Starting /dee2/code/volunteer_pipeline.sh SRR7169578 current disk space = 3056949084160 free memory = 1498957400 SRR7169578 SRAfilesize 28a687a05415931f01f14dcc8e6741f4 SRR7169578.sra SRR7169578.sra file validated SRR7169578 is paired end SRR7169578 is conventional basespace SRR7169578 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169578_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.136 34.0 33.0 34.0 33.0 34.0 2 33.44575 34.0 34.0 34.0 33.0 34.0 3 33.455 34.0 34.0 34.0 33.0 34.0 4 33.4385 34.0 34.0 34.0 33.0 34.0 5 33.464 34.0 34.0 34.0 33.0 34.0 6 37.0005 38.0 37.0 38.0 36.0 38.0 7 37.27825 38.0 38.0 38.0 36.0 38.0 8 37.38325 38.0 38.0 38.0 37.0 38.0 9 37.51275 38.0 38.0 38.0 37.0 38.0 10-14 37.4362 38.0 38.0 38.0 37.0 38.0 15-19 37.43245 38.0 38.0 38.0 37.0 38.0 20-24 37.44179999999999 38.0 38.0 38.0 37.0 38.0 25-29 37.4384 38.0 38.0 38.0 37.0 38.0 30-34 37.3701 38.0 38.0 38.0 37.0 38.0 35-39 37.329249999999995 38.0 38.0 38.0 37.0 38.0 40-44 37.1926 38.0 38.0 38.0 36.4 38.0 45-49 37.141999999999996 38.0 38.0 38.0 36.2 38.0 50-54 37.05645 38.0 38.0 38.0 36.0 38.0 55-59 37.0307 38.0 38.0 38.0 36.0 38.0 60-64 36.9673 38.0 38.0 38.0 35.8 38.0 65-69 36.91905 38.0 38.0 38.0 35.8 38.0 70-74 36.85585 38.0 38.0 38.0 35.4 38.0 75-79 36.70495 38.0 38.0 38.0 34.8 38.0 80-84 36.6504 38.0 38.0 38.0 34.8 38.0 85-89 36.662600000000005 38.0 38.0 38.0 34.8 38.0 90-94 36.540800000000004 38.0 38.0 38.0 34.0 38.0 95-99 36.41555 38.0 38.0 38.0 34.0 38.0 100-104 36.22995 38.0 37.8 38.0 33.6 38.0 105-109 36.07895 38.0 37.4 38.0 33.2 38.0 110-114 35.999700000000004 38.0 37.0 38.0 33.0 38.0 115-119 35.8078 38.0 37.0 38.0 32.0 38.0 120-124 35.631899999999995 38.0 36.8 38.0 31.2 38.0 125-129 35.532650000000004 38.0 36.2 38.0 31.2 38.0 130-134 35.3075 38.0 36.0 38.0 30.8 38.0 135-139 35.078050000000005 38.0 36.0 38.0 29.2 38.0 140-144 34.58874999999999 38.0 35.0 38.0 27.6 38.0 145-149 33.82625 38.0 35.0 38.0 21.4 38.0 150-151 30.515500000000003 36.5 30.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 2.0 10 1.0 11 1.0 12 0.0 13 0.0 14 2.0 15 2.0 16 3.0 17 1.0 18 4.0 19 7.0 20 6.0 21 2.0 22 8.0 23 8.0 24 10.0 25 14.0 26 19.0 27 24.0 28 30.0 29 22.0 30 49.0 31 54.0 32 77.0 33 112.0 34 127.0 35 258.0 36 631.0 37 2526.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.75935288169869 13.01820020222447 10.616784630940344 34.6056622851365 2 25.624999999999996 13.65 29.825000000000003 30.9 3 21.8 18.95 25.650000000000002 33.6 4 21.2 25.45 23.674999999999997 29.675 5 24.5 29.175 23.025000000000002 23.3 6 21.425 33.825 24.375 20.375 7 14.249999999999998 28.225 39.800000000000004 17.724999999999998 8 17.875 26.825 30.925000000000004 24.375 9 17.375 28.125 32.15 22.35 10-14 20.13 29.92 27.13 22.82 15-19 19.8 29.060000000000002 27.685 23.455000000000002 20-24 20.305 29.215000000000003 27.08 23.400000000000002 25-29 20.605 28.865000000000002 27.025 23.505000000000003 30-34 20.575 28.59 27.474999999999998 23.36 35-39 19.845 29.125 27.26 23.77 40-44 19.869999999999997 