Starting /dee2/code/volunteer_pipeline.sh SRR7169581 current disk space = 3054902472704 free memory = 1461737292 SRR7169581 SRAfilesize 66278eb46cbadc0cf3774bfd1b56f6ea SRR7169581.sra SRR7169581.sra file validated SRR7169581 is paired end SRR7169581 is conventional basespace SRR7169581 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169581_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.49225 34.0 33.0 34.0 32.0 34.0 2 33.25925 34.0 33.0 34.0 33.0 34.0 3 33.32 34.0 34.0 34.0 33.0 34.0 4 33.447 34.0 34.0 34.0 33.0 34.0 5 33.428 34.0 33.0 34.0 33.0 34.0 6 36.99125 38.0 37.0 38.0 36.0 38.0 7 37.35825 38.0 38.0 38.0 37.0 38.0 8 37.38875 38.0 38.0 38.0 37.0 38.0 9 37.3815 38.0 38.0 38.0 37.0 38.0 10-14 37.47840000000001 38.0 38.0 38.0 37.0 38.0 15-19 37.390100000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.357699999999994 38.0 38.0 38.0 37.0 38.0 25-29 37.36370000000001 38.0 38.0 38.0 37.0 38.0 30-34 37.269400000000005 38.0 38.0 38.0 37.0 38.0 35-39 37.21475 38.0 38.0 38.0 36.4 38.0 40-44 36.89185 38.0 38.0 38.0 35.4 38.0 45-49 36.80145 38.0 38.0 38.0 34.8 38.0 50-54 36.66914999999999 38.0 38.0 38.0 34.0 38.0 55-59 36.56805 38.0 38.0 38.0 34.0 38.0 60-64 36.49929999999999 38.0 38.0 38.0 34.0 38.0 65-69 36.3551 38.0 37.4 38.0 33.8 38.0 70-74 36.305150000000005 38.0 37.0 38.0 33.8 38.0 75-79 36.148250000000004 38.0 37.0 38.0 33.0 38.0 80-84 35.9679 38.0 37.0 38.0 32.4 38.0 85-89 35.85145 38.0 37.0 38.0 31.4 38.0 90-94 35.627050000000004 38.0 36.6 38.0 30.2 38.0 95-99 35.493900000000004 38.0 36.2 38.0 30.0 38.0 100-104 35.097449999999995 38.0 36.0 38.0 28.4 38.0 105-109 34.9132 38.0 36.0 38.0 28.0 38.0 110-114 34.6276 38.0 35.2 38.0 26.8 38.0 115-119 34.27765 38.0 35.0 38.0 24.0 38.0 120-124 34.19565 38.0 34.6 38.0 24.6 38.0 125-129 33.7342 38.0 34.0 38.0 21.4 38.0 130-134 33.51375 38.0 34.0 38.0 21.4 38.0 135-139 32.8377 38.0 33.0 38.0 15.0 38.0 140-144 32.31980000000001 37.6 33.0 38.0 14.2 38.0 145-149 31.466050000000003 36.4 32.2 38.0 11.2 38.0 150-151 27.6025 34.5 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 1.0 11 0.0 12 0.0 13 4.0 14 2.0 15 3.0 16 10.0 17 3.0 18 15.0 19 7.0 20 11.0 21 10.0 22 11.0 23 9.0 24 15.0 25 27.0 26 28.0 27 25.0 28 45.0 29 61.0 30 65.0 31 68.0 32 101.0 33 149.0 34 255.0 35 448.0 36 994.0 37 1631.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.80113343637301 13.575476558475014 6.774858320453375 33.84853168469861 2 24.05 11.425 32.324999999999996 32.2 3 19.925 17.549999999999997 25.85 36.675000000000004 4 23.35 25.124999999999996 23.474999999999998 28.050000000000004 5 23.799999999999997 29.225 25.025 21.95 6 20.549999999999997 33.125 24.025 22.3 7 14.899999999999999 29.5 38.25 17.349999999999998 8 17.599999999999998 28.050000000000004 31.025000000000002 23.325000000000003 9 17.9 25.25 34.175 22.675 10-14 19.61 30.205 27.375 22.81 15-19 19.59 28.939999999999998 27.284999999999997 24.185000000000002 20-24 20.355 29.049999999999997 27.27 23.325000000000003 25-29 19.495 28.95 27.284999999999997 24.27 30-34 19.955000000000002 29.415000000000003 26.875 23.755000000000003 35-39 20.11 29.01 26.77 24.11 40-44 20.31 28.915000000000003 27.105 23.669999999999998 