Starting /dee2/code/volunteer_pipeline.sh SRR7169583 current disk space = 3055112011776 free memory = 1467230096 SRR7169583 SRAfilesize 8c96a5090f42985d775a594259b2a8f5 SRR7169583.sra SRR7169583.sra file validated SRR7169583 is paired end SRR7169583 is conventional basespace SRR7169583 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169583_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.89025 34.0 33.0 34.0 33.0 34.0 2 33.3715 34.0 33.0 34.0 33.0 34.0 3 33.427 34.0 34.0 34.0 33.0 34.0 4 33.497 34.0 34.0 34.0 33.0 34.0 5 33.48 34.0 34.0 34.0 33.0 34.0 6 37.11025 38.0 37.0 38.0 36.0 38.0 7 37.4315 38.0 38.0 38.0 37.0 38.0 8 37.5075 38.0 38.0 38.0 37.0 38.0 9 37.52375 38.0 38.0 38.0 38.0 38.0 10-14 37.5026 38.0 38.0 38.0 37.2 38.0 15-19 37.50695 38.0 38.0 38.0 37.6 38.0 20-24 37.50265 38.0 38.0 38.0 37.8 38.0 25-29 37.4915 38.0 38.0 38.0 37.6 38.0 30-34 37.5255 38.0 38.0 38.0 38.0 38.0 35-39 37.310950000000005 38.0 38.0 38.0 36.8 38.0 40-44 37.328700000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.232749999999996 38.0 38.0 38.0 36.6 38.0 50-54 37.24495 38.0 38.0 38.0 36.8 38.0 55-59 37.193949999999994 38.0 38.0 38.0 36.2 38.0 60-64 37.13885 38.0 38.0 38.0 36.0 38.0 65-69 37.182050000000004 38.0 38.0 38.0 36.0 38.0 70-74 37.0735 38.0 38.0 38.0 36.0 38.0 75-79 37.0093 38.0 38.0 38.0 36.0 38.0 80-84 36.91545 38.0 38.0 38.0 35.8 38.0 85-89 36.80225 38.0 38.0 38.0 35.0 38.0 90-94 36.800450000000005 38.0 38.0 38.0 35.2 38.0 95-99 36.655899999999995 38.0 38.0 38.0 35.0 38.0 100-104 36.6013 38.0 38.0 38.0 34.4 38.0 105-109 36.44734999999999 38.0 38.0 38.0 34.0 38.0 110-114 36.29540000000001 38.0 38.0 38.0 34.0 38.0 115-119 36.09255 38.0 37.6 38.0 33.2 38.0 120-124 35.92565 38.0 37.0 38.0 32.6 38.0 125-129 35.841750000000005 38.0 37.0 38.0 32.6 38.0 130-134 35.71205 38.0 36.6 38.0 32.2 38.0 135-139 35.44595 38.0 36.0 38.0 31.0 38.0 140-144 35.10549999999999 38.0 36.0 38.0 30.0 38.0 145-149 34.463849999999994 38.0 35.2 38.0 27.0 38.0 150-151 31.529375 36.5 31.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 1.0 15 1.0 16 5.0 17 2.0 18 2.0 19 4.0 20 2.0 21 7.0 22 2.0 23 8.0 24 6.0 25 5.0 26 14.0 27 18.0 28 20.0 29 31.0 30 40.0 31 57.0 32 67.0 33 92.0 34 131.0 35 194.0 36 554.0 37 2736.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.61405295315682 12.601832993890019 9.063136456211812 31.720977596741346 2 25.25 14.000000000000002 30.55 30.2 3 20.175 18.3 26.950000000000003 34.575 4 21.875 26.650000000000002 25.55 25.924999999999997 5 23.849999999999998 30.475 24.75 20.925 6 19.675 34.225 24.8 21.3 7 14.45 26.450000000000003 40.2 18.9 8 17.625 26.575 29.475 26.325 9 16.575 25.275 33.85 24.3 10-14 19.74 29.93 27.310000000000002 23.02 15-19 20.1 28.485 28.23 23.185 20-24 19.835 28.43 27.18 24.555 25-29 19.985 28.854999999999997 27.865000000000002 23.294999999999998 30-34 19.675 29.01 27.63 23.685000000000002 35-39 19.945 28.13 27.36 24.565 40-44 20.22 27.92 28.52 23.34 45-49 20.025000000000002 27.91 27.500000000000004 24.565 50-54 20.185 28.470000000000002 27.38 23.965 55-59 20.335 29.2 27.315 23.150000000000002 60-64 20.03 28.485 27.384999999999998 24.099999999999998 65-69 20.29 28.194999999999997 27.800000000000004 23.715 70-74 19.975 28.395 27.47 24.16 75-79 20.025000000000002 28.77 27.474999999999998 23.73 80-84 20.119999999999997 28.08 27.315 24.485 85-89 20.235 