Starting /dee2/code/volunteer_pipeline.sh SRR7169582 current disk space = 3055112671232 free memory = 1563741204 SRR7169582 SRAfilesize 63a982419e226191328d89b7767e054d SRR7169582.sra SRR7169582.sra file validated SRR7169582 is paired end SRR7169582 is conventional basespace SRR7169582 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169582_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.89375 34.0 33.0 34.0 33.0 34.0 2 33.36125 34.0 33.0 34.0 33.0 34.0 3 33.44775 34.0 34.0 34.0 33.0 34.0 4 33.481 34.0 34.0 34.0 33.0 34.0 5 33.4845 34.0 34.0 34.0 33.0 34.0 6 37.08925 38.0 38.0 38.0 36.0 38.0 7 37.44525 38.0 38.0 38.0 37.0 38.0 8 37.51175 38.0 38.0 38.0 37.0 38.0 9 37.51625 38.0 38.0 38.0 38.0 38.0 10-14 37.52935 38.0 38.0 38.0 38.0 38.0 15-19 37.5227 38.0 38.0 38.0 37.8 38.0 20-24 37.53425 38.0 38.0 38.0 37.8 38.0 25-29 37.512649999999994 38.0 38.0 38.0 38.0 38.0 30-34 37.523199999999996 38.0 38.0 38.0 37.8 38.0 35-39 37.4403 38.0 38.0 38.0 37.2 38.0 40-44 37.36705 38.0 38.0 38.0 37.0 38.0 45-49 37.32105 38.0 38.0 38.0 37.0 38.0 50-54 37.249 38.0 38.0 38.0 37.0 38.0 55-59 37.272149999999996 38.0 38.0 38.0 37.0 38.0 60-64 37.227999999999994 38.0 38.0 38.0 36.6 38.0 65-69 37.174150000000004 38.0 38.0 38.0 36.4 38.0 70-74 37.1321 38.0 38.0 38.0 36.0 38.0 75-79 37.088300000000004 38.0 38.0 38.0 36.0 38.0 80-84 37.0707 38.0 38.0 38.0 36.0 38.0 85-89 36.921749999999996 38.0 38.0 38.0 35.8 38.0 90-94 36.88075 38.0 38.0 38.0 35.6 38.0 95-99 36.6995 38.0 38.0 38.0 35.0 38.0 100-104 36.64185 38.0 38.0 38.0 34.8 38.0 105-109 36.4617 38.0 38.0 38.0 34.0 38.0 110-114 36.38645 38.0 38.0 38.0 34.2 38.0 115-119 36.18635 38.0 38.0 38.0 33.8 38.0 120-124 36.01135 38.0 37.6 38.0 33.4 38.0 125-129 35.88995 38.0 37.0 38.0 33.0 38.0 130-134 35.778800000000004 38.0 36.8 38.0 32.6 38.0 135-139 35.48625 38.0 36.0 38.0 31.0 38.0 140-144 35.2192 38.0 36.0 38.0 31.0 38.0 145-149 34.6721 38.0 35.6 38.0 28.2 38.0 150-151 32.066125 37.0 33.5 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 1.0 17 1.0 18 3.0 19 6.0 20 7.0 21 10.0 22 3.0 23 6.0 24 7.0 25 12.0 26 13.0 27 10.0 28 23.0 29 25.0 30 37.0 31 40.0 32 57.0 33 79.0 34 129.0 35 202.0 36 485.0 37 2842.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.47967479674797 11.28048780487805 9.197154471544716 37.042682926829265 2 23.75 13.525 33.2 29.525000000000002 3 20.0 19.125 25.7 35.175 4 21.125 27.275 23.325000000000003 28.275 5 22.15 31.4 23.799999999999997 22.650000000000002 6 20.150000000000002 33.300000000000004 26.025 20.525 7 14.149999999999999 26.474999999999998 42.0 17.375 8 17.8 26.724999999999998 31.3 24.175 9 17.95 24.474999999999998 33.074999999999996 24.5 10-14 20.24 29.75 26.735 23.275000000000002 15-19 19.950000000000003 28.22 27.644999999999996 24.185000000000002 20-24 20.135 28.249999999999996 27.595 24.02 25-29 20.26 28.549999999999997 26.995 24.195 30-34 20.36 27.994999999999997 27.245 24.4 35-39 19.99 28.155 27.675 24.18 40-44 20.48 28.285 27.465 23.77 