45-49 19.71 29.12 26.71 24.46 50-54 19.75 28.415000000000003 27.375 24.46 55-59 20.135 28.799999999999997 26.840000000000003 24.224999999999998 60-64 20.27 28.48 27.415 23.835 65-69 20.65 28.24 27.279999999999998 23.830000000000002 70-74 19.615 28.53 27.83 24.025 75-79 20.49 27.860000000000003 27.325 24.325 80-84 20.73 28.37 27.089999999999996 23.810000000000002 85-89 20.345 28.775000000000002 27.18 23.7 90-94 20.085 28.73 27.089999999999996 24.095 95-99 20.76 28.46 26.674999999999997 24.104999999999997 100-104 20.799519086263903 27.862939585211905 27.25678789700431 24.080753431519888 105-109 20.82 27.779999999999998 27.625 23.775 110-114 20.379194462557056 28.91608566986006 27.110397752921706 23.594322114661182 115-119 20.535803705558337 28.24236354531798 27.611417125688533 23.610415623435152 120-124 20.529768163837563 28.040658955485455 26.939061639377098 24.490511241299885 125-129 20.50152660293308 28.034436157965864 27.35372140747785 24.110315831623204 130-134 20.64 27.544999999999998 27.87 23.945 135-139 20.855 27.884999999999998 27.334999999999997 23.925 140-144 20.315 27.36 28.28 24.044999999999998 145-149 20.79 27.985 27.589999999999996 23.635 150-151 20.4625 26.9625 28.3875 24.1875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 1.5 25 2.0 26 3.5 27 8.5 28 11.0 29 9.5 30 12.0 31 23.0 32 30.5 33 39.5 34 48.0 35 64.0 36 81.0 37 93.5 38 112.0 39 132.0 40 175.5 41 202.0 42 217.5 43 258.5 44 276.0 45 283.0 46 280.0 47 266.5 48 252.5 49 230.5 50 197.5 51 159.5 52 125.5 53 99.5 54 84.5 55 58.0 56 39.5 57 31.0 58 23.5 59 16.5 60 12.5 61 10.5 62 5.5 63 2.5 64 4.0 65 4.0 66 2.0 67 2.0 68 1.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.9499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.19 105-109 0.0 110-114 0.315 115-119 0.15 120-124 0.145 125-129 0.105 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.11249999999999999 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.3 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.4125 0.0 0.0 0.0 0.0 120-121 0.45 0.0 0.0 0.0 0.0 122-123 0.4625 0.0 0.0 0.0 0.0 124-125 0.55 0.0 0.0 0.0 0.0 126-127 0.6875 0.0 0.0 0.0 0.0 128-129 0.7875000000000001 0.0 0.0 0.0 0.0 130-131 0.8375 0.0 0.0 0.0 0.0 132-133 0.9375 0.0 0.0 0.0 0.0 134-135 1.1375 0.0 0.0 0.0 0.0 136-137 1.375 0.0 0.0 0.0 0.0 138-139 1.4500000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169581 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169581_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.61475 33.0 33.0 34.0 32.0 34.0 2 32.8885 34.0 33.0 34.0 32.0 34.0 3 32.90975 34.0 33.0 34.0 32.0 34.0 4 32.808 34.0 33.0 34.0 32.0 34.0 5 32.786 34.0 33.0 34.0 32.0 34.0 6 36.93 38.0 38.0 38.0 36.0 38.0 7 37.00675 38.0 38.0 38.0 37.0 38.0 8 37.1285 38.0 38.0 38.0 37.0 38.0 9 37.0515 38.0 38.0 38.0 37.0 38.0 10-14 37.02355 38.0 38.0 38.0 37.0 38.0 15-19 36.978300000000004 38.0 38.0 38.0 37.0 38.0 20-24 36.93515 38.0 38.0 38.0 36.6 38.0 25-29 36.94935 38.0 38.0 38.0 36.6 38.0 30-34 36.95245 38.0 38.0 38.0 36.6 38.0 35-39 36.872 38.0 38.0 38.0 36.4 38.0 40-44 36.809450000000005 38.0 38.0 38.0 36.0 38.0 45-49 36.82695 38.0 38.0 38.0 36.0 38.0 50-54 36.56015 38.0 38.0 38.0 