28.34 27.694999999999997 23.73 90-94 19.905 28.7 27.544999999999998 23.849999999999998 95-99 19.98 28.144999999999996 27.58 24.295 100-104 20.355 28.57 27.275 23.799999999999997 105-109 20.169999999999998 28.28 27.51 24.04 110-114 20.435 27.800000000000004 27.63 24.135 115-119 20.665 28.67 26.68 23.985 120-124 20.405 28.22 26.91 24.465 125-129 20.265 28.185 27.405 24.145 130-134 21.08 27.99 27.284999999999997 23.645 135-139 20.5 27.915 27.1 24.485 140-144 21.27 27.48 27.57 23.68 145-149 20.7 27.6 27.150000000000002 24.55 150-151 20.599999999999998 27.6375 27.487499999999997 24.275 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 1.0 20 1.0 21 0.5 22 1.0 23 2.0 24 2.0 25 1.5 26 4.5 27 6.5 28 4.5 29 8.0 30 16.5 31 22.5 32 27.5 33 40.5 34 51.0 35 56.0 36 80.5 37 106.0 38 117.5 39 140.5 40 175.0 41 205.0 42 243.5 43 277.0 44 282.0 45 293.5 46 305.5 47 278.5 48 239.0 49 198.0 50 163.0 51 142.5 52 111.5 53 94.0 54 79.0 55 59.5 56 50.5 57 36.0 58 20.0 59 11.0 60 11.0 61 10.5 62 8.0 63 4.5 64 1.5 65 1.5 66 1.0 67 2.0 68 2.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7999999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 0.8875 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.1625 0.0 0.0 0.0 0.0 102-103 1.3125 0.0 0.0 0.0 0.0 104-105 1.5375 0.0 0.0 0.0 0.0 106-107 1.625 0.0 0.0 0.0 0.0 108-109 1.8125 0.0 0.0 0.0 0.0 110-111 2.1125 0.0 0.0 0.0 0.0 112-113 2.3625 0.0 0.0 0.0 0.0 114-115 2.6125 0.0 0.0 0.0 0.0 116-117 2.9 0.0 0.0 0.0 0.0 118-119 3.175 0.0 0.0 0.0 0.0 120-121 3.4375 0.0 0.0 0.0 0.0 122-123 3.6500000000000004 0.0 0.0 0.0 0.0 124-125 3.95 0.0 0.0 0.0 0.0 126-127 4.1875 0.0 0.0 0.0 0.0 128-129 4.55 0.0 0.0 0.0 0.0 130-131 4.7875 0.0 0.0 0.0 0.0 132-133 5.1625 0.0 0.0 0.0 0.0 134-135 5.525 0.0 0.0 0.0 0.0 136-137 5.825 0.0 0.0 0.0 0.0 138-139 6.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169583 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169583_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.72675 33.0 33.0 34.0 32.0 34.0 2 32.769 34.0 33.0 34.0 32.0 34.0 3 32.77925 34.0 33.0 34.0 32.0 34.0 4 32.723 34.0 33.0 34.0 32.0 34.0 5 32.76775 34.0 33.0 34.0 32.0 34.0 6 36.82725 38.0 38.0 38.0 36.0 38.0 7 36.93375 38.0 38.0 38.0 37.0 38.0 8 36.87625 38.0 38.0 38.0 36.0 38.0 9 36.78575 38.0 38.0 38.0 36.0 38.0 10-14 36.8389 38.0 38.0 38.0 36.4 38.0 15-19 36.84195 38.0 38.0 38.0 36.4 38.0 20-24 36.7697 38.0 38.0 38.0 36.0 38.0 25-29 36.7664 38.0 38.0 38.0 36.2 38.0 30-34 36.7427 38.0 38.0 38.0 36.0 38.0 35-39 36.64555 38.0 38.0 38.0 36.0 38.0 40-44 36.704750000000004 38.0 38.0 38.0 36.0 38.0 45-49 36.687349999999995 38.0 38.0 38.0 36.0 38.0 50-54 36.671299999999995 38.0 38.0 38.0 36.0 38.0 55-59 36.193650000000005 38.0 37.8 38.0 33.6 38.0 60-64 36.5227 38.0 38.0 38.0 35.6 38.0 65-69 36.5486 38.0 38.0 38.0 35.6 38.0 70-74 36.40945 38.0 38.0 38.0 35.0 38.0 75-79 36.3326 38.0 38.0 38.0 34.8 38.0 80-84 36.24125 38.0 38.0 38.0 34.2 38.0 85-89 36.142450000000004 38.0 38.0 38.0 34.0 38.0 90-94 36.07 38.0 38.0 38.0 34.0 38.0 95-99 35.99165000000001 38.0 38.0 38.0 33.8 38.0 100-104 35.878699999999995 38.0 38.0 38.0 33.4 38.0 105-109 35.77465 38.0 38.0 38.0 33.2 38.0 110-114 35.613350000000004 38.0 38.0 38.0 32.2 38.0 115-119 35.47915 38.0 37.6 38.0 31.6 38.0 120-124 35.1607 38.0 37.0 38.0 29.6 38.0 125-129 34.92405 38.0 36.6 38.0 28.6 38.0 130-134 