 140-144 20.775 27.68 27.405 24.14 145-149 20.51 28.48 27.060000000000002 23.95 150-151 20.474999999999998 27.3375 27.55 24.637500000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 1.0 20 1.0 21 0.5 22 0.5 23 0.5 24 1.0 25 1.0 26 4.5 27 8.5 28 7.0 29 8.5 30 13.5 31 17.5 32 21.0 33 31.5 34 52.5 35 59.5 36 68.0 37 86.0 38 110.0 39 158.0 40 180.5 41 204.0 42 248.0 43 277.0 44 280.5 45 272.5 46 285.5 47 289.5 48 251.0 49 202.5 50 174.5 51 150.5 52 123.0 53 100.0 54 82.0 55 57.5 56 40.0 57 36.5 58 27.0 59 12.0 60 7.5 61 8.5 62 6.0 63 5.5 64 5.5 65 4.5 66 4.0 67 3.5 68 2.5 69 1.0 70 1.0 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.925 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.02 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49736114601659 98.97500000000001 2 0.4775069112842423 0.95 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.30000000000000004 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.7749999999999999 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.1875 0.0 0.0 0.0 0.0 108-109 1.35 0.0 0.0 0.0 0.0 110-111 1.6125 0.0 0.0 0.0 0.0 112-113 1.8375 0.0 0.0 0.0 0.0 114-115 2.0375 0.0 0.0 0.0 0.0 116-117 2.325 0.0 0.0 0.0 0.0 118-119 2.625 0.0 0.0 0.0 0.0 120-121 2.8375 0.0 0.0 0.0 0.0 122-123 3.1625 0.0 0.0 0.0 0.0 124-125 3.3625 0.0 0.0 0.0 0.0 126-127 3.7 0.0 0.0 0.0 0.0 128-129 4.125 0.0 0.0 0.0 0.0 130-131 4.5375 0.0 0.0 0.0 0.0 132-133 4.925 0.0 0.0 0.0 0.0 134-135 5.525 0.0 0.0 0.0 0.0 136-137 5.9375 0.0 0.0 0.0 0.0 138-139 6.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAGGA 10 0.006830828 145.0 8 AAGTTCA 10 0.006830828 145.0 9 >>END_MODULE SRR7169576 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169576_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9385 33.0 33.0 34.0 32.0 34.0 2 33.062 34.0 33.0 34.0 32.0 34.0 3 33.06875 34.0 33.0 34.0 32.0 34.0 4 33.05325 34.0 33.0 34.0 33.0 34.0 5 33.00975 34.0 33.0 34.0 32.0 34.0 6 37.04275 38.0 38.0 38.0 37.0 38.0 7 37.04275 38.0 38.0 38.0 37.0 38.0 8 37.0715 38.0 38.0 38.0 37.0 38.0 9 37.0995 38.0 38.0 38.0 37.0 38.0 10-14 37.05055 38.0 38.0 38.0 37.0 38.0 15-19 37.031949999999995 38.0 38.0 38.0 37.0 38.0 20-24 36.96575 38.0 38.0 38.0 37.0 38.0 25-29 36.97055 38.0 38.0 38.0 36.8 38.0 30-34 36.878699999999995 38.0 38.0 38.0 36.4 38.0 35-39 36.8876 38.0 38.0 38.0 36.0 38.0 40-44 36.92225 38.0 38.0 38.0 36.6 38.0 45-49 36.9391 38.0 38.0 38.0 37.0 38.0 50-54 36.92775 38.0 38.0 38.0 36.6 38.0 55-59 36.69185 38.0 38.0 38.0 35.6 38.0 60-64 36.813300000000005 38.0 38.0 38.0 36.0 38.0 65-69 36.74875 38.0 38.0 38.0 36.0 38.0 70-74 36.7115 38.0 38.0 38.0 35.8 38.0 75-79 36.6464 38.0 38.0 38.0 35.4 38.0 80-84 36.52120000000001 38.0 38.0 38.0 34.8 38.0 85-89 36.42105 38.0 38.0 38.0 34.6 38.0 90-94 36.3544 38.0 38.0 38.0 34.0 38.0 95-99 36.350649999999995 38.0 38.0 38.0 34.0 38.0 100-104 36.243649999999995 38.0 38.0 38.0 34.0 38.0 105-109 36.21055 38.0 38.0 38.0 34.0 38.0 110-114 36.05625 38.0 38.0 38.0 33.6 38.0 115-119 35.86585 38.0 37.8 38.0 32.8 38.0 120-124 35.69345 38.0 37.0 38.0 32.2 38.0 125-129 35.35575 38.0 36.6 38.0 30.6 38.0 130-134 35.1973 38.0 36.0 38.0 30.0 38.0 135-139 34.803999999999995 38.0 36.0 38.0 27.8 38.0 140-144 34.261250000000004 38.0 35.0 38.0 24.2 38.0 145-149 33.6571 38.0 35.0 38.0 20.8 38.0 150-151 30.018 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 14.0 4 0.0 5 3.0 6 1.0 7 0.0 8 0.0 9 0.0 10 1.0 11 2.0 12 0.0 13 1.0 14 3.0 15 2.0 16 6.0 17 2.0 18 1.0 19 8.0 20 3.0 21 6.0 22 7.0 23 16.0 24 14.0 25 20.0 26 30.0 27 17.0 28 31.0 29 32.0 30 35.0 31 66.0 32 41.0 33 93.0 34 118.0 35 208.0 36 536.0 37 2674.