Starting /dee2/code/volunteer_pipeline.sh SRR7169577 current disk space = 3056982945792 free memory = 1579972068 SRR7169577 SRAfilesize e1f2993d9dbdff615140bb6bee00e172 SRR7169577.sra SRR7169577.sra file validated SRR7169577 is paired end SRR7169577 is conventional basespace SRR7169577 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169577_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82175 34.0 33.0 34.0 33.0 34.0 2 33.315 34.0 33.0 34.0 33.0 34.0 3 33.408 34.0 34.0 34.0 33.0 34.0 4 33.4005 34.0 34.0 34.0 33.0 34.0 5 33.4 34.0 34.0 34.0 33.0 34.0 6 37.00725 38.0 37.0 38.0 36.0 38.0 7 37.35425 38.0 38.0 38.0 37.0 38.0 8 37.4585 38.0 38.0 38.0 37.0 38.0 9 37.48675 38.0 38.0 38.0 37.0 38.0 10-14 37.48935 38.0 38.0 38.0 37.4 38.0 15-19 37.444849999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.381299999999996 38.0 38.0 38.0 37.0 38.0 25-29 37.38625 38.0 38.0 38.0 37.0 38.0 30-34 37.2808 38.0 38.0 38.0 37.0 38.0 35-39 37.20525 38.0 38.0 38.0 36.8 38.0 40-44 37.0751 38.0 38.0 38.0 36.0 38.0 45-49 37.02915 38.0 38.0 38.0 36.0 38.0 50-54 36.9624 38.0 38.0 38.0 36.0 38.0 55-59 36.86105 38.0 38.0 38.0 35.2 38.0 60-64 36.828 38.0 38.0 38.0 35.2 38.0 65-69 36.7637 38.0 38.0 38.0 35.0 38.0 70-74 36.7436 38.0 38.0 38.0 34.8 38.0 75-79 36.5845 38.0 38.0 38.0 34.0 38.0 80-84 36.46485 38.0 38.0 38.0 34.0 38.0 85-89 36.360400000000006 38.0 37.8 38.0 34.0 38.0 90-94 36.23535 38.0 37.6 38.0 33.6 38.0 95-99 36.16165 38.0 37.4 38.0 33.4 38.0 100-104 35.77815 38.0 37.0 38.0 31.6 38.0 105-109 35.65989999999999 38.0 37.0 38.0 31.0 38.0 110-114 35.4245 38.0 36.4 38.0 29.8 38.0 115-119 35.0923 38.0 36.0 38.0 28.2 38.0 120-124 34.9601 38.0 35.8 38.0 27.8 38.0 125-129 34.69195 38.0 35.0 38.0 27.0 38.0 130-134 34.3695 38.0 35.0 38.0 25.6 38.0 135-139 34.115300000000005 38.0 35.0 38.0 23.2 38.0 140-144 33.6965 38.0 34.2 38.0 22.2 38.0 145-149 32.795849999999994 38.0 34.0 38.0 14.2 38.0 150-151 28.878124999999997 36.0 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 2.0 15 2.0 16 2.0 17 6.0 18 7.0 19 5.0 20 7.0 21 15.0 22 8.0 23 12.0 24 9.0 25 16.0 26 19.0 27 33.0 28 44.0 29 43.0 30 53.0 31 61.0 32 99.0 33 121.0 34 165.0 35 302.0 36 736.0 37 2231.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.39095068632435 12.811387900355871 8.693441789527197 35.104219623792574 2 25.45 15.5 30.775000000000002 28.275 3 20.05 18.8 25.775 35.375 4 22.575 27.275 23.95 26.200000000000003 5 23.325000000000003 31.525 23.25 21.9 6 19.275000000000002 35.675000000000004 24.325 20.724999999999998 7 14.674999999999999 26.5 41.3 17.525 8 16.650000000000002 25.974999999999998 31.55 25.825 9 17.549999999999997 23.9 34.25 24.3 10-14 20.485 29.5 27.089999999999996 22.925 15-19 20.28 28.515 27.54 23.665 20-24 20.105 28.65 27.88 23.365 25-29 20.48 28.610000000000003 26.845000000000002 24.065 30-34 20.064999999999998 28.884999999999998 27.245 23.805 35-39 20.560000000000002 28.455000000000002 27.13 23.855 40-44 19.605 28.939999999999998 27.544999999999998 23.91 45-49 20.355 28.665000000000003 27.705000000000002 23.275000000000002 50-54 20.625 28.660000000000004 27.115000000000002 23.599999999999998 55-59 20.345 28.84 27.21 23.605 60-64 20.305 28.605000000000004 27.150000000000002 23.94 65-69 19.919999999999998 28.565 