35.6 38.0 55-59 36.26585 38.0 38.0 38.0 35.2 38.0 60-64 36.079950000000004 38.0 38.0 38.0 34.4 38.0 65-69 35.88805 38.0 38.0 38.0 34.2 38.0 70-74 35.7301 38.0 38.0 38.0 33.8 38.0 75-79 35.6321 38.0 38.0 38.0 33.6 38.0 80-84 35.77454999999999 38.0 38.0 38.0 33.4 38.0 85-89 35.795249999999996 38.0 38.0 38.0 33.2 38.0 90-94 35.78295 38.0 38.0 38.0 33.4 38.0 95-99 35.61555 38.0 38.0 38.0 32.6 38.0 100-104 35.48625 38.0 38.0 38.0 31.0 38.0 105-109 35.477999999999994 38.0 38.0 38.0 31.0 38.0 110-114 35.42005 38.0 37.8 38.0 30.2 38.0 115-119 35.14945 38.0 37.0 38.0 29.2 38.0 120-124 34.961650000000006 38.0 37.0 38.0 28.2 38.0 125-129 34.7569 38.0 36.2 38.0 27.8 38.0 130-134 34.31185 38.0 36.0 38.0 24.6 38.0 135-139 33.7682 38.0 35.2 38.0 20.6 38.0 140-144 33.405 38.0 35.0 38.0 15.8 38.0 145-149 32.5673 38.0 34.4 38.0 9.0 38.0 150-151 28.75525 36.0 18.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 5.0 4 1.0 5 0.0 6 1.0 7 4.0 8 1.0 9 4.0 10 5.0 11 5.0 12 8.0 13 20.0 14 18.0 15 7.0 16 5.0 17 9.0 18 6.0 19 8.0 20 9.0 21 22.0 22 15.0 23 16.0 24 10.0 25 24.0 26 24.0 27 27.0 28 37.0 29 39.0 30 52.0 31 64.0 32 66.0 33 79.0 34 131.0 35 213.0 36 460.0 37 2596.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.186397984886646 22.997481108312343 12.065491183879093 26.750629722921914 2 27.431857964491122 26.581645411352838 29.532383095773945 16.454113528382095 3 20.025000000000002 29.075 31.5 19.400000000000002 4 22.675 33.975 24.75 18.6 5 24.8 34.975 22.975 17.25 6 20.625 37.65 23.05 18.675 7 20.9 22.725 36.6 19.775000000000002 8 23.425 25.724999999999998 26.775 24.075 9 22.675 24.525 29.575000000000003 23.225 10-14 22.935 29.565 26.229999999999997 21.27 15-19 23.74 27.76 27.155 21.345 20-24 23.44 28.055000000000003 27.555000000000003 20.95 25-29 23.43 27.560000000000002 27.73 21.279999999999998 30-34 23.419999999999998 28.155 26.99 21.435000000000002 35-39 23.215 28.050000000000004 27.1 21.634999999999998 40-44 23.724999999999998 27.83 27.57 20.875 45-49 23.705000000000002 28.17 27.305 20.82 50-54 23.595618530800923 27.96201386795297 27.504773389609085 20.93759421163702 55-59 24.127435064935064 27.891639610389614 27.28794642857143 20.6929788961039 60-64 23.35677162947111 27.89666768572302 27.529807398349128 21.21675328645674 65-69 23.743031047005267 27.604726100966705 27.88092680681295 20.77131604521508 70-74 23.784143904063956 27.561113104084455 27.61236099010916 21.04238200174243 75-79 23.732376313765702 27.726224045116638 27.603178672135346 20.938220968982314 80-84 23.985728848114167 27.44648318042813 27.69113149847095 20.87665647298675 85-89 23.81266825824148 27.871184030070605 27.9219789708945 20.39416874079342 90-94 23.66485773697824 27.53968656489324 28.102652533346856 20.69280316478166 95-99 23.914587137350377 27.956989247311824 27.73889227023737 20.389531345100426 100-104 24.55253311760542 27.990696733744564 26.93902315704318 20.517746991606835 105-109 24.147339699863572 27.20428477590824 27.694406548431104 20.95396897579708 110-114 24.21153555028511 27.330070141797446 27.82459504465863 20.63379926325882 115-119 24.458329134334374 27.64284994457321 27.360677214552048 20.53814370654036 120-124 