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.6 22.6 14.149999999999999 26.650000000000002 2 28.425 26.900000000000002 28.499999999999996 16.175 3 20.575 29.125 31.275 19.025 4 23.825 33.725 22.925 19.525000000000002 5 25.55 35.025 22.525000000000002 16.900000000000002 6 21.91815214662315 37.258347978910365 22.319859402460455 18.503640472006026 7 20.311323123273915 22.972633693196084 37.358774792869696 19.357268390660305 8 21.893045443133317 26.03565151895556 26.73863921667085 25.33266382124027 9 22.319859402460455 23.72583479789104 30.278684408737135 23.675621390911374 10-14 24.05222194325885 28.0743158423299 26.43735877479287 21.43610343961838 15-19 23.324127542053727 27.86844087371328 27.66256590509666 21.14486567913633 20-24 23.46974642229475 28.234998744664825 27.0298769771529 21.26537785588752 25-29 23.695706753703238 28.114486567913634 26.934471503891537 21.255335174491588 30-34 23.40446899322119 28.1646999748933 27.687672608586496 20.743158423299022 35-39 23.424554356013054 27.878483555109213 27.311072056239016 21.385890032638716 40-44 23.198594024604567 28.63168465980417 27.0298769771529 21.139844338438362 45-49 23.6017672457074 27.65337885329852 28.441610603474242 20.30324329751983 50-54 23.212045169385195 28.38143036386449 27.352572145545796 21.053952321204516 55-59 23.439931723480097 28.184145790451325 27.23530297705708 21.140619509011497 60-64 23.784896565575416 28.022695320345452 27.691303474593294 20.50110463948584 65-69 23.7459201606829 27.416520210896312 28.33542555862415 20.502134069796636 70-74 24.64474014561888 27.185538538789856 27.63745920160683 20.532262113984434 75-79 23.565151895556113 27.58724579462716 28.18980667838313 20.657795631433594 80-84 24.45392919909616 27.96384634697464 26.929450163193575 20.652774290735625 85-89 24.401144980665894 28.077135539597247 26.907045648571287 20.614673831165568 90-94 23.841325633944262 28.084358523725832 27.275922671353253 20.798393170976652 95-99 23.788723201285332 26.992016870010545 28.694080433800274 20.52517949490385 100-104 23.975697931311508 28.128138180357503 27.530628640289212 20.365535248041773 105-109 23.77797852052595 27.82796346481983 27.742647796848342 20.651410217805882 110-114 24.145374228201398 27.563877315395814 27.674313538476987 20.616434917925808 115-119 24.125119244866195 27.66982979364362 27.945975799568206 20.259075161921977 120-124 24.63098704689226 27.854202229139474 27.121196907320012 20.393613816648255 125-129 24.50916394677379 28.12955059000753 27.155410494602062 20.205874968616623 130-134 24.904599317131954 27.385017071701146 27.44024904599317 20.27013456517373 135-139 24.820487070047704 27.0600050213407 27.396434848104445 20.723073060507154 140-144 24.939746937135972 27.68628238602129 27.01847760594497 20.355493070897772 145-149 25.366392290704674 27.705280064244125 27.113029512146152 19.815298132905042 150-151 25.79514149762084 27.87377911344853 27.122464312546956 19.208615076383673 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 4.5 3 6.5 4 3.5 5 1.