27.565 23.95 70-74 20.28 27.875 28.105000000000004 23.74 75-79 20.53 28.675 27.139999999999997 23.655 80-84 20.29 28.744999999999997 27.185 23.78 85-89 20.255000000000003 28.775000000000002 27.32 23.65 90-94 20.8 28.04 27.334999999999997 23.825 95-99 20.48 28.52 27.525 23.474999999999998 100-104 20.779545681977385 28.4749324527169 27.314119883918742 23.43140198138697 105-109 20.415 28.294999999999998 27.455000000000002 23.835 110-114 20.913822440196174 28.125312781503354 27.16945250725653 23.791412271043942 115-119 20.96524131032758 28.617154288572145 26.791697924481124 23.625906476619154 120-124 20.303197078100766 28.233351678591085 27.863111022164404 23.600340221143743 125-129 20.76 28.194999999999997 27.095000000000002 23.95 130-134 20.790395197598798 28.69934967483742 26.903451725862933 23.60680340170085 135-139 20.845 28.535 27.465 23.155 140-144 20.9 27.76 27.565 23.775 145-149 20.645 28.555000000000003 27.255000000000003 23.544999999999998 150-151 21.15 28.212500000000002 26.875 23.7625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.0 25 1.0 26 2.5 27 7.5 28 8.5 29 7.5 30 12.5 31 18.0 32 28.0 33 40.0 34 56.0 35 64.0 36 64.5 37 94.0 38 126.0 39 145.0 40 189.0 41 221.5 42 245.0 43 268.0 44 278.5 45 276.0 46 269.0 47 271.0 48 259.0 49 220.5 50 173.5 51 141.5 52 122.0 53 103.0 54 78.0 55 57.0 56 38.5 57 25.5 58 21.5 59 16.5 60 10.0 61 10.0 62 7.5 63 3.5 64 2.0 65 2.0 66 2.5 67 3.5 68 3.5 69 1.5 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.6500000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.06999999999999999 105-109 0.0 110-114 0.09 115-119 0.025 120-124 0.065 125-129 0.0 130-134 0.05 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.07500000000000001 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.4 0.0 0.0 0.0 0.0 106-107 0.6125 0.0 0.0 0.0 0.0 108-109 0.6625000000000001 0.0 0.0 0.0 0.0 110-111 0.7124999999999999 0.0 0.0 0.0 0.0 112-113 0.8 0.0 0.0 0.0 0.0 114-115 0.9624999999999999 0.0 0.0 0.0 0.0 116-117 1.0375 0.0 0.0 0.0 0.0 118-119 1.2000000000000002 0.0 0.0 0.0 0.0 120-121 1.3125 0.0 0.0 0.0 0.0 122-123 1.5 0.0 0.0 0.0 0.0 124-125 1.8 0.0 0.0 0.0 0.0 126-127 2.0125 0.0 0.0 0.0 0.0 128-129 2.2375 0.0 0.0 0.0 0.0 130-131 2.525 0.0 0.0 0.0 0.0 132-133 2.95 0.0 0.0 0.0 0.0 134-135 3.2125 0.0 0.0 0.0 0.0 136-137 3.425 0.0 0.0 0.0 0.0 138-139 3.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169577 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169577_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5265 33.0 33.0 34.0 32.0 34.0 2 32.7495 33.0 33.0 34.0 32.0 34.0 3 32.821 34.0 33.0 34.0 32.0 34.0 4 32.8305 34.0 33.0 34.0 32.0 34.0 5 32.77625 34.0 33.0 34.0 32.0 34.0 6 36.91875 38.0 38.0 38.0 36.0 38.0 7 36.83325 38.0 38.0 38.0 36.0 38.0 8 36.99025 38.0 38.0 38.0 36.0 38.0 9 36.845 38.0 38.0 38.0 36.0 38.0 10-14 36.8493 38.0 38.0 38.0 36.0 38.0 15-19 36.8003 38.0 38.0 38.0 36.0 38.0 20-24 36.7969 38.0 38.0 38.0 36.0 38.0 25-29 36.85005 38.0 38.0 38.0 36.0 38.0 30-34 36.85495 38.0 38.0 38.0 36.0 38.0 35-39 36.73100000000001 38.0 38.0 38.0 35.6 38.0 40-44 36.71925 38.0 38.0 38.0 35.6 38.0 45-49 36.68635 38.0 38.0 38.0 35.8 38.0 50-54 36.50345 38.0 38.0 38.0 35.6 38.0 55-59 36.18695 38.0 38.0 38.0 34.6 38.0 60-64 36.035250000000005 38.0 