Starting /dee2/code/volunteer_pipeline.sh SRR7169584 current disk space = 3055620333568 free memory = 1473940952 SRR7169584 SRAfilesize 849254c1ac8b89450822b59182bbb5c9 SRR7169584.sra SRR7169584.sra file validated SRR7169584 is paired end SRR7169584 is conventional basespace SRR7169584 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169584_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.84775 34.0 33.0 34.0 33.0 34.0 2 33.3835 34.0 34.0 34.0 33.0 34.0 3 33.45675 34.0 34.0 34.0 33.0 34.0 4 33.469 34.0 34.0 34.0 33.0 34.0 5 33.53775 34.0 34.0 34.0 33.0 34.0 6 37.05275 38.0 37.0 38.0 36.0 38.0 7 37.338 38.0 38.0 38.0 37.0 38.0 8 37.444 38.0 38.0 38.0 37.0 38.0 9 37.5295 38.0 38.0 38.0 38.0 38.0 10-14 37.567750000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.522800000000004 38.0 38.0 38.0 37.4 38.0 20-24 37.49745 38.0 38.0 38.0 37.4 38.0 25-29 37.48335 38.0 38.0 38.0 37.2 38.0 30-34 37.456399999999995 38.0 38.0 38.0 37.4 38.0 35-39 37.236 38.0 38.0 38.0 36.8 38.0 40-44 37.3062 38.0 38.0 38.0 37.0 38.0 45-49 37.26755000000001 38.0 38.0 38.0 37.0 38.0 50-54 37.218450000000004 38.0 38.0 38.0 36.6 38.0 55-59 37.16955 38.0 38.0 38.0 36.2 38.0 60-64 37.184549999999994 38.0 38.0 38.0 36.2 38.0 65-69 37.0717 38.0 38.0 38.0 36.0 38.0 70-74 37.01445 38.0 38.0 38.0 36.0 38.0 75-79 36.94445 38.0 38.0 38.0 36.0 38.0 80-84 36.8975 38.0 38.0 38.0 35.4 38.0 85-89 36.80085 38.0 38.0 38.0 35.0 38.0 90-94 36.78365 38.0 38.0 38.0 35.0 38.0 95-99 36.598200000000006 38.0 38.0 38.0 34.2 38.0 100-104 36.45604999999999 38.0 38.0 38.0 34.0 38.0 105-109 36.400800000000004 38.0 38.0 38.0 34.0 38.0 110-114 36.286150000000006 38.0 37.6 38.0 33.8 38.0 115-119 36.0851 38.0 37.2 38.0 33.2 38.0 120-124 35.98655 38.0 37.0 38.0 33.0 38.0 125-129 35.779999999999994 38.0 37.0 38.0 31.8 38.0 130-134 35.52569999999999 38.0 36.2 38.0 30.6 38.0 135-139 35.23094999999999 38.0 36.0 38.0 30.0 38.0 140-144 34.82845 38.0 35.4 38.0 28.0 38.0 145-149 34.18615 38.0 35.0 38.0 25.8 38.0 150-151 31.2225 36.5 31.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 1.0 13 1.0 14 2.0 15 1.0 16 3.0 17 3.0 18 1.0 19 3.0 20 4.0 21 5.0 22 2.0 23 10.0 24 9.0 25 8.0 26 15.0 27 23.0 28 21.0 29 32.0 30 39.0 31 41.0 32 58.0 33 75.0 34 127.0 35 271.0 36 597.0 37 2647.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.60509554140127 11.10828025477707 8.509554140127388 38.77707006369427 2 24.2 13.525 33.2 29.075 3 20.875 18.425 25.324999999999996 35.375 4 22.725 26.724999999999998 23.0 27.55 5 23.599999999999998 31.674999999999997 22.375 22.35 6 19.775000000000002 34.55 24.8 20.875 7 14.799999999999999 26.900000000000002 42.0 16.3 8 18.025 25.650000000000002 31.424999999999997 24.9 9 18.175 24.775 33.300000000000004 23.75 10-14 19.285 30.435000000000002 27.43 22.85 15-19 19.605 28.58 28.050000000000004 23.765 20-24 19.905 28.705000000000002 27.855 23.535 25-29 19.655 