45-49 20.05 27.950000000000003 27.169999999999998 24.83 50-54 19.845 27.74 27.85 24.565 55-59 20.43 28.335 27.195000000000004 24.04 60-64 20.06 28.12 27.605 24.215 65-69 20.11 28.189999999999998 27.43 24.27 70-74 19.955000000000002 28.77 27.185 24.09 75-79 19.91 28.294999999999998 27.529999999999998 24.265 80-84 20.22 27.91 27.36 24.51 85-89 20.64 28.060000000000002 27.189999999999998 24.11 90-94 20.955 28.050000000000004 27.445000000000004 23.549999999999997 95-99 20.43 27.875 27.560000000000002 24.135 100-104 21.37 27.805000000000003 27.075 23.75 105-109 20.65 27.279999999999998 27.894999999999996 24.175 110-114 20.835 28.79 26.810000000000002 23.565 115-119 20.325 28.565 26.91 24.2 120-124 21.065 27.67 27.450000000000003 23.815 125-129 21.055 27.715 27.295 23.935000000000002 130-134 21.279999999999998 27.925 27.505000000000003 23.29 135-139 20.645 27.93 27.05 24.375 140-144 21.015 27.265 27.250000000000004 24.47 145-149 20.72 27.815 27.265 24.2 150-151 20.6625 27.212500000000002 27.625 24.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 2.5 25 3.5 26 5.5 27 7.5 28 8.5 29 8.5 30 14.5 31 19.5 32 20.5 33 32.5 34 44.0 35 51.5 36 72.5 37 91.0 38 111.0 39 150.0 40 169.5 41 202.0 42 237.0 43 258.5 44 273.5 45 285.0 46 287.0 47 262.0 48 245.0 49 215.0 50 180.5 51 158.0 52 140.0 53 112.0 54 82.5 55 66.0 56 44.5 57 30.0 58 22.5 59 18.0 60 15.5 61 11.5 62 10.5 63 7.0 64 5.0 65 4.0 66 4.0 67 2.5 68 1.0 69 2.5 70 1.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0125 0.0 0.0 0.025 0.0 80-81 0.025 0.0 0.0 0.025 0.0 82-83 0.025 0.0 0.0 0.025 0.0 84-85 0.025 0.0 0.0 0.025 0.0 86-87 0.025 0.0 0.0 0.025 0.0 88-89 0.025 0.0 0.0 0.025 0.0 90-91 0.037500000000000006 0.0 0.0 0.025 0.0 92-93 0.1 0.0 0.0 0.025 0.0 94-95 0.15 0.0 0.0 0.025 0.0 96-97 0.1875 0.0 0.0 0.025 0.0 98-99 0.2 0.0 0.0 0.025 0.0 100-101 0.3375 0.0 0.0 0.025 0.0 102-103 0.475 0.0 0.0 0.025 0.0 104-105 0.6499999999999999 0.0 0.0 0.025 0.0 106-107 0.8125 0.0 0.0 0.025 0.0 108-109 0.9625 0.0 0.0 0.025 0.0 110-111 1.15 0.0 0.0 0.025 0.0 112-113 1.3125 0.0 0.0 0.025 0.0 114-115 1.4375 0.0 0.0 0.025 0.0 116-117 1.55 0.0 0.0 0.025 0.0 118-119 1.8 0.0 0.0 0.025 0.0 120-121 2.0625 0.0 0.0 0.025 0.0 122-123 2.2249999999999996 0.0 0.0 0.025 0.0 124-125 2.5125 0.0 0.0 0.025 0.0 126-127 2.7750000000000004 0.0 0.0 0.025 0.0 128-129 3.0375 0.0 0.0 0.025 0.0 130-131 3.4000000000000004 0.0 0.0 0.025 0.0 132-133 3.825 0.0 0.0 0.025 0.0 134-135 4.1125 0.0 0.0 0.025 0.0 136-137 4.550000000000001 0.0 0.0 0.025 0.0 138-139 4.975 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169582 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169582_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.83275 33.0 33.0 34.0 32.0 34.0 2 32.94 34.0 33.0 34.0 32.0 34.0 3 32.9835 34.0 33.0 34.0 32.0 34.0 4 32.90925 34.0 33.0 34.0 32.0 34.0 5 33.00025 34.0 33.0 34.0 32.0 34.0 6 37.133 38.0 38.0 38.0 37.0 38.0 7 37.209 38.0 38.0 38.0 37.0 38.0 8 37.21325 38.0 38.0 38.0 37.0 38.0 9 37.192 