38.0 38.0 34.0 38.0 65-69 35.9292 38.0 38.0 38.0 34.0 38.0 70-74 35.8791 38.0 38.0 38.0 33.8 38.0 75-79 35.62955 38.0 38.0 38.0 32.8 38.0 80-84 35.733399999999996 38.0 38.0 38.0 33.0 38.0 85-89 35.874900000000004 38.0 38.0 38.0 33.6 38.0 90-94 35.7293 38.0 38.0 38.0 32.6 38.0 95-99 35.629999999999995 38.0 38.0 38.0 32.2 38.0 100-104 35.46405000000001 38.0 38.0 38.0 30.8 38.0 105-109 35.4108 38.0 37.4 38.0 30.6 38.0 110-114 35.303200000000004 38.0 37.2 38.0 29.8 38.0 115-119 35.05935 38.0 37.0 38.0 28.8 38.0 120-124 34.751099999999994 38.0 36.2 38.0 27.0 38.0 125-129 34.63755 38.0 36.0 38.0 26.8 38.0 130-134 34.20335 38.0 36.0 38.0 23.0 38.0 135-139 33.781600000000005 38.0 35.0 38.0 19.8 38.0 140-144 33.278549999999996 38.0 35.0 38.0 14.2 38.0 145-149 32.389500000000005 38.0 33.8 38.0 8.8 38.0 150-151 28.5235 36.0 18.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 7.0 4 6.0 5 1.0 6 0.0 7 3.0 8 3.0 9 2.0 10 1.0 11 1.0 12 3.0 13 23.0 14 22.0 15 2.0 16 8.0 17 3.0 18 9.0 19 9.0 20 8.0 21 12.0 22 12.0 23 16.0 24 21.0 25 22.0 26 32.0 27 34.0 28 50.0 29 48.0 30 44.0 31 70.0 32 80.0 33 97.0 34 120.0 35 214.0 36 415.0 37 2591.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.609841827768015 23.2237007280944 13.90911373336681 25.257343710770776 2 28.849999999999998 26.05 29.375 15.725 3 21.125 27.625 31.025000000000002 20.225 4 21.6 35.025 24.725 18.65 5 25.35 35.55 20.875 18.224999999999998 6 21.5 38.1 22.7 17.7 7 20.325 22.625 36.95 20.1 8 22.125 25.95 26.974999999999998 24.95 9 22.75 25.874999999999996 28.799999999999997 22.575 10-14 23.45907544526716 28.647188312987794 26.350810486291778 21.542925755453272 15-19 23.255464959231652 28.257715972187487 27.162223000350156 21.324596068230704 20-24 22.945 28.189999999999998 27.639999999999997 21.224999999999998 25-29 22.845 28.355000000000004 27.465 21.335 30-34 23.244999999999997 28.1 27.76 20.895 35-39 23.03 28.389999999999997 27.384999999999998 21.195 40-44 22.994999999999997 28.12 28.27 20.615 45-49 23.01 28.860000000000003 27.155 20.974999999999998 50-54 23.59855334538879 28.556359252561787 27.10468153506128 20.740405866988144 55-59 22.931645569620255 28.192405063291137 27.90886075949367 20.967088607594935 60-64 23.30876747141042 27.898348157560353 27.725540025412958 21.067344345616267 65-69 23.451124368976593 28.70327877211769 27.367293865687625 20.478302993218094 70-74 23.504208110175977 27.94185156847743 27.584799795970415 20.96914052537618 75-79 23.51377600572509 28.032510351173134 27.771814138935746 20.681899504166026 80-84 23.391158365976498 27.95950551966221 28.458055654474236 20.19128045988706 85-89 23.771654340998886 26.886840239084187 28.386181744504103 20.955323675412828 90-94 23.051224944320715 28.158534116217858 27.57643247620976 21.21380846325167 95-99 23.77629449838188 26.855784789644012 28.47390776699029 20.89401294498382 100-104 23.45360824742268 27.420658985243584 28.60319385486153 20.522538912472204 105-109 23.9775825507422 27.44622841563163 28.07735029788953 20.498838735736648 110-114 23.79750668752839 27.365870892848132 27.850401251703428 20.986221167920053 115-119 24.432448794268993 27.64604984360811 27.913429522752498 20.0080718393704 120-124 24.38347874325483 27.68672146855615 27.469867365979123 20.459932422209896 