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.5 24 0.5 25 0.5 26 1.0 27 1.5 28 3.0 29 6.0 30 6.0 31 8.5 32 13.0 33 24.0 34 32.0 35 46.5 36 67.0 37 83.5 38 117.5 39 157.5 40 199.5 41 235.0 42 254.0 43 277.5 44 297.5 45 298.0 46 285.5 47 279.0 48 259.0 49 210.5 50 184.0 51 154.0 52 126.5 53 100.5 54 61.0 55 50.5 56 43.5 57 28.0 58 15.5 59 9.5 60 8.0 61 7.0 62 6.0 63 4.5 64 3.0 65 3.0 66 4.5 67 4.0 68 2.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.42500000000000004 7 0.42500000000000004 8 0.42500000000000004 9 0.42500000000000004 10-14 0.42500000000000004 15-19 0.42500000000000004 20-24 0.42500000000000004 25-29 0.42500000000000004 30-34 0.42500000000000004 35-39 0.42500000000000004 40-44 0.42500000000000004 45-49 0.41000000000000003 50-54 0.375 55-59 0.40499999999999997 60-64 0.42 65-69 0.42500000000000004 70-74 0.42500000000000004 75-79 0.42500000000000004 80-84 0.42500000000000004 85-89 0.43499999999999994 90-94 0.42500000000000004 95-99 0.415 100-104 0.42 105-109 0.37 110-114 0.395 115-119 0.415 120-124 0.41000000000000003 125-129 0.42500000000000004 130-134 0.42 135-139 0.42500000000000004 140-144 0.42 145-149 0.38 150-151 0.17500000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52261306532664 99.02499999999999 2 0.4522613065326633 0.8999999999999999 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0125 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.32499999999999996 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.5375 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.125 0.0 0.0 0.0 0.0 106-107 1.2125 0.0 0.0 0.0 0.0 108-109 1.375 0.0 0.0 0.0 0.0 110-111 1.65 0.0 0.0 0.0 0.0 112-113 1.8624999999999998 0.0 0.0 0.0 0.0 114-115 2.0875 0.0 0.0 0.0 0.0 116-117 2.375 0.0 0.0 0.0 0.0 118-119 2.6500000000000004 0.0 0.0 0.0 0.0 120-121 2.875 0.0 0.0 0.0 0.0 122-123 3.175 0.0 0.0 0.0 0.0 124-125 3.325 0.0 0.0 0.0 0.0 126-127 3.6500000000000004 0.0 0.0 0.0 0.0 128-129 4.0875 0.0 0.0 0.0 0.0 130-131 4.5 0.0 0.0 0.0 0.0 132-133 4.8625 0.0 0.0 0.0 0.0 134-135 5.449999999999999 0.0 0.0 0.0 0.0 136-137 5.875 0.0 0.0 0.0 0.0 138-139 6.324999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTATGA 10 0.006825767 145.01266 1 CCTCAAC 10 0.006825767 145.01266 1 >>END_MODULE Read 877064 spots for SRR7169576.sra Written 877064 spots for SRR7169576.sra Read 877064 spots for SRR7169576.sra Written 877064 spots for SRR7169576.sra Read 877064 spots for SRR7169576.sra Written 877064 spots for SRR7169576.sra Read 877064 spots for SRR7169576.sra Written 877064 spots for SRR7169576.sra Read 877064 spots for SRR7169576.sra Written 877064 spots for SRR7169576.sra Read 877064 spots for SRR7169576.sra Written 877064 spots for SRR7169576.sra Read 877064 spots for SRR7169576.sra Written 877064 spots for SRR7169576.sra Read 877064 spots for SRR7169576.sra Written 877064 spots for SRR7169576.sra Read 877064 spots for SRR7169576.sra Written 877064 spots for SRR7169576.sra Read 877064 spots for SRR7169576.sra Written 877064 spots for SRR7169576.sra Read 877064 spots for SRR7169576.sra Written 877064 spots for SRR7169576.sra Read 877064 spots for SRR7169576.sra Written 877064 spots for SRR7169576.sra Read 877064 