28.904999999999998 27.575 23.65 45-49 20.11 28.79 27.500000000000004 23.599999999999998 50-54 20.28 28.465 27.015 24.240000000000002 55-59 20.645 28.060000000000002 27.295 24.0 60-64 20.145 28.43 27.415 24.01 65-69 19.755 28.685 27.435 24.125 70-74 20.525 28.87 26.88 23.724999999999998 75-79 20.424999999999997 28.185 27.045 24.345 80-84 20.51 27.900000000000002 27.165 24.425 85-89 20.965 28.025 27.05 23.96 90-94 21.17 28.46 26.665 23.705000000000002 95-99 20.325 28.7 27.0 23.974999999999998 100-104 20.77 28.455000000000002 26.950000000000003 23.825 105-109 20.935000000000002 28.425 26.745 23.895 110-114 21.08 28.235 27.015 23.669999999999998 115-119 20.445 28.49 26.939999999999998 24.125 120-124 20.724999999999998 28.349999999999998 26.525 24.4 125-129 21.240000000000002 28.694999999999997 26.395000000000003 23.669999999999998 130-134 21.615000000000002 27.67 26.634999999999998 24.08 135-139 21.565 27.845 26.1 24.490000000000002 140-144 20.7 27.939999999999998 27.134999999999998 24.224999999999998 145-149 21.19 27.92 27.185 23.705000000000002 150-151 20.25 28.050000000000004 27.3375 24.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 0.5 24 2.0 25 5.5 26 6.0 27 5.5 28 10.0 29 13.0 30 18.5 31 28.0 32 37.5 33 46.5 34 53.0 35 62.0 36 73.5 37 100.0 38 129.5 39 153.5 40 172.5 41 203.5 42 221.5 43 233.5 44 264.5 45 272.0 46 256.5 47 251.0 48 227.5 49 185.5 50 171.5 51 155.0 52 136.0 53 121.0 54 100.0 55 73.0 56 49.0 57 36.5 58 31.0 59 25.5 60 19.0 61 12.5 62 6.5 63 6.5 64 7.5 65 5.5 66 3.0 67 2.0 68 1.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0999999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42094662638469 98.725 2 0.5287009063444109 1.05 3 0.025176233635448138 0.075 4 0.0 0.0 5 0.0 0.0 6 0.025176233635448138 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTGATATCTCGTATGC 6 0.15 TruSeq Adapter, Index 25 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.48750000000000004 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.6 0.0 0.0 0.0 0.0 100-101 0.7125 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 1.0125 0.0 0.0 0.0 0.0 106-107 1.1875 0.0 0.0 0.0 0.0 108-109 1.4375 0.0 0.0 0.0 0.0 110-111 1.675 0.0 0.0 0.0 0.0 112-113 1.9500000000000002 0.0 0.0 0.0 0.0 114-115 2.0375 0.0 0.0 0.0 0.0 116-117 2.275 0.0 0.0 0.0 0.0 118-119 2.4375 0.0 0.0 0.0 0.0 120-121 2.75 0.0 0.0 0.0 0.0 122-123 2.95 0.0 0.0 0.0 0.0 124-125 3.175 0.0 0.0 0.0 0.0 126-127 3.3875 0.0 0.0 0.0 0.0 128-129 3.625 0.0 0.0 0.0 0.0 130-131 3.8875 0.0 0.0 0.0 0.0 132-133 4.25 0.0 0.0 0.0 0.0 134-135 4.6375 0.0 0.0 0.0 0.0 136-137 4.8875 0.0 0.0 0.0 0.0 138-139 5.