Starting /dee2/code/volunteer_pipeline.sh SRR7169579 current disk space = 3056975175680 free memory = 1473846972 SRR7169579 SRAfilesize 64323ea754fecd54b6cf3997280a766d SRR7169579.sra SRR7169579.sra file validated SRR7169579 is paired end SRR7169579 is conventional basespace SRR7169579 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169579_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.43275 34.0 33.0 34.0 32.0 34.0 2 33.2105 34.0 33.0 34.0 31.0 34.0 3 33.27025 34.0 33.0 34.0 33.0 34.0 4 33.4005 34.0 33.0 34.0 33.0 34.0 5 33.37275 34.0 33.0 34.0 33.0 34.0 6 36.924 38.0 37.0 38.0 35.0 38.0 7 37.2385 38.0 38.0 38.0 36.0 38.0 8 37.28575 38.0 38.0 38.0 37.0 38.0 9 37.31075 38.0 38.0 38.0 37.0 38.0 10-14 37.3945 38.0 38.0 38.0 37.0 38.0 15-19 37.3173 38.0 38.0 38.0 37.0 38.0 20-24 37.3457 38.0 38.0 38.0 37.0 38.0 25-29 37.28724999999999 38.0 38.0 38.0 36.8 38.0 30-34 37.19755 38.0 38.0 38.0 36.8 38.0 35-39 37.1338 38.0 38.0 38.0 36.4 38.0 40-44 36.8156 38.0 38.0 38.0 35.2 38.0 45-49 36.660000000000004 38.0 38.0 38.0 34.0 38.0 50-54 36.5261 38.0 38.0 38.0 34.0 38.0 55-59 36.36125 38.0 37.6 38.0 33.6 38.0 60-64 36.264700000000005 38.0 37.0 38.0 33.4 38.0 65-69 36.21965 38.0 37.2 38.0 33.4 38.0 70-74 36.2666 38.0 37.0 38.0 33.4 38.0 75-79 36.129850000000005 38.0 37.0 38.0 32.8 38.0 80-84 35.8931 38.0 37.0 38.0 31.8 38.0 85-89 35.7375 38.0 37.0 38.0 30.6 38.0 90-94 35.51535 38.0 36.2 38.0 29.6 38.0 95-99 35.37555 38.0 36.0 38.0 29.0 38.0 100-104 34.99315 38.0 35.8 38.0 28.4 38.0 105-109 34.7749 38.0 35.8 38.0 27.2 38.0 110-114 34.428450000000005 38.0 34.8 38.0 25.0 38.0 115-119 34.17805 38.0 34.4 38.0 23.0 38.0 120-124 34.044799999999995 38.0 34.4 38.0 22.0 38.0 125-129 33.6001 38.0 34.0 38.0 20.6 38.0 130-134 33.310449999999996 38.0 34.0 38.0 16.2 38.0 135-139 32.47855 37.2 33.0 38.0 14.6 38.0 140-144 32.212 37.0 33.0 38.0 14.0 38.0 145-149 31.122750000000003 36.0 31.2 38.0 9.0 38.0 150-151 26.935875000000003 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 2.0 10 0.0 11 0.0 12 3.0 13 4.0 14 1.0 15 2.0 16 13.0 17 6.0 18 14.0 19 8.0 20 8.0 21 11.0 22 16.0 23 18.0 24 16.0 25 19.0 26 35.0 27 33.0 28 45.0 29 53.0 30 71.0 31 79.0 32 104.0 33 168.0 34 244.0 35 453.0 36 984.0 37 1588.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.5887802367473 13.021101389603707 8.311888831703552 36.07822954194545 2 24.975 13.3 31.75 29.975 3 20.424999999999997 16.150000000000002 25.525 37.9 4 23.1 24.075 24.175 28.65 5 24.474999999999998 28.499999999999996 24.15 22.875 6 21.2 31.874999999999996 25.15 21.775 7 15.174999999999999 27.725 39.45 17.65 8 17.125 27.425 30.675 24.775 9 17.45 24.3 34.949999999999996 23.3 10-14 19.715 29.57 27.925 22.79 15-19 20.064999999999998 28.12 27.6 24.215 20-24 19.88 28.52 27.27 24.33 25-29 19.81 28.804999999999996 27.48 23.905 30-34 19.725 28.515 27.74 24.02 35-39 19.72 28.470000000000002 28.115000000000002 23.695 40-44 19.97 28.645 27.705000000000002 23.68 45-49 20.71 28.060000000000002 27.139999999999997 24.09 50-54 20.380000000000003 28.384999999999998 27.495000000000005 23.74 55-59 20.580000000000002 28.04 27.195000000000004 24.185000000000002 60-64 20.285 28.005000000000003 28.155 23.555 65-69 20.255000000000003 28.465 27.275 24.005000000000003 70-74 20.16 28.084999999999997 27.744999999999997 24.01 75-79 