125-129 24.578886134857605 27.431837725732205 27.649349992412365 20.339926146997826 130-134 24.602128737962495 27.992904206791685 27.399898631525595 20.005068423720225 135-139 24.453037549608222 27.724636206370207 27.434618907092705 20.38770733692887 140-144 24.7272912631257 28.295442960546435 26.857987562442652 20.11927821388521 145-149 24.216830466830466 28.1019656019656 27.329033579033577 20.35217035217035 150-151 25.637065637065636 27.07850707850708 27.516087516087516 19.768339768339768 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.5 17 2.0 18 2.0 19 4.0 20 6.0 21 5.0 22 5.0 23 6.0 24 6.5 25 7.0 26 6.5 27 8.5 28 9.5 29 7.0 30 7.0 31 14.0 32 19.0 33 28.5 34 45.0 35 61.5 36 82.5 37 98.0 38 127.0 39 168.5 40 206.0 41 245.0 42 263.0 43 263.0 44 262.0 45 271.0 46 276.5 47 267.0 48 240.5 49 209.5 50 175.0 51 138.0 52 124.5 53 100.5 54 62.0 55 39.0 56 32.0 57 25.0 58 16.0 59 14.0 60 12.0 61 6.0 62 4.0 63 4.0 64 2.5 65 3.0 66 2.0 67 0.0 68 0.5 69 1.5 70 2.0 71 1.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.42500000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.06 15-19 0.045 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.45999999999999996 55-59 1.25 60-64 1.625 65-69 1.9449999999999998 70-74 1.975 75-79 2.185 80-84 1.7149999999999999 85-89 1.29 90-94 1.22 95-99 1.1199999999999999 100-104 1.06 105-109 0.97 110-114 0.935 115-119 0.89 120-124 0.855 125-129 1.155 130-134 1.35 135-139 1.73 140-144 1.91 145-149 2.32 150-151 2.875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.07500000000000001 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.5625 0.0 0.0 0.0 0.0 108-109 0.6125 0.0 0.0 0.0 0.0 110-111 0.6625000000000001 0.0 0.0 0.0 0.0 112-113 0.75 0.0 0.0 0.0 0.0 114-115 0.9125000000000001 0.0 0.0 0.0 0.0 116-117 1.0125 0.0 0.0 0.0 0.0 118-119 1.1749999999999998 0.0 0.0 0.0 0.0 120-121 1.3125 0.0 0.0 0.0 0.0 122-123 1.4875 0.0 0.0 0.0 0.0 124-125 1.7875 0.0 0.0 0.0 0.0 126-127 2.0125 0.0 0.0 0.0 0.0 128-129 2.2375 0.0 0.0 0.0 0.0 130-131 2.5 0.0 0.0 0.0 0.0 132-133 2.9125 0.0 0.0 0.0 0.0 134-135 3.1625 0.0 0.0 0.0 0.0 136-137 3.375 0.0 0.0 0.0 0.0 138-139 3.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCAGAA 10 0.0069035282 144.4875 7 >>END_MODULE Read 841441 spots for SRR7169577.sra Written 841441 spots for SRR7169577.sra Read 841441 spots for SRR7169577.sra Written 841441 spots for SRR7169577.sra Read 841441 spots for SRR7169577.sra Written 841441 spots for SRR7169577.sra Read 841441 spots for SRR7169577.sra Written 841441 spots for SRR7169577.sra Read 841441 spots for SRR7169577.sra Written 841441 spots for SRR7169577.sra Read 841441 spots for SRR7169577.sra Written 841441 spots for SRR7169577.sra Read 841441 spots for SRR7169577.sra Written 841441 spots for SRR7169577.sra Read 841441 spots for SRR7169577.sra Written 841441 spots for SRR7169577.sra Read 841441 spots for SRR7169577.sra Written 841441 spots for SRR7169577.sra Read 841441 spots for SRR7169577.sra Written 841441 spots for SRR7169577.sra Read 841441 spots for SRR7169577.sra Written 841441 spots for SRR7169577.sra Read 841441 spots for SRR7169577.sra Written 841441 spots for SRR7169577.sra Read 841454 spots for SRR7169577.sra Written 841454 spots for SRR7169577.sra Read 841441 