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169578 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169578_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.746 33.0 33.0 34.0 32.0 34.0 2 32.89375 34.0 33.0 34.0 32.0 34.0 3 32.9105 34.0 33.0 34.0 32.0 34.0 4 32.8545 34.0 33.0 34.0 32.0 34.0 5 32.928 34.0 33.0 34.0 32.0 34.0 6 36.97475 38.0 38.0 38.0 37.0 38.0 7 37.0155 38.0 38.0 38.0 37.0 38.0 8 36.97875 38.0 38.0 38.0 37.0 38.0 9 36.96325 38.0 38.0 38.0 37.0 38.0 10-14 36.965700000000005 38.0 38.0 38.0 36.6 38.0 15-19 36.927400000000006 38.0 38.0 38.0 36.8 38.0 20-24 36.8089 38.0 38.0 38.0 36.0 38.0 25-29 36.801399999999994 38.0 38.0 38.0 35.8 38.0 30-34 36.71795000000001 38.0 38.0 38.0 35.8 38.0 35-39 36.84165 38.0 38.0 38.0 36.0 38.0 40-44 36.81765 38.0 38.0 38.0 36.0 38.0 45-49 36.75895 38.0 38.0 38.0 36.0 38.0 50-54 36.7579 38.0 38.0 38.0 36.0 38.0 55-59 36.65975 38.0 38.0 38.0 36.0 38.0 60-64 36.6297 38.0 38.0 38.0 35.8 38.0 65-69 36.607099999999996 38.0 38.0 38.0 35.2 38.0 70-74 36.50765 38.0 38.0 38.0 35.0 38.0 75-79 36.43655 38.0 38.0 38.0 34.8 38.0 80-84 36.2542 38.0 38.0 38.0 34.0 38.0 85-89 36.24835 38.0 38.0 38.0 34.0 38.0 90-94 36.14565 38.0 38.0 38.0 33.8 38.0 95-99 36.0852 38.0 38.0 38.0 34.0 38.0 100-104 36.0374 38.0 38.0 38.0 33.8 38.0 105-109 35.90475 38.0 38.0 38.0 33.4 38.0 110-114 35.763850000000005 38.0 38.0 38.0 32.6 38.0 115-119 35.55935 38.0 37.0 38.0 31.0 38.0 120-124 35.24825 38.0 37.0 38.0 29.8 38.0 125-129 34.9363 38.0 36.0 38.0 28.0 38.0 130-134 34.6928 38.0 35.8 38.0 27.6 38.0 135-139 34.413850000000004 38.0 35.2 38.0 25.2 38.0 140-144 33.95295 38.0 35.0 38.0 22.6 38.0 145-149 33.25515 38.0 35.0 38.0 15.2 38.0 150-151 29.573 36.5 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 4.0 4 2.0 5 0.0 6 3.0 7 3.0 8 1.0 9 4.0 10 1.0 11 0.0 12 4.0 13 1.0 14 2.0 15 5.0 16 5.0 17 9.0 18 9.0 19 4.0 20 8.0 21 10.0 22 12.0 23 17.0 24 13.0 25 24.0 26 26.0 27 29.0 28 30.0 29 29.0 30 42.0 31 57.0 32 62.0 33 95.0 34 135.0 35 211.0 36 490.0 37 2637.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.768884442221115 21.285642821410704 16.23311655827914 24.712356178089045 2 28.48560700876095 26.307884856070086 27.058823529411764 18.1476846057572 3 20.97622027534418 30.538172715894866 29.486858573216523 18.998748435544428 4 23.829787234042556 33.942428035043804 23.204005006257823 19.02377972465582 5 25.425425425425423 34.35935935935936 21.92192192192192 18.293293293293296 6 22.102628285356694 36.871088861076345 24.030037546933666 16.99624530663329 7 21.537690959178562 22.96518908089156 36.38868019033308 19.108439769596792 8 23.885828743114672 25.237856785177765 26.114171256885328 24.76214321482223 9 21.417835671342687 25.475951903807616 29.10821643286573 23.997995991983966 10-14 23.901071392810653 27.966356263142085 26.4443776909983 21.688194653048964 15-19 23.442270156648817 27.901506431109553 27.07071718132226 21.585506230919375 20-24 23.607772435897438 28.22015224358974 26.782852564102566 21.389222756410255 25-29 23.745618427641464 28.277416124186278 26.629944917376065 21.347020530796193 30-34 23.746120732806087 27.870657723495846 27.380118129942936 21.00310341375513 35-39 23.27188940092166 27.75495892606692 27.444399919855737 21.52875175315568 40-44 23.812625250501 27.955911823647295 26.88877755511022 21.34268537074148 45-49 23.94189832206361 27.56824442774856 27.60831455046331 20.881542699724516 