20.205000000000002 27.455000000000002 27.91 24.43 80-84 20.31 28.035 27.21 24.445 85-89 19.845 27.955000000000002 28.01 24.19 90-94 20.39 28.044999999999998 27.384999999999998 24.18 95-99 20.215 27.755000000000003 27.83 24.2 100-104 20.61416691714257 27.66255886183749 27.562368500150285 24.160905720869653 105-109 20.265 28.310000000000002 27.334999999999997 24.09 110-114 20.082254990470457 28.00180559735179 27.72595044638379 24.18998896579396 115-119 20.50665865625313 28.121558025433064 27.771102433163115 23.600680885150695 120-124 20.453635089124774 28.03424794712598 27.243140396555177 24.268976567194073 125-129 21.21470058081314 28.044261966753453 26.807530542759867 23.933506909673543 130-134 20.575 28.29 26.974999999999998 24.16 135-139 20.830000000000002 28.475 27.205000000000002 23.49 140-144 20.885 28.115000000000002 27.02 23.98 145-149 21.154999999999998 27.925 26.945000000000004 23.974999999999998 150-151 20.3 27.85 27.175 24.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 0.5 23 0.5 24 1.5 25 3.5 26 3.0 27 5.0 28 8.5 29 9.5 30 13.5 31 22.5 32 26.5 33 35.5 34 44.5 35 55.0 36 71.0 37 98.0 38 125.5 39 156.0 40 177.0 41 199.5 42 233.0 43 232.0 44 258.0 45 290.0 46 281.5 47 284.0 48 257.5 49 215.0 50 189.0 51 153.5 52 127.0 53 105.0 54 78.0 55 58.5 56 46.0 57 37.0 58 25.5 59 17.5 60 16.5 61 10.0 62 8.5 63 6.0 64 3.0 65 2.0 66 2.0 67 1.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.85 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.19 105-109 0.0 110-114 0.31 115-119 0.13 120-124 0.13999999999999999 125-129 0.13999999999999999 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.32499999999999996 0.0 0.0 0.0 0.0 100-101 0.42500000000000004 0.0 0.0 0.0 0.0 102-103 0.4875 0.0 0.0 0.0 0.0 104-105 0.5625 0.0 0.0 0.0 0.0 106-107 0.5874999999999999 0.0 0.0 0.0 0.0 108-109 0.625 0.0 0.0 0.0 0.0 110-111 0.675 0.0 0.0 0.0 0.0 112-113 0.725 0.0 0.0 0.0 0.0 114-115 0.7875 0.0 0.0 0.0 0.0 116-117 0.95 0.0 0.0 0.0 0.0 118-119 1.025 0.0 0.0 0.0 0.0 120-121 1.1625 0.0 0.0 0.0 0.0 122-123 1.275 0.0 0.0 0.0 0.0 124-125 1.4500000000000002 0.0 0.0 0.0 0.0 126-127 1.55 0.0 0.0 0.0 0.0 128-129 1.8125 0.0 0.0 0.0 0.0 130-131 2.0875 0.0 0.0 0.0 0.0 132-133 2.3375 0.0 0.0 0.0 0.0 134-135 2.5875 0.0 0.0 0.0 0.0 136-137 2.8125 0.0 0.0 0.0 0.0 138-139 3.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169579 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169579_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.573 33.0 33.0 34.0 32.0 34.0 2 32.902 34.0 33.0 34.0 32.0 34.0 3 32.88425 34.0 33.0 34.0 32.0 34.0 4 32.84375 34.0 33.0 34.0 32.0 34.0 5 32.84575 34.0 33.0 34.0 32.0 34.0 6 37.0065 38.0 38.0 38.0 37.0 38.0 7 37.13775 38.0 38.0 38.0 37.0 38.0 8 37.14375 38.0 38.0 38.0 37.0 38.0 9 37.0995 38.0 38.0 38.0 36.0 38.0 10-14 37.05215 38.0 38.0 38.0 36.8 38.0 15-19 37.03885 38.0 38.0 38.0 36.6 38.0 20-24 37.00705 38.0 38.0 38.0 36.8 38.0 25-29 37.0565 38.0 38.0 38.0 36.4 38.0 30-34 37.0212 38.0 38.0 38.0 36.6 38.0 35-39 36.912600000000005 38.0 38.0 38.0 36.0 38.0 40-44 36.9188 38.0 38.0 38.0 36.0 38.0 45-49 36.88205000000001 38.0 38.0 38.0 36.0 38.0 50-54 36.61245 38.0 38.0 38.0 35.6 38.0 55-59 36.2812 38.0 38.0 38.0 35.0 38.0 60-64 36.00805 38.0 38.0 38.0 34.2 38.0 65-69 35.8171 38.0 38.0 38.0 34.0 38.0 70-74 35.750550000000004 38.0 38.0 38.0 