28.785 27.834999999999997 23.724999999999998 30-34 19.869999999999997 28.485 27.79 23.855 35-39 20.05501375343836 28.992248062015502 27.321830457614404 23.63090772693173 40-44 20.119999999999997 29.385 26.840000000000003 23.655 45-49 20.235 28.705000000000002 27.155 23.905 50-54 20.21 28.645 27.639999999999997 23.505000000000003 55-59 20.330000000000002 28.994999999999997 27.425 23.25 60-64 19.97 29.01 27.060000000000002 23.96 65-69 20.064999999999998 28.59 27.66 23.685000000000002 70-74 20.3 28.205000000000002 27.750000000000004 23.745 75-79 19.89 28.715000000000003 27.37 24.025 80-84 20.36 27.725 27.794999999999998 24.12 85-89 20.64 28.549999999999997 27.169999999999998 23.64 90-94 20.44 29.21 27.025 23.325000000000003 95-99 20.985 27.915 27.33 23.77 100-104 20.565 28.599999999999998 27.060000000000002 23.775 105-109 20.31 28.325 27.54 23.825 110-114 19.794999999999998 28.305000000000003 27.939999999999998 23.96 115-119 20.805 28.384999999999998 27.439999999999998 23.369999999999997 120-124 20.674999999999997 28.025 27.13 24.169999999999998 125-129 20.445 28.565 26.950000000000003 24.04 130-134 21.44 28.1 27.485 22.975 135-139 20.59 28.025 27.205000000000002 24.18 140-144 21.38 28.37 26.56 23.69 145-149 20.865000000000002 27.97 27.465 23.7 150-151 20.9375 28.549999999999997 26.85 23.6625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 1.5 20 1.5 21 1.0 22 1.0 23 0.5 24 1.5 25 2.5 26 4.5 27 6.5 28 8.0 29 9.5 30 17.0 31 25.0 32 30.0 33 41.5 34 53.5 35 66.5 36 77.0 37 88.0 38 119.5 39 155.5 40 176.5 41 215.5 42 242.5 43 250.0 44 280.5 45 289.0 46 284.5 47 260.5 48 237.0 49 227.0 50 193.5 51 150.5 52 112.0 53 91.0 54 74.5 55 60.5 56 42.0 57 29.5 58 26.0 59 17.5 60 9.5 61 4.5 62 2.0 63 2.0 64 2.0 65 2.0 66 1.5 67 0.5 68 0.0 69 0.0 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.875 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.025 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2125 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.36250000000000004 0.0 0.0 0.0 0.0 96-97 0.42500000000000004 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.5874999999999999 0.0 0.0 0.0 0.0 102-103 0.6625 0.0 0.0 0.0 0.0 104-105 0.8 0.0 0.0 0.0 0.0 106-107 1.0 0.0 0.0 0.0 0.0 108-109 1.15 0.0 0.0 0.0 0.0 110-111 1.2625 0.0 0.0 0.0 0.0 112-113 1.475 0.0 0.0 0.0 0.0 114-115 1.7 0.0 0.0 0.0 0.0 116-117 1.9375 0.0 0.0 0.0 0.0 118-119 2.1375 0.0 0.0 0.0 0.0 120-121 2.425 0.0 0.0 0.0 0.0 122-123 2.6625 0.0 0.0 0.0 0.0 124-125 2.925 0.0 0.0 0.0 0.0 126-127 3.35 0.0 0.0 0.0 0.0 128-129 3.7375 0.0 0.0 0.0 0.0 130-131 4.112500000000001 0.0 0.0 0.0 0.0 132-133 4.5125 0.0 0.0 0.0 0.0 134-135 4.9375 0.0 0.0 0.0 0.0 136-137 5.35 0.0 0.0 0.0 0.0 138-139 5.637499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169584 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169584_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.94325 