50-54 23.48226808254859 27.990382688839908 26.948507313163695 21.578841915447804 55-59 23.817153156761627 27.371952135382767 27.807540179241975 21.00335452861363 60-64 24.157275231655397 27.618332081142 27.0473328324568 21.177059854745806 65-69 23.759202684429308 27.5504582561226 27.92607802874743 20.764261030700656 70-74 24.11582005811041 27.066426209798617 27.281835487426108 21.535918244664863 75-79 24.355056855182085 27.616089766067226 27.54596002604819 20.4828933527025 80-84 23.730341580687167 27.28638685765802 27.972553340679156 21.010718220975658 85-89 24.398677089597115 27.0695530166366 27.264982962517536 21.266786931248745 90-94 24.46025146521064 27.205329860241445 27.616089766067226 20.71832890848069 95-99 24.116174261392086 26.755132699048573 27.836755132699047 21.29193790686029 100-104 24.492964094346238 27.05193049226301 27.727978366468026 20.727127046922732 105-109 23.949727104301235 27.279555355265135 27.45480947373692 21.31590806669671 110-114 24.322564487853743 27.598297019784624 27.222639619333833 20.8564988730278 115-119 24.293870192307693 27.64423076923077 27.108373397435898 20.953525641025642 120-124 24.592956264716197 27.0226942537949 27.438505084915587 20.945844396573317 125-129 24.123070755662457 28.70314692323111 26.869112046502302 20.304670274604128 130-134 24.388532477947074 28.072373696872493 27.35064153969527 20.188452285485166 135-139 24.3812005210943 27.47770317667101 27.62300831746668 20.518087984768012 140-144 24.6405130517561 27.60158324565359 27.67673731148855 20.08116639110176 145-149 25.509744000801565 27.483593006362405 27.188016632433243 19.818646360402788 150-151 25.275275275275277 27.27727727727728 27.352352352352355 20.095095095095093 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.5 3 0.5 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 2.0 23 2.5 24 1.0 25 0.5 26 1.5 27 4.0 28 5.5 29 5.0 30 8.5 31 12.0 32 16.0 33 21.0 34 26.0 35 37.5 36 55.0 37 78.0 38 113.0 39 145.5 40 175.5 41 204.0 42 225.5 43 257.0 44 284.0 45 290.5 46 299.5 47 290.0 48 260.5 49 230.5 50 188.0 51 163.5 52 147.0 53 115.5 54 81.5 55 67.5 56 53.5 57 31.5 58 23.5 59 20.0 60 14.5 61 9.5 62 7.5 63 4.5 64 4.0 65 2.5 66 1.5 67 3.0 68 1.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.125 3 0.125 4 0.125 5 0.1 6 0.125 7 0.17500000000000002 8 0.15 9 0.2 10-14 0.13 15-19 0.095 20-24 0.16 25-29 0.15 30-34 0.11 35-39 0.18 40-44 0.2 45-49 0.17500000000000002 50-54 0.18 55-59 0.135 60-64 0.17500000000000002 65-69 0.165 70-74 0.19 75-79 0.185 80-84 0.16999999999999998 85-89 0.22 90-94 0.185 95-99 0.15 100-104 0.155 105-109 0.145 110-114 0.17500000000000002 115-119 0.16 120-124 0.19499999999999998 125-129 0.22 130-134 0.24 135-139 0.21 140-144 0.20500000000000002 145-149 0.19499999999999998 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39577039274926 98.7 2 0.5790533736153072 1.