38.0 38.0 38.0 37.0 38.0 10-14 37.14025 38.0 38.0 38.0 37.0 38.0 15-19 37.11325000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.063849999999995 38.0 38.0 38.0 37.0 38.0 25-29 37.0783 38.0 38.0 38.0 37.0 38.0 30-34 37.01825 38.0 38.0 38.0 36.6 38.0 35-39 37.01585 38.0 38.0 38.0 37.0 38.0 40-44 36.9944 38.0 38.0 38.0 36.8 38.0 45-49 37.03155 38.0 38.0 38.0 37.0 38.0 50-54 36.9945 38.0 38.0 38.0 36.8 38.0 55-59 36.96615 38.0 38.0 38.0 36.8 38.0 60-64 36.93845 38.0 38.0 38.0 36.4 38.0 65-69 36.92 38.0 38.0 38.0 36.0 38.0 70-74 36.7692 38.0 38.0 38.0 36.0 38.0 75-79 36.670049999999996 38.0 38.0 38.0 35.8 38.0 80-84 36.6315 38.0 38.0 38.0 35.4 38.0 85-89 36.56075 38.0 38.0 38.0 35.0 38.0 90-94 36.55075000000001 38.0 38.0 38.0 35.2 38.0 95-99 36.4497 38.0 38.0 38.0 34.8 38.0 100-104 36.39185 38.0 38.0 38.0 34.8 38.0 105-109 36.2695 38.0 38.0 38.0 34.0 38.0 110-114 36.2012 38.0 38.0 38.0 34.0 38.0 115-119 35.93075 38.0 37.8 38.0 33.2 38.0 120-124 35.7187 38.0 37.4 38.0 32.2 38.0 125-129 35.6 38.0 37.2 38.0 32.0 38.0 130-134 35.3443 38.0 36.6 38.0 31.0 38.0 135-139 34.9799 38.0 36.0 38.0 28.6 38.0 140-144 34.71665 38.0 36.0 38.0 27.8 38.0 145-149 34.15385 38.0 35.4 38.0 25.8 38.0 150-151 30.926375 36.5 30.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 0.0 4 0.0 5 1.0 6 0.0 7 1.0 8 2.0 9 2.0 10 1.0 11 3.0 12 3.0 13 4.0 14 4.0 15 1.0 16 3.0 17 8.0 18 3.0 19 4.0 20 1.0 21 6.0 22 10.0 23 10.0 24 12.0 25 11.0 26 21.0 27 24.0 28 29.0 29 30.0 30 44.0 31 41.0 32 51.0 33 77.0 34 117.0 35 198.0 36 432.0 37 2831.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.771929824561404 22.882205513784463 12.857142857142856 25.48872180451128 2 27.600902481825017 27.65104036099273 28.6287290047631 16.11932815241915 3 20.180496365003762 29.105038856856353 30.408623715216848 20.30584106292304 4 22.51190774630233 34.14389571321133 23.940837302582104 19.403359237904237 5 24.617698671346204 35.97392830283279 22.06066683379293 17.347706192028078 6 21.007771371270994 37.12709952369015 22.963148658811733 18.901980446227125 7 21.057909250438705 22.837803960892455 37.377788919528705 18.726497869140136 8 22.56204562547004 26.72348959639007 26.372524442216093 24.34194033592379 9 21.634494860867385 25.64552519428428 29.65655552770118 23.063424417147154 10-14 23.865630483830532 28.02206066683379 26.377538230132863 21.73477061920281 15-19 23.955878666332413 27.24993732765104 27.575833542241163 21.21835046377538 20-24 22.968162446728506 28.257708698922034 27.28503384306844 21.489095011281023 25-29 23.364251692153424 28.723990975181753 26.853848082226122 21.057909250438705 30-34 23.358066780306828 28.271332598014638 27.283665897924397 21.086934723754137 35-39 23.329155176736023 28.683880671847582 26.72348959639007 21.26347455502632 40-44 23.344196540486337 28.207570819754324 27.656054148909504 20.792178490849835 45-49 23.609927300075206 28.107295061418903 27.46051642015543 20.822261218350462 50-54 24.130151408803773 28.015642234031883 