33.0 33.0 34.0 32.0 34.0 2 33.00325 34.0 33.0 34.0 32.0 34.0 3 33.11 34.0 33.0 34.0 33.0 34.0 4 33.046 34.0 33.0 34.0 33.0 34.0 5 33.037 34.0 33.0 34.0 32.0 34.0 6 37.07525 38.0 38.0 38.0 37.0 38.0 7 37.145 38.0 38.0 38.0 37.0 38.0 8 37.1595 38.0 38.0 38.0 37.0 38.0 9 37.1715 38.0 38.0 38.0 37.0 38.0 10-14 37.125 38.0 38.0 38.0 37.0 38.0 15-19 37.058299999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.019 38.0 38.0 38.0 37.0 38.0 25-29 37.01545 38.0 38.0 38.0 36.6 38.0 30-34 36.9447 38.0 38.0 38.0 36.0 38.0 35-39 36.9157 38.0 38.0 38.0 36.2 38.0 40-44 36.9491 38.0 38.0 38.0 36.2 38.0 45-49 36.9023 38.0 38.0 38.0 36.0 38.0 50-54 36.8708 38.0 38.0 38.0 36.0 38.0 55-59 36.607099999999996 38.0 38.0 38.0 35.2 38.0 60-64 36.81374999999999 38.0 38.0 38.0 36.0 38.0 65-69 36.759699999999995 38.0 38.0 38.0 36.0 38.0 70-74 36.6448 38.0 38.0 38.0 35.0 38.0 75-79 36.632099999999994 38.0 38.0 38.0 35.4 38.0 80-84 36.471050000000005 38.0 38.0 38.0 34.8 38.0 85-89 36.39810000000001 38.0 38.0 38.0 34.2 38.0 90-94 36.307249999999996 38.0 38.0 38.0 34.0 38.0 95-99 36.25175 38.0 38.0 38.0 34.0 38.0 100-104 36.102850000000004 38.0 38.0 38.0 33.8 38.0 105-109 36.00840000000001 38.0 38.0 38.0 33.6 38.0 110-114 35.829899999999995 38.0 37.6 38.0 32.6 38.0 115-119 35.7029 38.0 37.2 38.0 32.6 38.0 120-124 35.44345 38.0 37.0 38.0 31.4 38.0 125-129 35.1661 38.0 36.2 38.0 29.2 38.0 130-134 34.878600000000006 38.0 36.0 38.0 27.8 38.0 135-139 34.4797 38.0 35.4 38.0 26.8 38.0 140-144 33.9666 38.0 35.0 38.0 23.0 38.0 145-149 33.406349999999996 38.0 34.8 38.0 19.0 38.0 150-151 29.616374999999998 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 9.0 4 0.0 5 1.0 6 2.0 7 2.0 8 0.0 9 1.0 10 0.0 11 3.0 12 4.0 13 2.0 14 2.0 15 2.0 16 4.0 17 4.0 18 6.0 19 7.0 20 11.0 21 14.0 22 10.0 23 9.0 24 20.0 25 10.0 26 22.0 27 27.0 28 27.0 29 33.0 30 49.0 31 45.0 32 63.0 33 81.0 34 139.0 35 226.0 36 545.0 37 2612.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.15 23.5 13.825000000000001 27.525 2 29.375 25.575 28.9 16.150000000000002 3 21.0 27.775 31.85 19.375 4 22.5 34.050000000000004 24.425 19.025 5 23.25 36.35 22.650000000000002 17.75 6 20.857357733767863 37.25244422160942 23.564803208824266 18.325394835798445 7 19.132397191574725 21.564694082246742 39.46840521564694 19.834503510531594 8 21.78490849837052 26.096766106793684 27.901729756831283 24.216595638004513 9 21.634494860867385 25.19428428177488 29.781900225620454 23.389320631737277 10-14 22.8088648215002 28.89089450461292 26.699759326113114 21.600481347773766 15-19 22.285169958889 28.376616865536953 28.02566930712925 21.3125438684448 20-24 22.92418772563177 28.04352186121139 28.078620136381872 20.953670276774968 25-29 22.717473050889947 28.60867385309601 27.505640511406366 21.16821258460767 30-34 22.803850782190132 28.544925792218212 27.993381468110712 20.657841957480947 35-39 