Starting /dee2/code/volunteer_pipeline.sh SRR7169580 current disk space = 3054916980736 free memory = 1418096456 SRR7169580 SRAfilesize 26dd10c2a976d0915f2781deb86acbcf SRR7169580.sra SRR7169580.sra file validated SRR7169580 is paired end SRR7169580 is conventional basespace SRR7169580 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169580_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.00625 34.0 33.0 34.0 33.0 34.0 2 33.43925 34.0 34.0 34.0 33.0 34.0 3 33.4755 34.0 34.0 34.0 33.0 34.0 4 33.527 34.0 34.0 34.0 33.0 34.0 5 33.52475 34.0 34.0 34.0 33.0 34.0 6 37.206 38.0 38.0 38.0 36.0 38.0 7 37.2935 38.0 38.0 38.0 37.0 38.0 8 37.0635 38.0 38.0 38.0 36.0 38.0 9 37.48475 38.0 38.0 38.0 37.0 38.0 10-14 37.53444999999999 38.0 38.0 38.0 37.2 38.0 15-19 37.506 38.0 38.0 38.0 37.4 38.0 20-24 37.53605 38.0 38.0 38.0 38.0 38.0 25-29 37.528749999999995 38.0 38.0 38.0 37.6 38.0 30-34 37.545049999999996 38.0 38.0 38.0 37.8 38.0 35-39 37.39325 38.0 38.0 38.0 37.2 38.0 40-44 37.3258 38.0 38.0 38.0 36.8 38.0 45-49 37.36755000000001 38.0 38.0 38.0 37.0 38.0 50-54 37.331399999999995 38.0 38.0 38.0 37.0 38.0 55-59 37.25795 38.0 38.0 38.0 37.0 38.0 60-64 37.2106 38.0 38.0 38.0 36.6 38.0 65-69 37.17675 38.0 38.0 38.0 36.4 38.0 70-74 37.1221 38.0 38.0 38.0 36.0 38.0 75-79 37.029849999999996 38.0 38.0 38.0 36.0 38.0 80-84 36.96995 38.0 38.0 38.0 36.0 38.0 85-89 36.96485 38.0 38.0 38.0 36.0 38.0 90-94 36.796850000000006 38.0 38.0 38.0 35.4 38.0 95-99 36.67875 38.0 38.0 38.0 35.0 38.0 100-104 36.54885 38.0 38.0 38.0 34.4 38.0 105-109 36.4724 38.0 38.0 38.0 34.0 38.0 110-114 36.352199999999996 38.0 38.0 38.0 34.0 38.0 115-119 36.241049999999994 38.0 38.0 38.0 33.8 38.0 120-124 36.029450000000004 38.0 37.2 38.0 33.2 38.0 125-129 35.9346 38.0 37.2 38.0 33.0 38.0 130-134 35.6659 38.0 36.4 38.0 31.8 38.0 135-139 35.353699999999996 38.0 36.0 38.0 30.4 38.0 140-144 35.0464 38.0 36.0 38.0 29.4 38.0 145-149 34.4067 38.0 35.0 38.0 27.6 38.0 150-151 31.0175 36.5 30.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 2.0 15 3.0 16 1.0 17 0.0 18 4.0 19 7.0 20 1.0 21 5.0 22 5.0 23 6.0 24 7.0 25 8.0 26 10.0 27 17.0 28 31.0 29 28.0 30 36.0 31 43.0 32 50.0 33 86.0 34 126.0 35 218.0 36 523.0 37 2782.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.55081300813008 11.026422764227641 10.899390243902438 40.52337398373984 2 22.1 13.25 33.324999999999996 31.324999999999996 3 20.3 17.349999999999998 24.8 37.55 4 23.95 23.575 22.35 30.125 5 23.674999999999997 29.4 23.275000000000002 23.65 6 20.974999999999998 33.074999999999996 23.25 22.7 7 14.975 27.975 39.7 17.349999999999998 8 16.875 27.0 31.724999999999998 24.4 9 17.4 24.375 34.2 24.025 10-14 19.785 29.845 27.16 23.21 15-19 19.73 28.675 27.439999999999998 24.154999999999998 20-24 20.135 28.645 27.834999999999997 23.385 25-29 19.64 28.715000000000003 27.584999999999997 24.060000000000002 30-34 19.605 29.465000000000003 27.05 23.880000000000003 35-39 19.919999999999998 28.99 27.060000000000002 24.03 40-44 20.29 28.665000000000003 27.065 23.98 45-49 19.93 28.76 27.115000000000002 24.195 50-54 20.21 28.360000000000003 27.384999999999998 24.044999999999998 55-59 20.155 