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.025176233635448138 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 6 0.15 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.48750000000000004 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.5875 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.8374999999999999 0.0 0.0 0.0 0.0 104-105 0.9874999999999999 0.0 0.0 0.0 0.0 106-107 1.225 0.0 0.0 0.0 0.0 108-109 1.4874999999999998 0.0 0.0 0.0 0.0 110-111 1.75 0.0 0.0 0.0 0.0 112-113 1.9874999999999998 0.0 0.0 0.0 0.0 114-115 2.0999999999999996 0.0 0.0 0.0 0.0 116-117 2.325 0.0 0.0 0.0 0.0 118-119 2.5 0.0 0.0 0.0 0.0 120-121 2.825 0.0 0.0 0.0 0.0 122-123 3.0375 0.0 0.0 0.0 0.0 124-125 3.3375 0.0 0.0 0.0 0.0 126-127 3.6 0.0 0.0 0.0 0.0 128-129 3.8499999999999996 0.0 0.0 0.0 0.0 130-131 4.1 0.0 0.0 0.0 0.0 132-133 4.4125 0.0 0.0 0.0 0.0 134-135 4.7625 0.0 0.0 0.0 0.0 136-137 5.0 0.0 0.0 0.0 0.0 138-139 5.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCACAG 10 0.006830828 145.0 2 AGGTGGT 10 0.006830828 145.0 9 >>END_MODULE Read 957840 spots for SRR7169578.sra Written 957840 spots for SRR7169578.sra Read 957840 spots for SRR7169578.sra Written 957840 spots for SRR7169578.sra Read 957840 spots for SRR7169578.sra Written 957840 spots for SRR7169578.sra Read 957840 spots for SRR7169578.sra Written 957840 spots for SRR7169578.sra Read 957840 spots for SRR7169578.sra Written 957840 spots for SRR7169578.sra Read 957840 spots for SRR7169578.sra Written 957840 spots for SRR7169578.sra Read 957840 spots for SRR7169578.sra Written 957840 spots for SRR7169578.sra Read 957840 spots for SRR7169578.sra Written 957840 spots for SRR7169578.sra Read 957840 spots for SRR7169578.sra Written 957840 spots for SRR7169578.sra Read 957840 spots for SRR7169578.sra Written 957840 spots for SRR7169578.sra Read 957840 spots for SRR7169578.sra Written 957840 spots for SRR7169578.sra Read 957840 spots for SRR7169578.sra Written 957840 spots for SRR7169578.sra Read 957840 spots for SRR7169578.sra Written 957840 spots for SRR7169578.sra Read 957840 spots for SRR7169578.sra Written 957840 spots for SRR7169578.sra Read 957859 spots for SRR7169578.sra Written 957859 spots for SRR7169578.sra Read 957840 spots for SRR7169578.sra Written 957840 spots for SRR7169578.sra Read 957840 spots for SRR7169578.sra Written 957840 spots for SRR7169578.sra Read 957840 spots for SRR7169578.sra Written 957840 spots for SRR7169578.sra Read 957840 spots for SRR7169578.sra Written 957840 spots for SRR7169578.sra Read 957840 spots for SRR7169578.sra Written 957840 spots for SRR7169578.sra SRR ids: ['SRR7169578.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cebjd2hg SRR7169578.sra spots: 19156819 blocks: [[1, 957840], [957841, 1915680], [1915681, 2873520], [2873521, 3831360], [3831361, 4789200], [4789201, 5747040], [5747041, 6704880], [6704881, 7662720], [7662721, 8620560], [8620561, 9578400], [9578401, 10536240], [10536241, 11494080], [11494081, 12451920], [12451921, 13409760], [13409761, 14367600], [14367601, 15325440], [15325441, 16283280], [16283281, 17241120], [17241121, 18198960], [18198961, 19156819]] SRR7169578 file