34.65045 38.0 36.0 38.0 26.6 38.0 135-139 34.41005 38.0 36.0 38.0 25.2 38.0 140-144 33.99905 38.0 35.0 38.0 22.2 38.0 145-149 33.38215 38.0 35.0 38.0 15.6 38.0 150-151 29.9315 36.0 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 24.0 3 6.0 4 5.0 5 1.0 6 4.0 7 1.0 8 1.0 9 3.0 10 3.0 11 5.0 12 6.0 13 1.0 14 4.0 15 6.0 16 5.0 17 7.0 18 5.0 19 12.0 20 10.0 21 9.0 22 9.0 23 13.0 24 23.0 25 16.0 26 25.0 27 17.0 28 39.0 29 23.0 30 40.0 31 46.0 32 73.0 33 68.0 34 111.0 35 211.0 36 446.0 37 2722.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.54420235411971 24.242424242424242 13.348359629351364 22.865013774104685 2 28.36381859183162 26.284139313455274 27.93786018541719 17.414181909295916 3 20.345778000501127 28.614382360310696 30.944625407166125 20.095214232022048 4 23.72838887496868 32.69857178651967 25.231771485843147 18.341267852668505 5 24.05412177399148 36.20646454522676 21.49837133550489 18.241042345276874 6 22.138742799899823 38.44227397946406 21.362384172301528 18.056599048334583 7 21.011770598547457 22.71475081392437 37.46556473829201 18.80791384923616 8 21.907861792689033 26.164246369554334 27.466199298948425 24.461692538808215 9 21.632448673009513 24.887330996494743 30.42063094641963 23.059589384076116 10-14 23.825503355704697 28.778924171090853 26.149454071922268 21.246118401282178 15-19 23.118144939149595 28.10637551960735 27.815896228777483 20.95958331246557 20-24 23.05534685699975 28.449787127473076 27.488104182319056 21.006761833208117 25-29 23.26070623591285 28.18432256448785 27.563235662409213 20.99173553719008 30-34 22.58953168044077 28.329576759328823 27.973954420235415 21.10693713999499 35-39 22.905083896819434 28.109191084397693 27.853744052091162 21.13198096669171 40-44 23.348525066359493 28.46697050132719 27.12976411078279 21.054740321530524 45-49 23.337339743589745 27.579126602564102 27.43389423076923 21.649639423076923 50-54 22.932104946925698 28.089325055077108 28.204486280793112 20.774083717204086 55-59 23.29994992488733 27.99699549323986 27.656484727090636 21.046569854782174 60-64 23.111979166666664 28.275240384615387 27.754407051282055 20.858373397435898 65-69 23.24835979365954 28.346772174087242 27.300045074372715 21.104822957880504 70-74 23.956924618081644 27.743551214625594 27.427998998246935 20.871525169045828 75-79 23.33466893719323 28.35820895522388 27.98257036962837 20.324551737954522 80-84 23.26955824902334 27.561855153761393 28.313132324952416 20.855454272262847 85-89 24.53794139744553 28.249436513899322 26.96218382168795 20.250438266967194 90-94 23.716503881793138 28.204357625845226 26.9671925870273 21.111945905334334 95-99 23.964748885884532 27.730208802764007 27.805317710680487 20.499724600670973 100-104 23.719393120024034 27.650092634319762 27.71017976065295 20.920334485003256 105-109 24.2992992992993 27.882882882882882 27.86786786786787 19.94994994994995 110-114 23.737980769230766 27.92467948717949 27.734375 20.602964743589745 115-119 23.70912004807933 27.825912756047476 28.386838283167226 20.078128912705964 120-124 23.985775818892115 27.45166783532004 28.28808975257939 20.274466593208455 125-129 24.53794139744553 27.78863010267969 27.302779864763338 20.370648635111447 130-134 24.873528675181568 27.62334084648134 27.518156774355123 19.984973703981968 135-139 24.99248722828809 27.356506060302515 26.785535410197337 20.86547130121206 140-144 24.80969551282051 27.989783653846157 27.358774038461537 19.841746794871796 145-149 24.48550398077212 28.396174452956785 27.259526313154076 19.85879525311702 150-151 24.696761285482054 28.360635238214332 26.79754908090534 20.145054395398272 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 6.0 1 3.