spots for SRR7169576.sra Written 877064 spots for SRR7169576.sra Read 877064 spots for SRR7169576.sra Written 877064 spots for SRR7169576.sra Read 877064 spots for SRR7169576.sra Written 877064 spots for SRR7169576.sra Read 877076 spots for SRR7169576.sra Written 877076 spots for SRR7169576.sra Read 877064 spots for SRR7169576.sra Written 877064 spots for SRR7169576.sra Read 877064 spots for SRR7169576.sra Written 877064 spots for SRR7169576.sra Read 877064 spots for SRR7169576.sra Written 877064 spots for SRR7169576.sra Read 877064 spots for SRR7169576.sra Written 877064 spots for SRR7169576.sra SRR ids: ['SRR7169576.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_o7igot5g SRR7169576.sra spots: 17541292 blocks: [[1, 877064], [877065, 1754128], [1754129, 2631192], [2631193, 3508256], [3508257, 4385320], [4385321, 5262384], [5262385, 6139448], [6139449, 7016512], [7016513, 7893576], [7893577, 8770640], [8770641, 9647704], [9647705, 10524768], [10524769, 11401832], [11401833, 12278896], [12278897, 13155960], [13155961, 14033024], [14033025, 14910088], [14910089, 15787152], [15787153, 16664216], [16664217, 17541292]] SRR7169576 file size 5922467 SRR7169576 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169576 SRR7169576_1.fastq SRR7169576_2.fastq Input file: SRR7169576_1.fastq Paired file: SRR7169576_2.fastq trimmed: SRR7169576-trimmed-pair1.fastq, SRR7169576-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 03:28:16 2025 >> started Tue Feb 11 03:32:59 2025 >> done (282.282s) 17541292 read pairs processed; of these: 33405 ( 0.19%) short read pairs filtered out after trimming by size control 35729 ( 0.20%) empty read pairs filtered out after trimming by size control 17472158 (99.61%) read pairs available; of these: 8280597 (47.39%) trimmed read pairs available after processing 9191561 (52.61%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 5 0.00% 21 11 0.00% 22 9 0.00% 23 2 0.00% 24 8 0.00% 25 8 0.00% 26 11 0.00% 27 10 0.00% 28 1 0.00% 29 11 0.00% 30 13 0.00% 31 9 0.00% 32 8 0.00% 33 12 0.00% 34 10 0.00% 35 22 0.00% 36 17 0.00% 37 12 0.00% 38 21 0.00% 39 27 0.00% 40 27 0.00% 41 27 0.00% 42 21 0.00% 43 34 0.00% 44 27 0.00% 45 26 0.00% 46 48 0.00% 47 33 0.00% 48 59 0.00% 49 58 0.00% 50 72 0.00% 51 73 0.00% 52 105 0.00% 53 100 0.00% 54 115 0.00% 55 148 0.00% 56 161 0.00% 57 161 0.00% 58 179 0.00% 59 230 0.00% 60 283 0.00% 61 304 0.00% 62 384 0.00% 63 380 0.00% 64 429 0.00% 65 485 0.00% 66 559 0.00% 67 620 0.00% 68 798 0.00% 69 1140 0.01% 70 1446 0.01% 71 1218 0.01% 72 1259 0.01% 73 1381 0.01% 74 1544 0.01% 75 1710 0.01% 76 1939 0.01% 77 2053 0.01% 78 2414 0.01% 79 2634 0.02% 80 3036 0.02% 81 3382 0.02% 82 3782 0.02% 83 4449 0.03% 84 5609 0.03% 85 6185 0.04% 86 6521 0.04% 87 7134 0.04% 88 7610 0.04% 89 7971 0.05% 90 8720 0.05% 91 9191 0.05% 92 10031 0.06% 93 10686 0.06% 94 11748 0.07% 95 12348 0.07% 96 12894 0.07% 97 13401 0.08% 98 13878 0.08% 99 14598 0.08% 100 15535 0.09% 101 16382 0.09% 102 17391 0.10% 103 18747 0.11% 104 19452 0.11% 105 20520 0.12% 106 21697 0.12% 107 22047 0.13% 108 22531 0.13% 109 23568 0.13% 110 24206 0.14% 111 25617 0.15% 112 26562 0.15% 113 28662 0.16% 114 29387 0.17% 115 30671 0.18% 116 31835 0.18% 117 33038 0.19% 118 33960 0.19% 119 34882 0.20% 120 35943 0.21% 121 