spots for SRR7169577.sra Written 841441 spots for SRR7169577.sra Read 841441 spots for SRR7169577.sra Written 841441 spots for SRR7169577.sra Read 841441 spots for SRR7169577.sra Written 841441 spots for SRR7169577.sra Read 841441 spots for SRR7169577.sra Written 841441 spots for SRR7169577.sra Read 841441 spots for SRR7169577.sra Written 841441 spots for SRR7169577.sra Read 841441 spots for SRR7169577.sra Written 841441 spots for SRR7169577.sra Read 841441 spots for SRR7169577.sra Written 841441 spots for SRR7169577.sra SRR ids: ['SRR7169577.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_v6rnkq3g SRR7169577.sra spots: 16828833 blocks: [[1, 841441], [841442, 1682882], [1682883, 2524323], [2524324, 3365764], [3365765, 4207205], [4207206, 5048646], [5048647, 5890087], [5890088, 6731528], [6731529, 7572969], [7572970, 8414410], [8414411, 9255851], [9255852, 10097292], [10097293, 10938733], [10938734, 11780174], [11780175, 12621615], [12621616, 13463056], [13463057, 14304497], [14304498, 15145938], [15145939, 15987379], [15987380, 16828833]] SRR7169577 file size 5681038 SRR7169577 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169577 SRR7169577_1.fastq SRR7169577_2.fastq Input file: SRR7169577_1.fastq Paired file: SRR7169577_2.fastq trimmed: SRR7169577-trimmed-pair1.fastq, SRR7169577-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 03:54:05 2025 >> started Tue Feb 11 03:58:37 2025 >> done (271.489s) 16828833 read pairs processed; of these: 20222 ( 0.12%) short read pairs filtered out after trimming by size control 14736 ( 0.09%) empty read pairs filtered out after trimming by size control 16793875 (99.79%) read pairs available; of these: 9115457 (54.28%) trimmed read pairs available after processing 7678418 (45.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 9 0.00% 20 8 0.00% 21 5 0.00% 22 8 0.00% 23 5 0.00% 24 3 0.00% 25 11 0.00% 26 7 0.00% 27 6 0.00% 28 13 0.00% 29 14 0.00% 30 21 0.00% 31 10 0.00% 32 16 0.00% 33 17 0.00% 34 12 0.00% 35 21 0.00% 36 20 0.00% 37 23 0.00% 38 21 0.00% 39 38 0.00% 40 25 0.00% 41 29 0.00% 42 26 0.00% 43 36 0.00% 44 30 0.00% 45 44 0.00% 46 45 0.00% 47 59 0.00% 48 69 0.00% 49 65 0.00% 50 77 0.00% 51 94 0.00% 52 93 0.00% 53 91 0.00% 54 120 0.00% 55 114 0.00% 56 124 0.00% 57 129 0.00% 58 165 0.00% 59 191 0.00% 60 169 0.00% 61 266 0.00% 62 285 0.00% 63 272 0.00% 64 331 0.00% 65 362 0.00% 66 425 0.00% 67 453 0.00% 68 551 0.00% 69 804 0.00% 70 985 0.01% 71 875 0.01% 72 977 0.01% 73 1090 0.01% 74 1316 0.01% 75 1585 0.01% 76 1336 0.01% 77 1134 0.01% 78 1518 0.01% 79 2545 0.02% 80 4062 0.02% 81 1799 0.01% 82 1935 0.01% 83 2224 0.01% 84 3223 0.02% 85 4012 0.02% 86 4494 0.03% 87 4614 0.03% 88 4573 0.03% 89 4857 0.03% 90 5201 0.03% 91 5536 0.03% 92 6011 0.04% 93 6605 0.04% 94 7117 0.04% 95 7712 0.05% 96 8435 0.05% 97 9171 0.05% 98 10338 0.06% 99 12785 0.08% 100 16453 0.10% 101 14221 0.08% 102 11615 0.07% 103 11861 0.07% 104 12607 0.08% 105 13277 0.08% 106 14152 0.08% 107 14798 0.09% 108 15532 0.09% 109 16337 0.10% 110 17157 0.10% 111 18365 0.11% 112 19190 0.11% 113 20406 0.12% 114 22045 0.13% 115 23065 0.14% 116 24486 0.15% 117 25497 0.15% 118 26268 0.16% 119 27828 0.17% 120 28931 0.17% 121 30999 0.18% 122 32617 0.19% 123 35268 0.21% 124 37122 0.22% 