size 6469917 SRR7169578 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169578 SRR7169578_1.fastq SRR7169578_2.fastq Input file: SRR7169578_1.fastq Paired file: SRR7169578_2.fastq trimmed: SRR7169578-trimmed-pair1.fastq, SRR7169578-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 03:51:57 2025 >> started Tue Feb 11 03:56:36 2025 >> done (279.723s) 19156819 read pairs processed; of these: 39666 ( 0.21%) short read pairs filtered out after trimming by size control 76954 ( 0.40%) empty read pairs filtered out after trimming by size control 19040199 (99.39%) read pairs available; of these: 9479078 (49.78%) trimmed read pairs available after processing 9561121 (50.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 5 0.00% 21 7 0.00% 22 5 0.00% 23 6 0.00% 24 5 0.00% 25 13 0.00% 26 5 0.00% 27 9 0.00% 28 10 0.00% 29 7 0.00% 30 17 0.00% 31 5 0.00% 32 11 0.00% 33 17 0.00% 34 18 0.00% 35 20 0.00% 36 11 0.00% 37 21 0.00% 38 22 0.00% 39 18 0.00% 40 23 0.00% 41 35 0.00% 42 22 0.00% 43 40 0.00% 44 49 0.00% 45 32 0.00% 46 47 0.00% 47 46 0.00% 48 67 0.00% 49 72 0.00% 50 95 0.00% 51 81 0.00% 52 124 0.00% 53 138 0.00% 54 138 0.00% 55 130 0.00% 56 181 0.00% 57 215 0.00% 58 201 0.00% 59 257 0.00% 60 231 0.00% 61 312 0.00% 62 392 0.00% 63 429 0.00% 64 459 0.00% 65 569 0.00% 66 663 0.00% 67 884 0.00% 68 1319 0.01% 69 3545 0.02% 70 4170 0.02% 71 2098 0.01% 72 1559 0.01% 73 1568 0.01% 74 1667 0.01% 75 1761 0.01% 76 2056 0.01% 77 2269 0.01% 78 2452 0.01% 79 2870 0.02% 80 3116 0.02% 81 3545 0.02% 82 3980 0.02% 83 4743 0.02% 84 6748 0.04% 85 7770 0.04% 86 7892 0.04% 87 8429 0.04% 88 9098 0.05% 89 9367 0.05% 90 10038 0.05% 91 10539 0.06% 92 11217 0.06% 93 11750 0.06% 94 12400 0.07% 95 13285 0.07% 96 13784 0.07% 97 14603 0.08% 98 15297 0.08% 99 15800 0.08% 100 16735 0.09% 101 17287 0.09% 102 18349 0.10% 103 19537 0.10% 104 20727 0.11% 105 22022 0.12% 106 23408 0.12% 107 23431 0.12% 108 24432 0.13% 109 25529 0.13% 110 26318 0.14% 111 27237 0.14% 112 28657 0.15% 113 30409 0.16% 114 31579 0.17% 115 33157 0.17% 116 34406 0.18% 117 35782 0.19% 118 37066 0.19% 119 37787 0.20% 120 39279 0.21% 121 40830 0.21% 122 42322 0.22% 123 44672 0.23% 124 46636 0.24% 125 48990 0.26% 126 50754 0.27% 127 53825 0.28% 128 56112 0.29% 129 58158 0.31% 130 61565 0.32% 131 63718 0.33% 132 66517 0.35% 133 70305 0.37% 134 74414 0.39% 135 79824 0.42% 136 84530 0.44% 137 89321 0.47% 138 95182 0.50% 139 102601 0.54% 140 109502 0.58% 141 119686 0.63% 142 132121 0.69% 143 148367 0.78% 144 171358 0.90% 145 204133 1.07% 146 255020 1.34% 147 346306 1.82% 148 535705 2.81% 149 994535 5.22% 150 4432029 23.28% 151 9561121 50.22% 19040199 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=39 prefix-density=0.29 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=135.86 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=9.9 