23.964944091870656 28.22101339780397 27.163292031832377 20.650750478493 125-129 23.790994997220675 27.757845267572893 27.66688564353934 20.784274091667086 130-134 24.320893627824322 28.04772784970805 27.33688753490734 20.294490987560295 135-139 24.098352293016376 27.72024690098454 27.608019180737642 20.57338162526144 140-144 24.574929793209087 27.592545315292316 27.347459790656114 20.48506510084248 145-149 24.56662221766335 27.633603446507333 27.618217253051597 20.181557082777722 150-151 24.22056171089925 27.776346302499356 27.23524864725586 20.76784333934553 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 3.5 19 3.0 20 2.5 21 8.0 22 8.0 23 7.5 24 7.0 25 6.5 26 9.5 27 8.5 28 7.5 29 12.0 30 14.0 31 12.0 32 13.5 33 22.5 34 38.0 35 51.5 36 67.5 37 95.0 38 124.0 39 153.0 40 173.0 41 219.0 42 260.0 43 257.0 44 263.5 45 291.5 46 297.5 47 271.0 48 257.5 49 225.0 50 172.5 51 152.5 52 133.5 53 88.5 54 63.5 55 54.5 56 40.0 57 29.0 58 20.5 59 14.5 60 8.5 61 6.0 62 7.5 63 7.5 64 4.0 65 2.5 66 2.5 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.75 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.49 55-59 1.44 60-64 1.87 65-69 2.245 70-74 2.435 75-79 2.475 80-84 1.9 85-89 1.5650000000000002 90-94 1.415 95-99 1.4200000000000002 100-104 1.11 105-109 1.045 110-114 0.915 115-119 0.77 120-124 0.73 125-129 1.055 130-134 1.525 135-139 1.9849999999999999 140-144 2.075 145-149 2.5100000000000002 150-151 2.9749999999999996 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.11249999999999999 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.3 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.42500000000000004 0.0 0.0 0.0 0.0 120-121 0.475 0.0 0.0 0.0 0.0 122-123 0.4875 0.0 0.0 0.0 0.0 124-125 0.575 0.0 0.0 0.0 0.0 126-127 0.7124999999999999 0.0 0.0 0.0 0.0 128-129 0.8125 0.0 0.0 0.0 0.0 130-131 0.85 0.0 0.0 0.0 0.0 132-133 0.9375 0.0 0.0 0.0 0.0 134-135 1.1375 0.0 0.0 0.0 0.0 136-137 1.4 0.0 0.0 0.0 0.0 138-139 1.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 851444 spots for SRR7169581.sra Written 851444 spots for SRR7169581.sra Read 851444 spots for SRR7169581.sra Written 851444 spots for SRR7169581.sra Read 851444 spots for SRR7169581.sra Written 851444 spots for SRR7169581.sra Read 851444 spots for SRR7169581.sra Written 851444 spots for SRR7169581.sra Read 851444 spots for SRR7169581.sra Written 851444 spots for SRR7169581.sra Read 851444 spots for SRR7169581.sra Written 851444 spots for SRR7169581.sra Read 851444 spots for SRR7169581.sra Written 851444 spots for SRR7169581.sra Read 851444 spots for SRR7169581.sra Written 851444 spots for SRR7169581.sra Read 851444 spots for SRR7169581.sra Written 851444 spots for SRR7169581.sra Read 851444 spots for SRR7169581.sra Written 851444 spots for SRR7169581.sra Read 851444 spots for SRR7169581.sra Written 851444 spots for SRR7169581.sra Read 851444 spots for SRR7169581.sra Written 851444 spots for SRR7169581.sra Read 851444 spots for SRR7169581.sra Written 851444 spots for SRR7169581.sra Read 851444 spots for SRR7169581.sra Written 851444 spots for SRR7169581.sra Read 851444 spots for SRR7169581.sra Written 851444 spots for SRR7169581.sra Read 851444 spots for SRR7169581.sra Written 851444 spots for SRR7169581.sra Read 851444 spots for SRR7169581.sra Written 851444 spots for SRR7169581.sra Read 851444 spots for SRR7169581.sra Written 851444 spots for SRR7169581.sra Read 851444 spots for SRR7169581.sra Written 851444 spots for SRR7169581.sra Read 851444 spots for SRR7169581.sra Written 851444 spots for SRR7169581.sra SRR ids: ['SRR7169581.