27.04802968013637 20.806176677027977 55-59 23.488418730572548 28.18108894013837 27.544369798455833 20.78612253083325 60-64 23.905740787164703 28.072198546001502 27.019303083479567 21.002757583354224 65-69 24.231637001754827 27.58084733015793 27.209827024316873 20.977688643770367 70-74 24.07620957633492 27.044372023063424 27.891702180997747 20.98771621960391 75-79 24.30183003258962 27.11456505389822 27.79142642266232 20.792178490849835 80-84 24.011030333416898 27.620957633492104 27.264978691401353 21.10303334168965 85-89 23.374279267986964 28.187515668087237 27.4304336926548 21.007771371270994 90-94 23.870644271747306 27.706192028077215 27.97192278766608 20.451240912509398 95-99 23.868250864791698 27.563042061462877 27.372537223642652 21.196169850102773 100-104 23.632626460119315 28.04431744121923 27.427683360906403 20.89537273775505 105-109 24.540031082368277 27.5379756354339 27.362510653231066 20.559482628966762 110-114 24.24667836550514 27.78641263474555 27.18475808473302 20.782150915016295 115-119 24.064975433670913 28.02566930712925 27.669708212172868 20.239647047026974 120-124 24.65780897468037 27.039358235146654 27.630985209325647 20.67184758084733 125-129 24.367009275507645 28.172474304336927 27.12960641764853 20.330910002506894 130-134 24.52868030485359 28.133774568792617 26.895306859205775 20.442238267148014 135-139 24.78816746051642 27.275006267234897 27.981950363499625 19.95487590874906 140-144 24.933567310102784 27.641012785159187 27.259964903484583 20.165455001253445 145-149 25.058912008022062 28.02707445475057 26.80371020305841 20.110303334168965 150-151 25.406758448060074 27.546933667083856 26.896120150187734 20.150187734668336 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 10.0 1 5.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 1.5 26 2.0 27 2.5 28 4.5 29 5.0 30 5.5 31 9.0 32 17.0 33 27.0 34 36.0 35 45.5 36 58.5 37 78.0 38 109.0 39 151.5 40 192.0 41 222.5 42 248.0 43 286.0 44 313.5 45 297.0 46 289.0 47 263.5 48 233.5 49 235.5 50 207.0 51 153.5 52 118.5 53 98.5 54 70.0 55 54.0 56 43.5 57 29.0 58 22.0 59 17.0 60 11.0 61 7.0 62 4.0 63 3.0 64 4.0 65 3.0 66 2.0 67 1.5 68 0.5 69 0.5 70 0.5 71 1.5 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.27499999999999997 3 0.27499999999999997 4 0.27499999999999997 5 0.27499999999999997 6 0.27499999999999997 7 0.27499999999999997 8 0.27499999999999997 9 0.27499999999999997 10-14 0.27499999999999997 15-19 0.27499999999999997 20-24 0.27499999999999997 25-29 0.27499999999999997 30-34 0.27 35-39 0.27499999999999997 40-44 0.27499999999999997 45-49 0.27499999999999997 50-54 0.27 55-59 0.27 60-64 0.27499999999999997 65-69 0.27499999999999997 70-74 0.27499999999999997 75-79 0.27499999999999997 80-84 0.27499999999999997 85-89 0.27499999999999997 90-94 0.27499999999999997 95-99 0.265 100-104 0.265 105-109 0.265 110-114 0.27499999999999997 115-119 0.27 120-124 0.27499999999999997 125-129 0.27499999999999997 130-134 0.27999999999999997 135-139 0.27499999999999997 140-144 0.27499999999999997 145-149 0.27499999999999997 150-151 0.