33.6 38.0 75-79 35.65565 38.0 38.0 38.0 33.4 38.0 80-84 35.752950000000006 38.0 38.0 38.0 33.0 38.0 85-89 35.77785 38.0 38.0 38.0 33.4 38.0 90-94 35.7779 38.0 38.0 38.0 33.4 38.0 95-99 35.627500000000005 38.0 38.0 38.0 32.6 38.0 100-104 35.469449999999995 38.0 38.0 38.0 30.8 38.0 105-109 35.40855 38.0 37.8 38.0 30.2 38.0 110-114 35.3851 38.0 37.4 38.0 31.0 38.0 115-119 35.18295 38.0 37.0 38.0 29.4 38.0 120-124 35.02835 38.0 37.0 38.0 28.4 38.0 125-129 34.691500000000005 38.0 36.0 38.0 27.2 38.0 130-134 34.198299999999996 38.0 35.8 38.0 23.2 38.0 135-139 33.7101 38.0 35.2 38.0 18.6 38.0 140-144 33.30805 38.0 35.0 38.0 14.2 38.0 145-149 32.5587 38.0 34.6 38.0 8.8 38.0 150-151 28.942625 36.0 24.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 1.0 4 1.0 5 0.0 6 2.0 7 1.0 8 2.0 9 2.0 10 1.0 11 11.0 12 9.0 13 20.0 14 20.0 15 4.0 16 3.0 17 5.0 18 12.0 19 7.0 20 13.0 21 10.0 22 17.0 23 14.0 24 26.0 25 27.0 26 29.0 27 47.0 28 38.0 29 39.0 30 52.0 31 56.0 32 67.0 33 85.0 34 100.0 35 189.0 36 457.0 37 2626.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.02014098690836 23.66565961732125 13.746223564954683 27.567975830815712 2 29.575000000000003 26.375 26.875 17.175 3 20.45 28.075 30.85 20.625 4 24.0 33.6 25.2 17.2 5 25.924999999999997 35.175 21.3 17.599999999999998 6 20.825 38.4 22.6 18.175 7 20.349999999999998 23.65 36.825 19.175 8 22.975 25.424999999999997 26.724999999999998 24.875 9 21.45 25.2 30.325000000000003 23.025000000000002 10-14 23.47 28.985 26.179999999999996 21.365000000000002 15-19 23.41 28.175 27.005000000000003 21.41 20-24 22.91 28.955 26.965 21.17 25-29 23.755000000000003 27.644999999999996 27.465 21.135 30-34 23.605 28.384999999999998 26.91 21.099999999999998 35-39 23.49 28.044999999999998 27.245 21.22 40-44 23.755000000000003 27.92 27.534999999999997 20.79 45-49 23.369999999999997 27.85 27.71 21.07 50-54 24.330704706414185 28.007433823898744 27.058114420613794 20.603747049073284 55-59 24.228269699431358 28.00060926076361 27.39134849715678 20.379772542648254 60-64 23.787151465631702 28.020631191910937 27.515064855479523 20.67715248697784 65-69 23.824162311712264 27.139051132288145 28.363561840352496 20.673224715647095 70-74 24.443646805455852 28.02789457491539 27.315147164393395 20.21331145523536 75-79 23.091916290521134 28.077554370127206 28.01600328272466 20.814526056627 80-84 23.757216573851732 28.110151739641342 27.103663209523322 21.0289684769836 85-89 24.1807449623448 27.849582739670264 27.121921432933032 20.847750865051903 90-94 23.79187817258883 27.83248730964467 27.446700507614214 20.928934010152282 95-99 24.615774790768448 27.735226984529547 27.3649505452701 20.284047679431904 100-104 24.9456823808802 28.10873629427518 26.64342377848517 20.302157546359457 105-109 24.68817855880422 28.000807958390144 27.505933444427612 19.805080038378023 110-114 24.219498663438745 27.775255964089375 27.54829273213295 20.456952640338933 115-119 24.224572004028197 28.293051359516618 27.054380664652566 20.427995971802616 120-124 23.80688683044704 28.005436971405555 27.5926298832058 20.595046314941605 125-129 24.76888103056327 27.774690578428896 27.213942914877492 20.242485476130337 130-134 24.860221612280167 28.33689132865711 27.23391277828606 19.56897428077666 135-139 24.27804753386149 27.758752875031945 27.02785586506517 20.9353437260414 