28.54 27.55 23.755000000000003 60-64 20.18 28.970000000000002 26.810000000000002 24.04 65-69 20.43 28.43 26.919999999999998 24.22 70-74 20.4 28.549999999999997 27.384999999999998 23.665 75-79 20.41 28.050000000000004 27.715 23.825 80-84 20.54 28.335 27.045 24.08 85-89 20.405 28.610000000000003 26.900000000000002 24.085 90-94 20.315 28.22 27.685 23.78 95-99 20.53 27.839999999999996 27.57 24.060000000000002 100-104 20.995 28.044999999999998 27.655 23.305 105-109 21.516075803790187 27.471373568678437 27.551377568878443 23.461173058652932 110-114 20.91 28.610000000000003 26.705000000000002 23.775 115-119 21.19 28.34 26.534999999999997 23.935000000000002 120-124 21.115000000000002 28.470000000000002 26.575 23.84 125-129 21.575 28.105000000000004 26.045 24.275 130-134 21.05 28.1 26.58 24.27 135-139 21.044999999999998 28.32 26.665 23.97 140-144 21.12 28.044999999999998 26.474999999999998 24.36 145-149 21.235 28.475 26.195 24.095 150-151 20.8125 28.475 25.837500000000002 24.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 0.5 21 0.5 22 0.5 23 1.5 24 2.5 25 1.5 26 4.0 27 6.5 28 7.0 29 10.5 30 17.5 31 22.5 32 24.0 33 35.0 34 48.0 35 56.0 36 69.5 37 94.0 38 119.0 39 146.5 40 170.5 41 184.5 42 236.0 43 281.5 44 280.0 45 278.5 46 277.5 47 277.5 48 257.5 49 217.5 50 179.0 51 147.0 52 131.5 53 110.0 54 76.5 55 56.5 56 47.5 57 33.5 58 22.0 59 17.0 60 10.5 61 5.5 62 7.5 63 6.5 64 5.0 65 4.0 66 2.0 67 2.0 68 1.5 69 1.5 70 2.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.005 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49698189134809 98.9 2 0.45271629778672035 0.8999999999999999 3 0.025150905432595575 0.075 4 0.0 0.0 5 0.025150905432595575 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGAGAAATCTCGTATGC 5 0.125 TruSeq Adapter, Index 2 (97% over 36bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.36250000000000004 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.525 0.0 0.0 0.0 0.0 88-89 0.6499999999999999 0.0 0.0 0.0 0.0 90-91 0.7749999999999999 0.0 0.0 0.0 0.0 92-93 0.9125 0.0 0.0 0.0 0.0 94-95 1.1 0.0 0.0 0.0 0.0 96-97 1.25 0.0 0.0 0.0 0.0 98-99 1.5 0.0 0.0 0.0 0.0 100-101 1.8 0.0 0.0 0.0 0.0 102-103 2.0375 0.0 0.0 0.0 0.0 104-105 2.2375 0.0 0.0 0.0 0.0 106-107 2.4375 0.0 0.0 0.0 0.0 108-109 2.7750000000000004 0.0 0.0 0.0 0.0 110-111 3.0375 0.0 0.0 0.0 0.0 112-113 3.325 0.0 0.0 0.0 0.0 114-115 3.7874999999999996 0.0 0.0 0.0 0.0 116-117 4.275 0.0 0.0 0.0 0.0 118-119 4.75 0.0 0.0 0.0 0.0 120-121 5.125 0.0 0.0 0.0 0.0 122-123 5.5875 0.0 0.0 0.0 0.0 124-125 5.9375 0.0 0.0 0.0 0.0 126-127 6.3125 0.0 0.0 0.0 0.0 128-129 6.775 0.0 0.0 0.0 0.0 130-131 7.3875 0.0 0.0 0.0 0.0 132-133 8.25 0.0 0.0 0.0 0.0 134-135 8.9625 0.0 0.0 0.0 0.0 136-137 9.675 0.0 0.0 0.0 0.0 138-139 10.