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47103274559194 98.725 2 0.4785894206549119 0.95 3 0.025188916876574305 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025188916876574305 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 10 0.25 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.1875 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.525 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.8625 0.0 0.0 0.0 0.0 108-109 1.0125 0.0 0.0 0.0 0.0 110-111 1.2 0.0 0.0 0.0 0.0 112-113 1.3625 0.0 0.0 0.0 0.0 114-115 1.4875 0.0 0.0 0.0 0.0 116-117 1.6 0.0 0.0 0.0 0.0 118-119 1.85 0.0 0.0 0.0 0.0 120-121 2.1125 0.0 0.0 0.0 0.0 122-123 2.3 0.0 0.0 0.0 0.0 124-125 2.575 0.0 0.0 0.0 0.0 126-127 2.825 0.0 0.0 0.0 0.0 128-129 3.0875 0.0 0.0 0.0 0.0 130-131 3.45 0.0 0.0 0.0 0.0 132-133 3.875 0.0 0.0 0.0 0.0 134-135 4.1625 0.0 0.0 0.0 0.0 136-137 4.55 0.0 0.0 0.0 0.0 138-139 4.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 916973 spots for SRR7169582.sra Written 916973 spots for SRR7169582.sra Read 916973 spots for SRR7169582.sra Written 916973 spots for SRR7169582.sra Read 916973 spots for SRR7169582.sra Written 916973 spots for SRR7169582.sra Read 916973 spots for SRR7169582.sra Written 916973 spots for SRR7169582.sra Read 916973 spots for SRR7169582.sra Written 916973 spots for SRR7169582.sra Read 916973 spots for SRR7169582.sra Written 916973 spots for SRR7169582.sra Read 916973 spots for SRR7169582.sra Written 916973 spots for SRR7169582.sra Read 916973 spots for SRR7169582.sra Written 916973 spots for SRR7169582.sra Read 916973 spots for SRR7169582.sra Written 916973 spots for SRR7169582.sra Read 916973 spots for SRR7169582.sra Written 916973 spots for SRR7169582.sra Read 916973 spots for SRR7169582.sra Written 916973 spots for SRR7169582.sra Read 916973 spots for SRR7169582.sra Written 916973 spots for SRR7169582.sra Read 916973 spots for SRR7169582.sra Written 916973 spots for SRR7169582.sra Read 916973 spots for SRR7169582.sra Written 916973 spots for SRR7169582.sra Read 916973 spots for SRR7169582.sra Written 916973 spots for SRR7169582.sra Read 916986 spots for SRR7169582.sra Written 916986 spots for SRR7169582.sra Read 916973 spots for SRR7169582.sra Written 916973 spots for SRR7169582.sra Read 916973 spots for SRR7169582.sra Written 916973 spots for SRR7169582.sra Read 916973 spots for SRR7169582.sra Written 916973 spots for SRR7169582.sra Read 916973 spots for SRR7169582.sra Written 916973 spots for SRR7169582.sra SRR ids: ['SRR7169582.