22.842817748809225 28.292805214339435 28.04211581850088 20.822261218350462 40-44 22.952380952380953 28.967418546365913 27.644110275689222 20.43609022556391 45-49 23.103137215595872 27.99939861681868 28.03447930239551 20.862984865189937 50-54 22.92199007966331 28.658750438398716 27.135628037476828 21.283631444461147 55-59 23.273875137789357 27.783345024551558 28.50987072852991 20.43290910912917 60-64 23.12471814400962 28.4160946033973 27.834844916570628 20.624342336022448 65-69 23.2249336072556 27.945081926141203 27.749661772811546 21.080322693791654 70-74 23.55889724310777 27.598997493734334 28.035087719298247 20.807017543859647 75-79 22.752330359827603 27.823995188934546 28.495539741405235 20.928134709832616 80-84 23.363080316855513 27.805073698987265 27.599518700491327 21.232327283665896 85-89 23.425275827482448 27.7432296890672 27.973921765295888 20.85757271815446 90-94 23.805225414974174 27.33062534476706 27.95245975628103 20.911689483977735 95-99 23.437421683123652 28.12390356373114 27.92341236028269 20.515262392862514 100-104 23.773490353294914 28.013029315960914 27.84264595339514 20.370834377349034 105-109 23.842685370741485 27.62024048096192 27.595190380761526 20.941883767535067 110-114 23.981560354762742 27.614370897429474 27.544220073157287 20.8598486746505 115-119 23.930039089906785 28.179813571213792 27.35792322341385 20.53222411546557 120-124 23.94888499123027 28.053119518917562 27.276371836632425 20.721623653219744 125-129 24.26079983963115 27.829006715445527 27.398015435501655 20.51217800942167 130-134 24.47373696872494 27.435846030473137 27.490978348035284 20.59943865276664 135-139 24.451127819548873 27.88972431077694 27.518796992481203 20.140350877192983 140-144 24.393666065343755 27.991581479254357 27.104630186410102 20.510122268991783 145-149 25.34569138276553 27.76553106212425 26.613226452905813 20.27555110220441 150-151 24.39634680345302 28.324784186162894 27.94945577380208 19.32941323658201 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 1.0 2 1.5 3 2.5 4 2.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.5 23 1.5 24 2.0 25 3.0 26 4.5 27 6.0 28 6.0 29 10.5 30 11.0 31 16.0 32 27.0 33 37.0 34 42.0 35 50.5 36 84.0 37 106.5 38 147.5 39 191.5 40 209.0 41 231.5 42 249.5 43 279.5 44 278.5 45 278.0 46 294.0 47 269.5 48 218.5 49 188.0 50 160.0 51 122.5 52 117.0 53 98.0 54 65.5 55 52.0 56 43.5 57 28.5 58 17.5 59 13.5 60 8.0 61 5.5 62 5.0 63 4.0 64 2.0 65 0.5 66 0.5 67 1.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.27499999999999997 7 0.3 8 0.27499999999999997 9 0.27499999999999997 10-14 0.27999999999999997 15-19 0.27 20-24 0.27999999999999997 25-29 0.27499999999999997 30-34 0.27999999999999997 35-39 0.27499999999999997 40-44 0.25 45-49 0.22999999999999998 50-54 0.20500000000000002 55-59 0.21 60-64 0.215 65-69 0.215 70-74 0.25 75-79 0.22999999999999998 80-84 0.27 85-89 0.3 90-94 0.295 95-99 