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 0.5 20 0.5 21 1.0 22 1.0 23 0.5 24 1.0 25 3.0 26 3.0 27 2.0 28 5.0 29 4.0 30 3.0 31 11.0 32 18.5 33 28.0 34 40.0 35 51.5 36 69.0 37 102.5 38 119.5 39 141.0 40 203.5 41 256.5 42 280.5 43 280.0 44 292.5 45 299.5 46 270.5 47 257.0 48 251.0 49 213.0 50 172.5 51 146.5 52 126.5 53 99.5 54 67.5 55 47.5 56 29.5 57 20.5 58 20.5 59 17.5 60 11.0 61 6.5 62 3.5 63 3.0 64 4.0 65 2.5 66 1.0 67 0.5 68 0.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.22499999999999998 3 0.22499999999999998 4 0.22499999999999998 5 0.22499999999999998 6 0.17500000000000002 7 0.17500000000000002 8 0.15 9 0.15 10-14 0.16999999999999998 15-19 0.165 20-24 0.17500000000000002 25-29 0.17500000000000002 30-34 0.17500000000000002 35-39 0.17500000000000002 40-44 0.165 45-49 0.16 50-54 0.13999999999999999 55-59 0.15 60-64 0.16 65-69 0.165 70-74 0.17500000000000002 75-79 0.16999999999999998 80-84 0.16999999999999998 85-89 0.17500000000000002 90-94 0.17500000000000002 95-99 0.145 100-104 0.145 105-109 0.1 110-114 0.16 115-119 0.165 120-124 0.16999999999999998 125-129 0.17500000000000002 130-134 0.17500000000000002 135-139 0.16999999999999998 140-144 0.16 145-149 0.145 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64850615114236 99.225 2 0.3263871453678132 0.65 3 0.0 0.0 4 0.0 0.0 5 0.025106703489831784 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.575 0.0 0.0 0.0 0.0 94-95 0.6875 0.0 0.0 0.0 0.0 96-97 0.875 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.1625 0.0 0.0 0.0 0.0 102-103 1.3125 0.0 0.0 0.0 0.0 104-105 1.5375 0.0 0.0 0.0 0.0 106-107 1.65 0.0 0.0 0.0 0.0 108-109 1.8375 0.0 0.0 0.0 0.0 110-111 2.1375 0.0 0.0 0.0 0.0 112-113 2.3875 0.0 0.0 0.0 0.0 114-115 2.6125 0.0 0.0 0.0 0.0 116-117 2.8625 0.0 0.0 0.0 0.0 118-119 3.1625 0.0 0.0 0.0 0.0 120-121 3.4375 0.0 0.0 0.0 0.0 122-123 3.625 0.0 0.0 0.0 0.0 124-125 3.925 0.0 0.0 0.0 0.0 126-127 4.1625 0.0 0.0 0.0 0.0 128-129 4.512499999999999 0.0 0.0 0.0 0.0 130-131 4.725 0.0 0.0 0.0 0.0 132-133 5.075 0.0 0.0 0.0 0.0 134-135 5.4 0.0 0.0 0.0 0.0 136-137 5.6875 0.0 0.0 0.0 0.0 138-139 6.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTTTTG 10 0.006830828 145.0 5 >>END_MODULE Read 819957 spots for SRR7169583.sra Written 819957 spots for SRR7169583.sra Read 819957 spots for SRR7169583.sra Written 819957 spots for SRR7169583.sra Read 819957 spots for SRR7169583.sra Written 819957 spots for SRR7169583.sra Read 819957 spots for SRR7169583.sra Written 819957 spots for SRR7169583.sra Read 819957 spots for SRR7169583.sra Written 819957 spots for SRR7169583.sra Read 819957 spots for SRR7169583.sra Written 819957 spots for SRR7169583.sra Read 819957 spots for SRR7169583.sra Written 819957 spots for SRR7169583.sra Read 819957 spots for SRR7169583.sra Written 819957 spots for SRR7169583.sra Read 819957 spots for SRR7169583.sra Written 819957 spots for SRR7169583.sra Read 819957 spots for SRR7169583.sra Written 819957 spots for SRR7169583.sra Read 819957 spots for SRR7169583.sra Written 819957 