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ap9p0kly SRR7169582.sra spots: 18339473 blocks: [[1, 916973], [916974, 1833946], [1833947, 2750919], [2750920, 3667892], [3667893, 4584865], [4584866, 5501838], [5501839, 6418811], [6418812, 7335784], [7335785, 8252757], [8252758, 9169730], [9169731, 10086703], [10086704, 11003676], [11003677, 11920649], [11920650, 12837622], [12837623, 13754595], [13754596, 14671568], [14671569, 15588541], [15588542, 16505514], [16505515, 17422487], [17422488, 18339473]] SRR7169582 file size 6192945 SRR7169582 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169582 SRR7169582_1.fastq SRR7169582_2.fastq Input file: SRR7169582_1.fastq Paired file: SRR7169582_2.fastq trimmed: SRR7169582-trimmed-pair1.fastq, SRR7169582-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 07:36:06 2025 >> started Tue Feb 11 07:36:26 2025 >> done (19.955s) 18339473 read pairs processed; of these: 14946 ( 0.08%) short read pairs filtered out after trimming by size control 58845 ( 0.32%) empty read pairs filtered out after trimming by size control 18265682 (99.60%) read pairs available; of these: 7377055 (40.39%) trimmed read pairs available after processing 10888627 (59.61%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 2 0.00% 21 2 0.00% 22 5 0.00% 23 6 0.00% 24 6 0.00% 25 4 0.00% 26 8 0.00% 27 12 0.00% 28 13 0.00% 29 7 0.00% 30 11 0.00% 31 12 0.00% 32 13 0.00% 33 7 0.00% 34 7 0.00% 35 12 0.00% 36 12 0.00% 37 12 0.00% 38 19 0.00% 39 18 0.00% 40 12 0.00% 41 22 0.00% 42 23 0.00% 43 20 0.00% 44 22 0.00% 45 22 0.00% 46 37 0.00% 47 37 0.00% 48 42 0.00% 49 54 0.00% 50 52 0.00% 51 57 0.00% 52 67 0.00% 53 66 0.00% 54 69 0.00% 55 73 0.00% 56 100 0.00% 57 101 0.00% 58 123 0.00% 59 125 0.00% 60 143 0.00% 61 184 0.00% 62 193 0.00% 63 218 0.00% 64 223 0.00% 65 285 0.00% 66 287 0.00% 67 352 0.00% 68 383 0.00% 69 766 0.00% 70 1198 0.01% 71 919 0.01% 72 732 0.00% 73 761 0.00% 74 843 0.00% 75 905 0.00% 76 1029 0.01% 77 1053 0.01% 78 1246 0.01% 79 1374 0.01% 80 1529 0.01% 81 1799 0.01% 82 2116 0.01% 83 2458 0.01% 84 3102 0.02% 85 3814 0.02% 86 4091 0.02% 87 4385 0.02% 88 4718 0.03% 89 5123 0.03% 90 5429 0.03% 91 5809 0.03% 92 6279 0.03% 93 6802 0.04% 94 7206 0.04% 95 7991 0.04% 96 8703 0.05% 97 9012 0.05% 98 9457 0.05% 99 10007 0.05% 100 10554 0.06% 101 11348 0.06% 102 12120 0.07% 103 12971 0.07% 104 13979 0.08% 105 14779 0.08% 106 15405 0.08% 107 16032 0.09% 108 16943 0.09% 109 17697 0.10% 110 18440 0.10% 111 19288 0.11% 112 20714 0.11% 113 22044 0.12% 114 23182 0.13% 115 24690 0.14% 116 25303 0.14% 117 26612 0.15% 118 27289 0.15% 119 27996 0.15% 120 29455 0.16% 121 30891 0.17% 122 32019 0.18% 123 33877 0.19% 124 35341 0.19% 125 37505 0.21% 126 39682 0.22% 127 41218 0.23% 128 42585 0.23% 129 44484 0.24% 130 46663 0.26% 131 48397 0.26% 132 51164 0.28% 133 54110 0.30% 134 57173 0.31% 135 61458 0.34% 136 65008 0.36% 137 69001 0.38% 138 72726 0.40% 139 78156 0.43% 140 82955 0.45% 141 89300 0.49% 142 98004 0.54% 143 108580 0.59% 144 124374 0.68% 145 145709 0.80% 146 176285 0.97% 147 233159 1.28% 148 347747 1.90% 149 689893 3.78% 150 3808510 20.85% 151 10888627 59.61% 18265682 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=43 prefix-density=0.20 