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAAATAA 10 0.006832588 144.9875 7 CTTTTTA 10 0.006832588 144.9875 3 >>END_MODULE SRR7169580 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169580_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.98025 32.0 30.0 33.0 18.0 33.0 2 30.4765 33.0 31.0 33.0 18.0 34.0 3 30.681 33.0 31.0 33.0 25.0 34.0 4 30.41125 33.0 31.0 33.0 25.0 34.0 5 30.321 33.0 31.0 33.0 25.0 34.0 6 33.809 37.0 33.0 38.0 16.0 38.0 7 34.0425 38.0 34.0 38.0 26.0 38.0 8 34.02825 38.0 34.0 38.0 26.0 38.0 9 34.0805 38.0 34.0 38.0 26.0 38.0 10-14 34.0184 38.0 34.0 38.0 22.0 38.0 15-19 33.985499999999995 38.0 34.0 38.0 24.0 38.0 20-24 33.81305 38.0 33.6 38.0 20.8 38.0 25-29 33.5595 37.6 33.2 38.0 16.0 38.0 30-34 33.15560000000001 37.0 32.2 38.0 16.0 38.0 35-39 33.079049999999995 37.0 31.6 38.0 16.0 38.0 40-44 33.21625 37.0 32.6 38.0 16.0 38.0 45-49 33.168150000000004 37.0 33.0 38.0 16.0 38.0 50-54 33.0909 37.0 32.2 38.0 16.0 38.0 55-59 32.97175 37.0 31.0 38.0 16.0 38.0 60-64 32.753750000000004 37.0 31.0 38.0 16.0 38.0 65-69 32.51635 37.0 30.6 38.0 16.0 38.0 70-74 32.263549999999995 37.0 29.0 38.0 16.0 38.0 75-79 31.7555 36.0 28.8 38.0 16.0 38.0 80-84 31.481600000000004 36.0 29.0 38.0 15.4 38.0 85-89 31.14345 36.0 28.0 38.0 15.0 38.0 90-94 30.769149999999996 36.0 27.4 38.0 15.0 38.0 95-99 30.580099999999998 36.0 26.8 38.0 15.0 38.0 100-104 29.972500000000004 35.0 25.8 38.0 15.0 38.0 105-109 29.4404 34.2 24.0 38.0 14.6 38.0 110-114 28.59605 34.0 22.6 38.0 13.4 38.0 115-119 28.227500000000003 34.0 18.2 38.0 13.0 38.0 120-124 27.24565 33.8 15.0 37.4 2.0 38.0 125-129 26.1988 32.2 15.0 37.0 2.0 38.0 130-134 25.13375 31.0 14.0 36.6 2.0 38.0 135-139 23.868900000000004 30.2 13.4 36.0 2.0 38.0 140-144 21.898199999999996 27.4 4.2 34.8 2.0 38.0 145-149 19.477 21.8 2.0 33.8 2.0 38.0 150-151 14.407250000000001 2.0 2.0 32.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 23.0 3 12.0 4 0.0 5 4.0 6 4.0 7 5.0 8 7.0 9 11.0 10 8.0 11 13.0 12 19.0 13 9.0 14 20.0 15 36.0 16 32.0 17 37.0 18 49.0 19 56.0 20 57.0 21 57.0 22 72.0 23 72.0 24 97.0 25 99.0 26 146.0 27 130.0 28 165.0 29 199.0 30 256.0 31 315.0 32 303.0 33 360.0 34 359.0 35 401.0 36 411.0 37 156.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.272613380105234 21.69882235028815 16.637434227010775 29.391130042595844 2 26.634928589325984 27.411676271611125 27.68729641693811 18.26609872212478 3 20.621398145828113 28.288649461287896 29.942370333249812 21.147582059634175 4 23.62816336757705 32.272613380105234 23.95389626659985 20.145326985717865 5 24.429967426710096 35.42971686294162 22.726133801052367 17.414181909295916 6 21.348033074417437 36.10623903783513 23.12703583061889 19.41869205712854 7 20.446003507892758 21.373089451265347 39.13806063643197 19.04284640440992 8 22.149837133550488 26.158857429215736 26.73515409671762 24.95615134051616 9 21.373089451265347 23.803558005512404 31.145076421949387 23.678276121272866 10-14 23.34486042199168 28.166190547787302 26.497268581165738 21.991680449055277 15-19 23.695684859419636 27.324211897960204 27.163835012278852 21.8162682303413 20-24 23.57010376459973 28.287132187077045 26.98882149481177 21.153942553511452 25-29 23.02060873489445 28.130170987313846 27.393070250213107 21.456150027578598 30-34 23.24310776942356 28.43107769423559 26.741854636591476 21.583959899749374 35-39 23.106990729140566 28.749686795289403 26.935605111500877 21.207717364069158 40-44 23.53000150383478 27.94125018797935 27.851020101258207 20.677728206927664 45-49 24.052726543704892 27.13512429831596 28.127506014434644 