125 38752 0.23% 126 41400 0.25% 127 43651 0.26% 128 45379 0.27% 129 48088 0.29% 130 50439 0.30% 131 53373 0.32% 132 57192 0.34% 133 61747 0.37% 134 66700 0.40% 135 71334 0.42% 136 77226 0.46% 137 82840 0.49% 138 91083 0.54% 139 100371 0.60% 140 109319 0.65% 141 119316 0.71% 142 133361 0.79% 143 151203 0.90% 144 179015 1.07% 145 216501 1.29% 146 274692 1.64% 147 373380 2.22% 148 571419 3.40% 149 1130836 6.73% 150 4262837 25.38% 151 7678418 45.72% 16793875 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.43 fanout-score-rank=36 prefix-density=0.21 prefix-fanout=2.3 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.02 sequence-density-rank=40 fanout-score=232.57 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=15.8 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.60 fanout-score-rank=31 prefix-density=0.32 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.13 sequence-density-rank=16 fanout-score=47.86 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=13.4 sequence=TGTTGGTGGTGGTACTGGA SRR7169577 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 05:38:34 Started mapping on | Feb 11 05:38:52 Finished on | Feb 11 07:33:15 Mapping speed, Million of reads per hour | 8.81 Number of input reads | 16793875 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 15755827 Uniquely mapped reads % | 93.82% Average mapped length | 294.17 Number of splices: Total | 14929428 Number of splices: Annotated (sjdb) | 14685717 Number of splices: GT/AG | 14717078 Number of splices: GC/AG | 169286 Number of splices: AT/AC | 12219 Number of splices: Non-canonical | 30845 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 290489 % of reads mapped to multiple loci | 1.73% Number of reads mapped to too many loci | 149677 % of reads mapped to too many loci | 0.89% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.35% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 768968 768968 768968 N_multimapping 290489 290489 290489 N_noFeature 356324 15581444 434663 N_ambiguous 159237 1033 62393 UnstrandedReadsAssigned:15240266 PositiveStrandReadsAssigned:173350 NegativeStrandReadsAssigned:15258771 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169577 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169577-trimmed-pair1.fastq SRR7169577-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,793,875 reads, 15,275,082 reads pseudoaligned [quant] estimated average fragment length: 258.966 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,152 rounds 52401 SRR7169577.ke.tsv 34699 SRR7169577.se.tsv 87100 total ==> SRR7169577.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1760.03 283 10.7745 Potri.005G024800.1.v4.1 1035 777.034 28 2.41463 Potri.004G059700.1.v4.1 961 703.077 0 0 Potri.007G009000.2.v4.1 1416 1158.03 0 0 Potri.003G141000.2.v4.1 2943 2685.03 308 7.6866 Potri.016G087400.1.v4.1 270 72.9549 1220 1120.57 Potri.015G069301.1.v4.1 564 312.868 0 0 Potri.010G195200.1.v4.1 1773 1515.03 13 0.574982 Potri.012G127500.1.v4.1 977 719.061 5227 487.102 ==> SRR7169577.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1621 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 207 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169577 completed mapping pipeline successfully