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACGAACTGGATTGTGCGCTTGGTCTTGATGGTAGCCACAGCTGCATTCACATCCTTGGGCACAACATCACCTCTATACATCAGGCAGCAAGCCATGTACTTGCCATGACGTGGGTCACACTTGGCCATCATGGATGATGGCTCAAAAGCACTGTTGGTTATCTCAGCCACAGAGAGCTGCTCATGGTATGCCTTCTCTGCGGAGATGACAGGGGCATAAGAGGAAAGCATGAAATGGATCCTGGGGTATGGAACCAAGTTGGTTTGGAACTCAGTAACATCCACATTAAGAGCTCCATCAAACCTTAATGAGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=385.96 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=19.4 sequence=TGCTTTCTTTTCCGTTACATAAGTCTTTACTGTTTGAAGCATAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCAGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.68 fanout-score-rank=33 prefix-density=0.28 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.13 sequence-density-rank=11 fanout-score=49.06 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=13.3 sequence=TGTTGGTGGTGG SRR7169582 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 07:37:08 Started mapping on | Feb 11 07:37:09 Finished on | Feb 11 07:39:09 Mapping speed, Million of reads per hour | 547.97 Number of input reads | 18265682 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 17368606 Uniquely mapped reads % | 95.09% Average mapped length | 295.56 Number of splices: Total | 16508484 Number of splices: Annotated (sjdb) | 16231977 Number of splices: GT/AG | 16271038 Number of splices: GC/AG | 189465 Number of splices: AT/AC | 13591 Number of splices: Non-canonical | 34390 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 312636 % of reads mapped to multiple loci | 1.71% Number of reads mapped to too many loci | 64366 % of reads mapped to too many loci | 0.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.78% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 598153 598153 598153 N_multimapping 312636 312636 312636 N_noFeature 366199 17176044 444945 N_ambiguous 181927 861 67607 UnstrandedReadsAssigned:16820480 PositiveStrandReadsAssigned:191701 NegativeStrandReadsAssigned:16856054 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169582 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169582-trimmed-pair1.fastq SRR7169582-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,265,682 reads, 16,776,662 reads pseudoaligned [quant] estimated average fragment length: 245.347 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,233 rounds 52401 SRR7169582.ke.tsv 34699 SRR7169582.se.tsv 87100 total ==> SRR7169582.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1773.65 318 10.3893 Potri.005G024800.1.v4.1 1035 790.653 47 3.44459 Potri.004G059700.1.v4.1 961 716.683 5 0.404268 Potri.007G009000.2.v4.1 1416 1171.65 0 0 Potri.003G141000.2.v4.1 2943 2698.65 295.068 6.33579 Potri.016G087400.1.v4.1 270 76.602 1564 1183.1 Potri.015G069301.1.v4.1 564 324.4 0 0 Potri.010G195200.1.v4.1 1773 1528.65 15 0.568602 Potri.012G127500.1.v4.1 977 732.661 6366 503.489 ==> SRR7169582.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1448 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 261 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169582 completed mapping pipeline successfully