20.684643143544506 50-54 23.62169206094627 27.07999198075381 28.162590216519646 21.135725741780274 55-59 23.62287604631347 28.033682522179337 27.682822916144556 20.66061851536264 60-64 24.141733072720896 27.31418834260512 27.92562521926527 20.61845336540871 65-69 23.78923092349343 27.840168454828035 27.208462849694175 21.16213777198436 70-74 24.184087832756806 27.72346718804833 27.282298089938333 20.81014688925653 75-79 23.25546420693804 28.183276518949267 27.160617605775016 21.400641668337677 80-84 23.81931214278552 27.64965406597814 27.67472174872155 20.85631204251479 85-89 23.98074319241763 28.15806629557194 27.29552178927837 20.56566872273206 90-94 24.30318828955284 27.95267696009625 27.396230198516143 20.34790455183477 95-99 24.324459818519077 27.803679751341054 27.166992530205043 20.70486789993483 100-104 23.989177814519767 28.24790821183426 27.19074101908913 20.57217295455684 105-109 24.15330661322645 27.895791583166336 27.434869739478955 20.516032064128257 110-114 24.00380933286552 28.32439476717959 27.006165104506042 20.66563079544885 115-119 24.51127819548872 28.225563909774436 27.16290726817043 20.100250626566414 120-124 24.598876855194547 28.419574809466507 26.94043321299639 20.04111512234256 125-129 25.218132584495034 27.77053455019557 26.69240798315114 20.31892488215826 130-134 24.916010630296345 29.05781477210049 25.783482926340067 20.2426916712631 135-139 25.831202046035806 28.383732009427813 25.90642395065443 19.878641993881953 140-144 25.49874686716792 29.308270676691727 25.69423558897243 19.49874686716792 145-149 25.66274116762716 28.945126534703082 25.602605863192185 19.789526434477576 150-151 24.499248873309966 29.819729594391585 26.164246369554334 19.516775162744114 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 7.0 1 4.5 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 0.5 24 1.0 25 0.5 26 0.0 27 0.5 28 2.5 29 6.0 30 8.0 31 9.0 32 12.5 33 19.0 34 31.5 35 55.0 36 77.0 37 90.0 38 113.5 39 145.0 40 172.0 41 229.5 42 263.5 43 274.0 44 298.5 45 294.5 46 288.5 47 267.5 48 243.5 49 231.5 50 198.5 51 160.0 52 125.0 53 93.5 54 73.5 55 54.5 56 38.5 57 33.5 58 25.0 59 13.5 60 8.0 61 5.5 62 4.5 63 4.0 64 4.5 65 3.5 66 3.5 67 3.0 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.22499999999999998 3 0.22499999999999998 4 0.22499999999999998 5 0.22499999999999998 6 0.22499999999999998 7 0.22499999999999998 8 0.22499999999999998 9 0.22499999999999998 10-14 0.23500000000000001 15-19 0.23500000000000001 20-24 0.255 25-29 0.28500000000000003 30-34 0.25 35-39 0.22499999999999998 40-44 0.255 45-49 0.24 50-54 0.24 55-59 0.245 60-64 0.23500000000000001 65-69 0.27 70-74 0.265 75-79 0.26 80-84 0.27 85-89 0.295 90-94 0.26 95-99 0.265 100-104 0.20500000000000002 105-109 0.2 110-114 0.245 115-119 0.25 120-124 0.27999999999999997 125-129 0.29 130-134 0.28500000000000003 135-139 0.295 140-144 0.25 145-149 0.22499999999999998 150-151 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59748427672956 98.97500000000001 2 0.3522012578616352 0.7000000000000001 3 0.0 0.0 4 0.025157232704402514 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025157232704402514 