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7igwp3_m SRR7169581.sra spots: 17028880 blocks: [[1, 851444], [851445, 1702888], [1702889, 2554332], [2554333, 3405776], [3405777, 4257220], [4257221, 5108664], [5108665, 5960108], [5960109, 6811552], [6811553, 7662996], [7662997, 8514440], [8514441, 9365884], [9365885, 10217328], [10217329, 11068772], [11068773, 11920216], [11920217, 12771660], [12771661, 13623104], [13623105, 14474548], [14474549, 15325992], [15325993, 16177436], [16177437, 17028880]] SRR7169581 file size 5748828 SRR7169581 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169581 SRR7169581_1.fastq SRR7169581_2.fastq Input file: SRR7169581_1.fastq Paired file: SRR7169581_2.fastq trimmed: SRR7169581-trimmed-pair1.fastq, SRR7169581-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 07:17:10 2025 >> started Tue Feb 11 07:33:17 2025 >> done (967.126s) 17028880 read pairs processed; of these: 16972 ( 0.10%) short read pairs filtered out after trimming by size control 15962 ( 0.09%) empty read pairs filtered out after trimming by size control 16995946 (99.81%) read pairs available; of these: 8137068 (47.88%) trimmed read pairs available after processing 8858878 (52.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 7 0.00% 20 1 0.00% 21 4 0.00% 22 8 0.00% 23 8 0.00% 24 4 0.00% 25 11 0.00% 26 13 0.00% 27 15 0.00% 28 5 0.00% 29 10 0.00% 30 15 0.00% 31 10 0.00% 32 11 0.00% 33 21 0.00% 34 21 0.00% 35 11 0.00% 36 19 0.00% 37 26 0.00% 38 20 0.00% 39 22 0.00% 40 29 0.00% 41 27 0.00% 42 44 0.00% 43 41 0.00% 44 35 0.00% 45 52 0.00% 46 44 0.00% 47 50 0.00% 48 58 0.00% 49 57 0.00% 50 86 0.00% 51 77 0.00% 52 106 0.00% 53 89 0.00% 54 111 0.00% 55 127 0.00% 56 136 0.00% 57 177 0.00% 58 179 0.00% 59 190 0.00% 60 213 0.00% 61 242 0.00% 62 283 0.00% 63 284 0.00% 64 350 0.00% 65 407 0.00% 66 435 0.00% 67 494 0.00% 68 597 0.00% 69 804 0.00% 70 907 0.01% 71 898 0.01% 72 986 0.01% 73 1216 0.01% 74 1452 0.01% 75 2110 0.01% 76 1622 0.01% 77 860 0.01% 78 1157 0.01% 79 1966 0.01% 80 4118 0.02% 81 1183 0.01% 82 1468 0.01% 83 1668 0.01% 84 2519 0.01% 85 3247 0.02% 86 3665 0.02% 87 3823 0.02% 88 3456 0.02% 89 3701 0.02% 90 3979 0.02% 91 4296 0.03% 92 4677 0.03% 93 5133 0.03% 94 5520 0.03% 95 6014 0.04% 96 6663 0.04% 97 7887 0.05% 98 9911 0.06% 99 15866 0.09% 100 19664 0.12% 101 10684 0.06% 102 7947 0.05% 103 8277 0.05% 104 8553 0.05% 105 9294 0.05% 106 9838 0.06% 107 10259 0.06% 108 10838 0.06% 109 11498 0.07% 110 12065 0.07% 111 12708 0.07% 112 13552 0.08% 113 14425 0.08% 114 15079 0.09% 115 16138 0.09% 116 17366 0.10% 117 18311 0.11% 118 19480 0.11% 119 20062 0.12% 120 20908 0.12% 121 22129 0.13% 122 23237 0.14% 123 24616 0.14% 124 26203 0.15% 125 27858 0.16% 126 29730 0.17% 127 31621 0.19% 128 33861 0.20% 129 36108 0.21% 