sequence=ATATTCATCATAACTCAATTACATTATTCTCACCCAGAACATCTCTTCCAGCAATAGATACAAACCATGGCAATTAACTAGAGCAGAACATCATTTCACAAGGTTTATAAGGAAAGAGACCTCCTTGACTTGGACAAACACTCGTCTATAAGAAACACCCAAATTTCCAACTATTCGGCTGTTTATTTCATTAATAACTGGAGAGCAGGAGATGCCAGTGCCTCAGACAAACTGATCAAGGTACTCTTCTACGGTGGTATATTTGACATCTGGATATAGCTCAGAGGCCTCAAGCCCCCATGATGGGTCAATCTCAAAGTTGGTCATGTCACCATTAACGAGGGCTGAGTGGTTGATTGACAGAACAATATTAATCGGAATCGGAGACTCTTGGATGTCCTTCAGAAGTTTCTCTTCAGGAACAAAGGTTTTTTCGAGGGTTTTGCCAATCTTTTTCTCCCATAGATCAATAAGCTCATTGAATGAGTAGGTGTTTTTAGGAGGCTTGATT criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=42 prefix-density=0.28 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.13 sequence-density-rank=15 fanout-score=34.31 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=8.8 sequence=TCAAGGAAGCTTTCAG SRR7169578 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 04:11:10 Started mapping on | Feb 11 04:11:29 Finished on | Feb 11 04:53:57 Mapping speed, Million of reads per hour | 26.90 Number of input reads | 19040199 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 17857773 Uniquely mapped reads % | 93.79% Average mapped length | 293.36 Number of splices: Total | 15904978 Number of splices: Annotated (sjdb) | 15642244 Number of splices: GT/AG | 15685974 Number of splices: GC/AG | 171564 Number of splices: AT/AC | 14198 Number of splices: Non-canonical | 33242 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.02% Deletion average length | 2.53 Insertion rate per base | 0.02% Insertion average length | 2.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 318585 % of reads mapped to multiple loci | 1.67% Number of reads mapped to too many loci | 19395 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.40% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 897222 897222 897222 N_multimapping 318585 318585 318585 N_noFeature 349642 17604894 443269 N_ambiguous 232117 893 72320 UnstrandedReadsAssigned:17276014 PositiveStrandReadsAssigned:251986 NegativeStrandReadsAssigned:17342184 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169578 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169578-trimmed-pair1.fastq SRR7169578-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,040,199 reads, 17,258,877 reads pseudoaligned [quant] estimated average fragment length: 242.926 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,057 rounds 52401 SRR7169578.ke.tsv 34699 SRR7169578.se.tsv 87100 total ==> SRR7169578.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.07 264 7.9995 Potri.005G024800.1.v4.1 1035 793.074 43 2.91793 Potri.004G059700.1.v4.1 961 719.081 3 0.224525 Potri.007G009000.2.v4.1 1416 1174.07 0 0 Potri.003G141000.2.v4.1 2943 2701.07 292.039 5.81867 Potri.016G087400.1.v4.1 270 78.5625 1563.28 1070.88 Potri.015G069301.1.v4.1 564 325.791 0 0 Potri.010G195200.1.v4.1 1773 1531.07 20 0.702998 Potri.012G127500.1.v4.1 977 735.074 3468 253.903 ==> SRR7169578.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1798 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 273 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 20 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169578 completed mapping pipeline successfully