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.07500000000000001 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.3375 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.4375 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.625 0.0 0.0 0.0 0.0 90-91 0.75 0.0 0.0 0.0 0.0 92-93 0.8875 0.0 0.0 0.0 0.0 94-95 1.0375 0.0 0.0 0.0 0.0 96-97 1.1749999999999998 0.0 0.0 0.0 0.0 98-99 1.4 0.0 0.0 0.0 0.0 100-101 1.6875 0.0 0.0 0.0 0.0 102-103 1.8875 0.0 0.0 0.0 0.0 104-105 2.0625 0.0 0.0 0.0 0.0 106-107 2.2249999999999996 0.0 0.0 0.0 0.0 108-109 2.5 0.0 0.0 0.0 0.0 110-111 2.7249999999999996 0.0 0.0 0.0 0.0 112-113 2.9375 0.0 0.0 0.0 0.0 114-115 3.35 0.0 0.0 0.0 0.0 116-117 3.7375 0.0 0.0 0.0 0.0 118-119 4.0625 0.0 0.0 0.0 0.0 120-121 4.375 0.0 0.0 0.0 0.0 122-123 4.762499999999999 0.0 0.0 0.0 0.0 124-125 5.1125 0.0 0.0 0.0 0.0 126-127 5.525 0.0 0.0 0.0 0.0 128-129 5.875 0.0 0.0 0.0 0.0 130-131 6.35 0.0 0.0 0.0 0.0 132-133 7.05 0.0 0.0 0.0 0.0 134-135 7.5875 0.0 0.0 0.0 0.0 136-137 8.225000000000001 0.0 0.0 0.0 0.0 138-139 8.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGTCAT 10 0.006830828 145.0 2 AAGATGG 10 0.006830828 145.0 5 TCATGGT 10 0.006830828 145.0 5 >>END_MODULE Read 1120841 spots for SRR7169580.sra Written 1120841 spots for SRR7169580.sra Read 1120853 spots for SRR7169580.sra Written 1120853 spots for SRR7169580.sra Read 1120841 spots for SRR7169580.sra Written 1120841 spots for SRR7169580.sra Read 1120841 spots for SRR7169580.sra Written 1120841 spots for SRR7169580.sra Read 1120841 spots for SRR7169580.sra Written 1120841 spots for SRR7169580.sra Read 1120841 spots for SRR7169580.sra Written 1120841 spots for SRR7169580.sra Read 1120841 spots for SRR7169580.sra Written 1120841 spots for SRR7169580.sra Read 1120841 spots for SRR7169580.sra Written 1120841 spots for SRR7169580.sra Read 1120841 spots for SRR7169580.sra Written 1120841 spots for SRR7169580.sra Read 1120841 spots for SRR7169580.sra Written 1120841 spots for SRR7169580.sra Read 1120841 spots for SRR7169580.sra Written 1120841 spots for SRR7169580.sra Read 1120841 spots for SRR7169580.sra Written 1120841 spots for SRR7169580.sra Read 1120841 spots for SRR7169580.sra Written 1120841 spots for SRR7169580.sra Read 1120841 spots for SRR7169580.sra Written 1120841 spots for SRR7169580.sra Read 1120841 spots for SRR7169580.sra Written 1120841 spots for SRR7169580.sra Read 1120841 spots for SRR7169580.sra Written 1120841 spots for SRR7169580.sra Read 1120841 spots for SRR7169580.sra Written 1120841 spots for SRR7169580.sra Read 1120841 spots for SRR7169580.sra Written 1120841 spots for SRR7169580.sra Read 1120841 spots for SRR7169580.sra Written 1120841 spots for SRR7169580.sra Read 1120841 spots for SRR7169580.sra Written 1120841 spots for SRR7169580.sra SRR ids: ['SRR7169580.