140-144 25.093402937714316 28.43543681867035 26.940989815241313 19.53017042837402 145-149 25.125679696316816 27.77264799425464 26.746691289627577 20.354981019800963 150-151 23.840719332048813 28.59344894026975 27.14193962748876 20.423892100192678 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 2.0 17 3.5 18 2.5 19 3.5 20 4.5 21 5.0 22 5.0 23 7.0 24 8.5 25 8.0 26 9.5 27 8.5 28 7.5 29 8.0 30 13.0 31 18.0 32 16.0 33 23.5 34 39.5 35 50.0 36 61.0 37 76.5 38 99.5 39 136.0 40 183.0 41 228.5 42 247.5 43 278.5 44 307.0 45 307.5 46 301.0 47 280.5 48 253.0 49 220.5 50 176.5 51 132.5 52 119.5 53 90.5 54 62.5 55 55.5 56 35.5 57 24.0 58 20.5 59 15.5 60 11.0 61 8.5 62 6.5 63 5.5 64 3.5 65 2.0 66 2.0 67 1.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7000000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.455 55-59 1.52 60-64 2.09 65-69 2.41 70-74 2.4899999999999998 75-79 2.52 80-84 2.1350000000000002 85-89 1.7399999999999998 90-94 1.5 95-99 1.425 100-104 1.045 105-109 0.985 110-114 0.865 115-119 0.7000000000000001 120-124 0.6799999999999999 125-129 1.0250000000000001 130-134 1.63 135-139 2.175 140-144 2.305 145-149 2.53 150-151 2.6875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67361285463218 99.25 2 0.25106703489831783 0.5 3 0.05021340697966357 0.15 4 0.025106703489831784 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.30000000000000004 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.5375000000000001 0.0 0.0 0.0 0.0 106-107 0.5625 0.0 0.0 0.0 0.0 108-109 0.6 0.0 0.0 0.0 0.0 110-111 0.65 0.0 0.0 0.0 0.0 112-113 0.7 0.0 0.0 0.0 0.0 114-115 0.7625 0.0 0.0 0.0 0.0 116-117 0.9624999999999999 0.0 0.0 0.0 0.0 118-119 1.0499999999999998 0.0 0.0 0.0 0.0 120-121 1.1875 0.0 0.0 0.0 0.0 122-123 1.2875 0.0 0.0 0.0 0.0 124-125 1.4375 0.0 0.0 0.0 0.0 126-127 1.5375 0.0 0.0 0.0 0.0 128-129 1.775 0.0 0.0 0.0 0.0 130-131 2.0375 0.0 0.0 0.0 0.0 132-133 2.2750000000000004 0.0 0.0 0.0 0.0 134-135 2.5125 0.0 0.0 0.0 0.0 136-137 2.75 0.0 0.0 0.0 0.0 138-139 3.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 825688 spots for SRR7169579.sra Written 825688 spots for SRR7169579.sra Read 825688 spots for SRR7169579.sra Written 825688 spots for SRR7169579.sra Read 825688 spots for SRR7169579.sra Written 825688 spots for SRR7169579.sra Read 825688 spots for SRR7169579.sra Written 825688 spots for SRR7169579.sra Read 825688 spots for SRR7169579.sra Written 825688 spots for SRR7169579.sra Read 825689 spots for SRR7169579.sra Written 825689 spots for SRR7169579.sra Read 825688 spots for SRR7169579.sra Written 825688 spots for SRR7169579.sra Read 825688 spots for SRR7169579.sra Written 825688 spots for SRR7169579.sra Read 825688 spots for SRR7169579.sra Written 825688 spots for SRR7169579.sra Read 825688 spots for SRR7169579.sra Written 825688 spots for SRR7169579.sra Read 825688 spots for SRR7169579.sra Written 825688 spots for SRR7169579.sra Read 825688 spots for SRR7169579.sra Written 825688 spots for SRR7169579.sra Read 825688 spots for SRR7169579.sra Written 825688 spots for SRR7169579.sra Read 825688 spots for SRR7169579.sra Written 825688 spots for SRR7169579.sra Read 825688 spots for SRR7169579.sra Written 825688 spots for SRR7169579.sra Read 825688 spots for SRR7169579.sra Written 825688 spots for SRR7169579.sra Read 825688 spots for SRR7169579.sra Written 825688 spots for SRR7169579.sra Read 825688 spots for SRR7169579.sra Written 825688 spots for SRR7169579.sra Read 825688 spots for SRR7169579.sra Written 825688 spots for SRR7169579.sra Read 825688 spots for SRR7169579.sra Written 825688 spots for SRR7169579.sra SRR ids: ['SRR7169579.