spots for SRR7169583.sra Read 819957 spots for SRR7169583.sra Written 819957 spots for SRR7169583.sra Read 819957 spots for SRR7169583.sra Written 819957 spots for SRR7169583.sra Read 819957 spots for SRR7169583.sra Written 819957 spots for SRR7169583.sra Read 819957 spots for SRR7169583.sra Written 819957 spots for SRR7169583.sra Read 819961 spots for SRR7169583.sra Written 819961 spots for SRR7169583.sra Read 819957 spots for SRR7169583.sra Written 819957 spots for SRR7169583.sra Read 819957 spots for SRR7169583.sra Written 819957 spots for SRR7169583.sra Read 819957 spots for SRR7169583.sra Written 819957 spots for SRR7169583.sra Read 819957 spots for SRR7169583.sra Written 819957 spots for SRR7169583.sra SRR ids: ['SRR7169583.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_v_u9tel2 SRR7169583.sra spots: 16399144 blocks: [[1, 819957], [819958, 1639914], [1639915, 2459871], [2459872, 3279828], [3279829, 4099785], [4099786, 4919742], [4919743, 5739699], [5739700, 6559656], [6559657, 7379613], [7379614, 8199570], [8199571, 9019527], [9019528, 9839484], [9839485, 10659441], [10659442, 11479398], [11479399, 12299355], [12299356, 13119312], [13119313, 13939269], [13939270, 14759226], [14759227, 15579183], [15579184, 16399144]] SRR7169583 file size 5535431 SRR7169583 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169583 SRR7169583_1.fastq SRR7169583_2.fastq Input file: SRR7169583_1.fastq Paired file: SRR7169583_2.fastq trimmed: SRR7169583-trimmed-pair1.fastq, SRR7169583-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 07:34:58 2025 >> started Tue Feb 11 07:35:17 2025 >> done (19.107s) 16399144 read pairs processed; of these: 26097 ( 0.16%) short read pairs filtered out after trimming by size control 62825 ( 0.38%) empty read pairs filtered out after trimming by size control 16310222 (99.46%) read pairs available; of these: 6756276 (41.42%) trimmed read pairs available after processing 9553946 (58.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 5 0.00% 20 4 0.00% 21 5 0.00% 22 7 0.00% 23 4 0.00% 24 7 0.00% 25 9 0.00% 26 9 0.00% 27 5 0.00% 28 3 0.00% 29 7 0.00% 30 19 0.00% 31 14 0.00% 32 12 0.00% 33 16 0.00% 34 11 0.00% 35 20 0.00% 36 14 0.00% 37 16 0.00% 38 16 0.00% 39 26 0.00% 40 23 0.00% 41 36 0.00% 42 37 0.00% 43 39 0.00% 44 58 0.00% 45 59 0.00% 46 68 0.00% 47 58 0.00% 48 87 0.00% 49 102 0.00% 50 106 0.00% 51 115 0.00% 52 118 0.00% 53 166 0.00% 54 162 0.00% 55 166 0.00% 56 178 0.00% 57 233 0.00% 58 277 0.00% 59 299 0.00% 60 338 0.00% 61 342 0.00% 62 443 0.00% 63 535 0.00% 64 593 0.00% 65 641 0.00% 66 712 0.00% 67 944 0.01% 68 1265 0.01% 69 2484 0.02% 70 3130 0.02% 71 2002 0.01% 72 1658 0.01% 73 1849 0.01% 74 1896 0.01% 75 2029 0.01% 76 2263 0.01% 77 2382 0.01% 78 2641 0.02% 79 2904 0.02% 80 3390 0.02% 81 3828 0.02% 82 4123 0.03% 83 4760 0.03% 84 6193 0.04% 85 7222 0.04% 86 7526 0.05% 87 7795 0.05% 88 8330 0.05% 89 8457 0.05% 90 9092 0.06% 91 9593 0.06% 92 10485 0.06% 93 11196 0.07% 94 11689 0.07% 95 12321 0.08% 96 12839 0.08% 97 13364 0.08% 98 13792 0.08% 99 14384 0.09% 100 15050 0.09% 101 15457 0.09% 102 16697 0.10% 103 17420 0.11% 104 18412 0.11% 105 19501 0.12% 106 19920 0.12% 107 20042 0.12% 108 20957 0.13% 109 21666 0.13% 110 21886 0.13% 111 22723 0.14% 112 23909 0.15% 113 25343 0.16% 114 26193 0.16% 115 27194 0.17% 116 28060 0.17% 117 29137 0.18% 118 