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8n1sad8w SRR7169580.sra spots: 22416832 blocks: [[1, 1120841], [1120842, 2241682], [2241683, 3362523], [3362524, 4483364], [4483365, 5604205], [5604206, 6725046], [6725047, 7845887], [7845888, 8966728], [8966729, 10087569], [10087570, 11208410], [11208411, 12329251], [12329252, 13450092], [13450093, 14570933], [14570934, 15691774], [15691775, 16812615], [16812616, 17933456], [17933457, 19054297], [19054298, 20175138], [20175139, 21295979], [21295980, 22416832]] SRR7169580 file size 7574628 SRR7169580 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169580 SRR7169580_1.fastq SRR7169580_2.fastq Input file: SRR7169580_1.fastq Paired file: SRR7169580_2.fastq trimmed: SRR7169580-trimmed-pair1.fastq, SRR7169580-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 07:35:04 2025 >> started Tue Feb 11 07:35:44 2025 >> done (40.198s) 22416832 read pairs processed; of these: 64482 ( 0.29%) short read pairs filtered out after trimming by size control 165874 ( 0.74%) empty read pairs filtered out after trimming by size control 22186476 (98.97%) read pairs available; of these: 16238926 (73.19%) trimmed read pairs available after processing 5947550 (26.81%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 13 0.00% 20 15 0.00% 21 11 0.00% 22 18 0.00% 23 14 0.00% 24 7 0.00% 25 15 0.00% 26 15 0.00% 27 19 0.00% 28 20 0.00% 29 26 0.00% 30 35 0.00% 31 36 0.00% 32 35 0.00% 33 32 0.00% 34 46 0.00% 35 47 0.00% 36 53 0.00% 37 60 0.00% 38 82 0.00% 39 65 0.00% 40 76 0.00% 41 101 0.00% 42 118 0.00% 43 123 0.00% 44 137 0.00% 45 186 0.00% 46 232 0.00% 47 275 0.00% 48 289 0.00% 49 381 0.00% 50 406 0.00% 51 378 0.00% 52 484 0.00% 53 446 0.00% 54 531 0.00% 55 538 0.00% 56 550 0.00% 57 717 0.00% 58 798 0.00% 59 824 0.00% 60 956 0.00% 61 1098 0.00% 62 1171 0.01% 63 1415 0.01% 64 1553 0.01% 65 1666 0.01% 66 2008 0.01% 67 2172 0.01% 68 2671 0.01% 69 3238 0.01% 70 3718 0.02% 71 3908 0.02% 72 4154 0.02% 73 4504 0.02% 74 5012 0.02% 75 5392 0.02% 76 5973 0.03% 77 6424 0.03% 78 7027 0.03% 79 7869 0.04% 80 8915 0.04% 81 9736 0.04% 82 11164 0.05% 83 12536 0.06% 84 16043 0.07% 85 18380 0.08% 86 19244 0.09% 87 20194 0.09% 88 21198 0.10% 89 21980 0.10% 90 23326 0.11% 91 24100 0.11% 92 25852 0.12% 93 27630 0.12% 94 29146 0.13% 95 31088 0.14% 96 32726 0.15% 97 34371 0.15% 98 35486 0.16% 99 36646 0.17% 100 38537 0.17% 101 40254 0.18% 102 42152 0.19% 103 44425 0.20% 104 46785 0.21% 105 49354 0.22% 106 51223 0.23% 107 52735 0.24% 108 55194 0.25% 109 56833 0.26% 110 58634 0.26% 111 60733 0.27% 112 64083 0.29% 113 66948 0.30% 114 69982 0.32% 115 73595 0.33% 116 77038 0.35% 117 80546 0.36% 118 83703 0.38% 119 86550 0.39% 120 89963 0.41% 121 94143 0.42% 122 99352 0.45% 123 104840 0.47% 124 111308 0.50% 125 118386 0.53% 126 126730 0.57% 127 135567 0.61% 128 142615 0.64% 129 151795 0.68% 130 162040 0.73% 131 173046 0.78% 132 185784 0.84% 133 198762 0.90% 134 214319 0.97% 135 235095 1.06% 136 255032 1.15% 137 279921 1.26% 138 306723 1.38% 139 330791 1.49% 140 356113 1.61% 141 386392 1.74% 142 418271 1.89% 143 458774 2.07% 144 515749 2.32% 145 575443 2.59% 146 656267 2.96% 147 812714 3.66% 148 1085541 4.89% 149 1690392 7.62% 150 4027799 18.15% 151 5947550 26.81% 22186476 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=36 prefix-density=0.25 prefix-fanout=2.3 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAA criterion=fanout-score sequence-density=0.12 sequence-density-rank=23 fanout-score=54.98 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=15.6 