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_b6t0hnka SRR7169579.sra spots: 16513761 blocks: [[1, 825688], [825689, 1651376], [1651377, 2477064], [2477065, 3302752], [3302753, 4128440], [4128441, 4954128], [4954129, 5779816], [5779817, 6605504], [6605505, 7431192], [7431193, 8256880], [8256881, 9082568], [9082569, 9908256], [9908257, 10733944], [10733945, 11559632], [11559633, 12385320], [12385321, 13211008], [13211009, 14036696], [14036697, 14862384], [14862385, 15688072], [15688073, 16513761]] SRR7169579 file size 5574271 SRR7169579 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169579 SRR7169579_1.fastq SRR7169579_2.fastq Input file: SRR7169579_1.fastq Paired file: SRR7169579_2.fastq trimmed: SRR7169579-trimmed-pair1.fastq, SRR7169579-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 03:42:46 2025 >> started Tue Feb 11 03:48:34 2025 >> done (348.009s) 16513761 read pairs processed; of these: 16796 ( 0.10%) short read pairs filtered out after trimming by size control 19456 ( 0.12%) empty read pairs filtered out after trimming by size control 16477509 (99.78%) read pairs available; of these: 8034310 (48.76%) trimmed read pairs available after processing 8443199 (51.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 1 0.00% 21 4 0.00% 22 4 0.00% 23 5 0.00% 24 5 0.00% 25 5 0.00% 26 2 0.00% 27 7 0.00% 28 8 0.00% 29 14 0.00% 30 15 0.00% 31 6 0.00% 32 14 0.00% 33 15 0.00% 34 11 0.00% 35 11 0.00% 36 23 0.00% 37 29 0.00% 38 13 0.00% 39 26 0.00% 40 33 0.00% 41 32 0.00% 42 33 0.00% 43 35 0.00% 44 36 0.00% 45 37 0.00% 46 43 0.00% 47 43 0.00% 48 57 0.00% 49 75 0.00% 50 69 0.00% 51 77 0.00% 52 90 0.00% 53 98 0.00% 54 124 0.00% 55 121 0.00% 56 118 0.00% 57 124 0.00% 58 161 0.00% 59 216 0.00% 60 194 0.00% 61 228 0.00% 62 271 0.00% 63 325 0.00% 64 330 0.00% 65 379 0.00% 66 440 0.00% 67 496 0.00% 68 589 0.00% 69 677 0.00% 70 800 0.00% 71 894 0.01% 72 1008 0.01% 73 1201 0.01% 74 1481 0.01% 75 2241 0.01% 76 1612 0.01% 77 837 0.01% 78 1235 0.01% 79 2103 0.01% 80 3965 0.02% 81 1467 0.01% 82 1666 0.01% 83 1904 0.01% 84 2796 0.02% 85 3434 0.02% 86 3918 0.02% 87 4234 0.03% 88 3976 0.02% 89 4139 0.03% 90 4558 0.03% 91 4811 0.03% 92 5347 0.03% 93 5914 0.04% 94 6263 0.04% 95 7072 0.04% 96 7517 0.05% 97 8999 0.05% 98 11067 0.07% 99 16666 0.10% 100 20644 0.13% 101 11818 0.07% 102 9503 0.06% 103 9950 0.06% 104 10448 0.06% 105 11335 0.07% 106 11977 0.07% 107 12638 0.08% 108 13214 0.08% 109 13734 0.08% 110 14540 0.09% 111 15648 0.09% 112 16184 0.10% 113 17744 0.11% 114 18421 0.11% 115 19590 0.12% 116 20808 0.13% 117 21958 0.13% 118 22920 0.14% 119 24001 0.15% 120 25095 0.15% 121 26076 0.16% 122 27688 0.17% 123 29580 0.18% 124 31122 0.19% 125 32901 0.20% 126 34659 0.21% 127 36875 0.22% 128 39123 0.24% 129 41236 0.25% 130 43422 0.26% 131 46558 0.28% 132 49213 0.30% 133 52773 0.32% 134 56555 0.34% 135 60426 0.37% 136 65521 0.40% 137 70968 0.43% 138 77126 0.47% 139 84373 0.51% 140 92428 0.56% 141 101545 0.62% 142 113568 0.69% 143 127846 0.78% 144 150665 