130 38532 0.23% 131 40576 0.24% 132 43651 0.26% 133 46933 0.28% 134 51058 0.30% 135 54965 0.32% 136 60229 0.35% 137 65052 0.38% 138 72108 0.42% 139 80222 0.47% 140 88171 0.52% 141 98599 0.58% 142 111098 0.65% 143 124858 0.73% 144 150517 0.89% 145 184366 1.08% 146 236785 1.39% 147 333066 1.96% 148 512933 3.02% 149 989875 5.82% 150 4093108 24.08% 151 8858878 52.12% 16995946 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=12.50 fanout-score-rank=10 prefix-density=0.38 prefix-fanout=6.4 sequence=GGTGCTGGTGCTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=627.12 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=19.6 sequence=AAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.76 fanout-score-rank=38 prefix-density=0.31 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.05 sequence-density-rank=44 fanout-score=61.84 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=7.1 sequence=TCTTCCTCTCTATAATTTTCTAGGGTTTAGCAATGTCTGCCGAGGTTGAGTACAGGTGCTTTGTTGG SRR7169581 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 07:34:05 Started mapping on | Feb 11 07:34:05 Finished on | Feb 11 07:36:09 Mapping speed, Million of reads per hour | 493.43 Number of input reads | 16995946 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 16169465 Uniquely mapped reads % | 95.14% Average mapped length | 295.66 Number of splices: Total | 15539560 Number of splices: Annotated (sjdb) | 15284130 Number of splices: GT/AG | 15310418 Number of splices: GC/AG | 179963 Number of splices: AT/AC | 12470 Number of splices: Non-canonical | 36709 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 302169 % of reads mapped to multiple loci | 1.78% Number of reads mapped to too many loci | 24186 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.91% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 542407 542407 542407 N_multimapping 302169 302169 302169 N_noFeature 309186 15989393 384898 N_ambiguous 170361 1113 65191 UnstrandedReadsAssigned:15689918 PositiveStrandReadsAssigned:178959 NegativeStrandReadsAssigned:15719376 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169581 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169581-trimmed-pair1.fastq SRR7169581-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,995,946 reads, 15,625,400 reads pseudoaligned [quant] estimated average fragment length: 263.705 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,120 rounds 52401 SRR7169581.ke.tsv 34699 SRR7169581.se.tsv 87100 total ==> SRR7169581.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1755.29 269 8.41929 Potri.005G024800.1.v4.1 1035 772.295 31 2.20522 Potri.004G059700.1.v4.1 961 698.339 0 0 Potri.007G009000.2.v4.1 1416 1153.29 0 0 Potri.003G141000.2.v4.1 2943 2680.29 154 3.15654 Potri.016G087400.1.v4.1 270 64.7116 1673.52 1420.77 Potri.015G069301.1.v4.1 564 306.476 0 0 Potri.010G195200.1.v4.1 1773 1510.29 62 2.2553 Potri.012G127500.1.v4.1 977 714.327 8559 658.263 ==> SRR7169581.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1308 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 318 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169581 completed mapping pipeline successfully