37648 0.22% 122 38324 0.22% 123 40710 0.23% 124 42617 0.24% 125 44429 0.25% 126 46654 0.27% 127 48404 0.28% 128 50131 0.29% 129 51637 0.30% 130 54314 0.31% 131 56739 0.32% 132 59057 0.34% 133 62686 0.36% 134 65865 0.38% 135 70577 0.40% 136 74951 0.43% 137 79561 0.46% 138 84380 0.48% 139 90328 0.52% 140 95668 0.55% 141 103776 0.59% 142 113735 0.65% 143 125995 0.72% 144 144664 0.83% 145 170887 0.98% 146 208143 1.19% 147 279622 1.60% 148 427924 2.45% 149 849947 4.86% 150 3930500 22.50% 151 9191561 52.61% 17472158 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=43 prefix-density=0.17 prefix-fanout=2.0 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.11 sequence-density-rank=19 fanout-score=228.20 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=27.0 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=4.87 fanout-score-rank=25 prefix-density=0.38 prefix-fanout=3.5 sequence=ACTGTTGAGGTTG criterion=fanout-score sequence-density=0.10 sequence-density-rank=25 fanout-score=267.91 fanout-score-rank=1 prefix-density=0.98 prefix-fanout=28.6 sequence=AAGAAGAAGAAA SRR7169576 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 04:25:39 Started mapping on | Feb 11 04:25:55 Finished on | Feb 11 06:15:48 Mapping speed, Million of reads per hour | 9.54 Number of input reads | 17472158 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 16606418 Uniquely mapped reads % | 95.05% Average mapped length | 293.50 Number of splices: Total | 15942614 Number of splices: Annotated (sjdb) | 15687201 Number of splices: GT/AG | 15705523 Number of splices: GC/AG | 189991 Number of splices: AT/AC | 12487 Number of splices: Non-canonical | 34613 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 317514 % of reads mapped to multiple loci | 1.82% Number of reads mapped to too many loci | 32801 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.91% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 563050 563050 563050 N_multimapping 317514 317514 317514 N_noFeature 309168 16428734 396595 N_ambiguous 158905 945 68050 UnstrandedReadsAssigned:16138345 PositiveStrandReadsAssigned:176739 NegativeStrandReadsAssigned:16141773 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169576 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169576-trimmed-pair1.fastq SRR7169576-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,472,158 reads, 16,010,968 reads pseudoaligned [quant] estimated average fragment length: 240.714 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,060 rounds 52401 SRR7169576.ke.tsv 34699 SRR7169576.se.tsv 87100 total ==> SRR7169576.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.29 344 11.9441 Potri.005G024800.1.v4.1 1035 795.286 31 2.40678 Potri.004G059700.1.v4.1 961 721.341 2 0.171194 Potri.007G009000.2.v4.1 1416 1176.29 0 0 Potri.003G141000.2.v4.1 2943 2703.29 366 8.35964 Potri.016G087400.1.v4.1 270 81.452 1587.82 1203.64 Potri.015G069301.1.v4.1 564 329.295 0 0 Potri.010G195200.1.v4.1 1773 1533.29 6 0.241616 Potri.012G127500.1.v4.1 977 737.317 7710 645.652 ==> SRR7169576.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 929 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 302 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7169576 completed mapping pipeline successfully