0.91% 145 182565 1.11% 146 234510 1.42% 147 324273 1.97% 148 492869 2.99% 149 942706 5.72% 150 3894068 23.63% 151 8443199 51.24% 16477509 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=43 prefix-density=0.19 prefix-fanout=1.9 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGGATTGTGCGCTTGGTCTTGATGGTAGCCACAGCTGCATTCACATCCTTGGGCACAACATCACCTCTATACATCAGGCAGCAAGCCATGTACTTGCCATGACGTGGGTCACACTTGGCCATCATGGATGATGGCTCAAAAGCACTGTTGGTTATCTCAGCCACAGAGAGCTGCTCATGGTATGCCTTCTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=43 fanout-score=233.60 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=17.7 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCGTGGGAGATTTTGTCCCAGTAACTGGGATCAGCCTTGCACTTCTCAAAGAAGTCAAC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.60 fanout-score-rank=36 prefix-density=0.22 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.04 sequence-density-rank=44 fanout-score=184.51 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=15.9 sequence=AGAAAGAAATGAGAATTCTCATGGTGGGTCTTGATGCTGCTGGTAAGACCACCATCTTGTACAAGCTCAA SRR7169579 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 05:45:28 Started mapping on | Feb 11 05:45:51 Finished on | Feb 11 07:33:15 Mapping speed, Million of reads per hour | 9.21 Number of input reads | 16477509 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 15476615 Uniquely mapped reads % | 93.93% Average mapped length | 294.93 Number of splices: Total | 14440585 Number of splices: Annotated (sjdb) | 14188804 Number of splices: GT/AG | 14217237 Number of splices: GC/AG | 173414 Number of splices: AT/AC | 12005 Number of splices: Non-canonical | 37929 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.74 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 284497 % of reads mapped to multiple loci | 1.73% Number of reads mapped to too many loci | 23513 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.07% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 733282 733282 733282 N_multimapping 284497 284497 284497 N_noFeature 322500 15295974 399350 N_ambiguous 166249 1009 61889 UnstrandedReadsAssigned:14987866 PositiveStrandReadsAssigned:179632 NegativeStrandReadsAssigned:15015376 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169579 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169579-trimmed-pair1.fastq SRR7169579-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,477,509 reads, 14,920,742 reads pseudoaligned [quant] estimated average fragment length: 252.631 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,163 rounds 52401 SRR7169579.ke.tsv 34699 SRR7169579.se.tsv 87100 total ==> SRR7169579.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.37 258 8.97384 Potri.005G024800.1.v4.1 1035 783.369 19 1.49014 Potri.004G059700.1.v4.1 961 709.406 2 0.173211 Potri.007G009000.2.v4.1 1416 1164.37 0 0 Potri.003G141000.2.v4.1 2943 2691.37 277.039 6.32422 Potri.016G087400.1.v4.1 270 71.2629 1303.99 1124.22 Potri.015G069301.1.v4.1 564 316.765 0 0 Potri.010G195200.1.v4.1 1773 1521.37 62 2.50378 Potri.012G127500.1.v4.1 977 725.381 6820 577.641 ==> SRR7169579.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1671 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 272 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169579 completed mapping pipeline successfully