sequence=CAAAATCATAGCCCACTTAAAAAAACGAGAGCAATCCATGCAATAACCTCATCAAAACCTTCTGTGTCACAAAGAATATATTGCTGCAACCATGCAAACTCCAAAGAACACAACATTGTTCAGAACAGTAAAGCTTACTGCCCCAGAAGTATCCGCAGGAGATTCTGGACTCGCTGCAGCTTTGGATCTCTTCTTTGGCTTTTCAGGTGCTGGTGCTGGAGTAGGAGGTTTAGGTGTAAAGATATCAAGAGGAAGAAGCACCTTGTCAACCTGATAAACAGCTAACTGGCTATCAGTGTAGATAGTGCCGGATACGCTTGTATTTGTAAGCCCTGTAGTTATATTCACAGAGTTTCCTGTGGTGGTTACGTTAAGCTCTAACCTGCCACCTGATCCTGCTTGTGTGGTCAGAGGGTTGCTCACAGTCTGGAACTGGGAACTTGATAGAAATTGTGGTATAATGTGAAACTGTACTAGCTCAGCCTTTTCTTGATCGCTTAGGGAGTTGAGG criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=41 prefix-density=0.24 prefix-fanout=2.1 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.12 sequence-density-rank=15 fanout-score=45.89 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=11.9 sequence=TGTTGGTGGTGG SRR7169580 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 07:36:46 Started mapping on | Feb 11 07:36:46 Finished on | Feb 11 07:39:36 Mapping speed, Million of reads per hour | 469.83 Number of input reads | 22186476 Average input read length | 285 UNIQUE READS: Uniquely mapped reads number | 20953910 Uniquely mapped reads % | 94.44% Average mapped length | 284.46 Number of splices: Total | 18420520 Number of splices: Annotated (sjdb) | 18107346 Number of splices: GT/AG | 18171899 Number of splices: GC/AG | 193840 Number of splices: AT/AC | 15873 Number of splices: Non-canonical | 38908 Mismatch rate per base, % | 0.55% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 402172 % of reads mapped to multiple loci | 1.81% Number of reads mapped to too many loci | 141292 % of reads mapped to too many loci | 0.64% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.94% % of reads unmapped: other | 0.17% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 885433 885433 885433 N_multimapping 402172 402172 402172 N_noFeature 471915 20672261 575823 N_ambiguous 259755 1328 81028 UnstrandedReadsAssigned:20222240 PositiveStrandReadsAssigned:280321 NegativeStrandReadsAssigned:20297059 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169580 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169580-trimmed-pair1.fastq SRR7169580-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,186,476 reads, 20,366,595 reads pseudoaligned [quant] estimated average fragment length: 222.554 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,089 rounds 52401 SRR7169580.ke.tsv 34699 SRR7169580.se.tsv 87100 total ==> SRR7169580.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1796.45 413 11.1902 Potri.005G024800.1.v4.1 1035 813.446 31 1.85497 Potri.004G059700.1.v4.1 961 739.465 3 0.197473 Potri.007G009000.2.v4.1 1416 1194.45 0 0 Potri.003G141000.2.v4.1 2943 2721.45 347.029 6.20683 Potri.016G087400.1.v4.1 270 87.0168 1891 1057.77 Potri.015G069301.1.v4.1 564 344.642 0 0 Potri.010G195200.1.v4.1 1773 1551.45 24 0.75297 Potri.012G127500.1.v4.1 977 755.453 3487 224.671 ==> SRR7169580.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1642 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 391 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169580 completed mapping pipeline successfully