29424 0.18% 119 30143 0.18% 120 30982 0.19% 121 32071 0.20% 122 33720 0.21% 123 35372 0.22% 124 37200 0.23% 125 38209 0.23% 126 39632 0.24% 127 40539 0.25% 128 41831 0.26% 129 43606 0.27% 130 45489 0.28% 131 47055 0.29% 132 49576 0.30% 133 51969 0.32% 134 54418 0.33% 135 58714 0.36% 136 61223 0.38% 137 65218 0.40% 138 69429 0.43% 139 72617 0.45% 140 76856 0.47% 141 82224 0.50% 142 90560 0.56% 143 101631 0.62% 144 116122 0.71% 145 135383 0.83% 146 163665 1.00% 147 218057 1.34% 148 320588 1.97% 149 605164 3.71% 150 3233973 19.83% 151 9553946 58.58% 16310222 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.94 fanout-score-rank=33 prefix-density=0.21 prefix-fanout=2.6 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.10 sequence-density-rank=14 fanout-score=230.81 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=27.1 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.46 fanout-score-rank=37 prefix-density=0.33 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=27 fanout-score=211.44 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=24.2 sequence=GAAGAAGAAGAAA SRR7169583 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 07:36:04 Started mapping on | Feb 11 07:36:04 Finished on | Feb 11 07:37:34 Mapping speed, Million of reads per hour | 652.41 Number of input reads | 16310222 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 15539638 Uniquely mapped reads % | 95.28% Average mapped length | 293.82 Number of splices: Total | 14707154 Number of splices: Annotated (sjdb) | 14462226 Number of splices: GT/AG | 14491394 Number of splices: GC/AG | 173620 Number of splices: AT/AC | 12289 Number of splices: Non-canonical | 29851 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 268254 % of reads mapped to multiple loci | 1.64% Number of reads mapped to too many loci | 18077 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.94% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 524961 524961 524961 N_multimapping 268254 268254 268254 N_noFeature 355429 15375915 422221 N_ambiguous 162157 876 64603 UnstrandedReadsAssigned:15022052 PositiveStrandReadsAssigned:162847 NegativeStrandReadsAssigned:15052814 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169583 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169583-trimmed-pair1.fastq SRR7169583-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,310,222 reads, 14,960,184 reads pseudoaligned [quant] estimated average fragment length: 252.039 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,281 rounds 52401 SRR7169583.ke.tsv 34699 SRR7169583.se.tsv 87100 total ==> SRR7169583.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1766.96 309 11.7084 Potri.005G024800.1.v4.1 1035 783.961 46 3.92851 Potri.004G059700.1.v4.1 961 710.051 2 0.188584 Potri.007G009000.2.v4.1 1416 1164.96 0 0 Potri.003G141000.2.v4.1 2943 2691.96 228 5.67062 Potri.016G087400.1.v4.1 270 80.2162 1598 1333.76 Potri.015G069301.1.v4.1 564 320.552 0 0 Potri.010G195200.1.v4.1 1773 1521.96 29 1.27573 Potri.012G127500.1.v4.1 977 726.01 9142 843.069 ==> SRR7169583.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1727 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 335 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 15 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169583 completed mapping pipeline successfully