0.245 100-104 0.22499999999999998 105-109 0.2 110-114 0.215 115-119 0.22999999999999998 120-124 0.22499999999999998 125-129 0.22999999999999998 130-134 0.24 135-139 0.25 140-144 0.22 145-149 0.2 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44681921046015 98.875 2 0.5280362081971335 1.05 3 0.025144581342720643 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.5375000000000001 0.0 0.0 0.0 0.0 102-103 0.6125 0.0 0.0 0.0 0.0 104-105 0.725 0.0 0.0 0.0 0.0 106-107 0.925 0.0 0.0 0.0 0.0 108-109 1.0750000000000002 0.0 0.0 0.0 0.0 110-111 1.1875 0.0 0.0 0.0 0.0 112-113 1.375 0.0 0.0 0.0 0.0 114-115 1.625 0.0 0.0 0.0 0.0 116-117 1.8625 0.0 0.0 0.0 0.0 118-119 2.075 0.0 0.0 0.0 0.0 120-121 2.3499999999999996 0.0 0.0 0.0 0.0 122-123 2.575 0.0 0.0 0.0 0.0 124-125 2.8375000000000004 0.0 0.0 0.0 0.0 126-127 3.2874999999999996 0.0 0.0 0.0 0.0 128-129 3.6625 0.0 0.0 0.0 0.0 130-131 4.0125 0.0 0.0 0.0 0.0 132-133 4.4125 0.0 0.0 0.0 0.0 134-135 4.8375 0.0 0.0 0.0 0.0 136-137 5.275 0.0 0.0 0.0 0.0 138-139 5.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAACCA 10 0.006830828 145.0 3 ATCAAAT 10 0.006830828 145.0 1 >>END_MODULE Read 838924 spots for SRR7169584.sra Written 838924 spots for SRR7169584.sra Read 838924 spots for SRR7169584.sra Written 838924 spots for SRR7169584.sra Read 838924 spots for SRR7169584.sra Written 838924 spots for SRR7169584.sra Read 838924 spots for SRR7169584.sra Written 838924 spots for SRR7169584.sra Read 838924 spots for SRR7169584.sra Written 838924 spots for SRR7169584.sra Read 838924 spots for SRR7169584.sra Written 838924 spots for SRR7169584.sra Read 838924 spots for SRR7169584.sra Written 838924 spots for SRR7169584.sra Read 838924 spots for SRR7169584.sra Written 838924 spots for SRR7169584.sra Read 838924 spots for SRR7169584.sra Written 838924 spots for SRR7169584.sra Read 838924 spots for SRR7169584.sra Written 838924 spots for SRR7169584.sra Read 838924 spots for SRR7169584.sra Written 838924 spots for SRR7169584.sra Read 838924 spots for SRR7169584.sra Written 838924 spots for SRR7169584.sra Read 838924 spots for SRR7169584.sra Written 838924 spots for SRR7169584.sra Read 838924 spots for SRR7169584.sra Written 838924 spots for SRR7169584.sra Read 838931 spots for SRR7169584.sra Written 838931 spots for SRR7169584.sra Read 838924 spots for SRR7169584.sra Written 838924 spots for SRR7169584.sra Read 838924 spots for SRR7169584.sra Written 838924 spots for SRR7169584.sra Read 838924 spots for SRR7169584.sra Written 838924 spots for SRR7169584.sra Read 838924 spots for SRR7169584.sra Written 838924 spots for SRR7169584.sra Read 838924 spots for SRR7169584.sra Written 838924 spots for SRR7169584.sra SRR ids: ['SRR7169584.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_c3lr__w_ SRR7169584.sra spots: 16778487 blocks: [[1, 838924], [838925, 1677848], [1677849, 2516772], [2516773, 3355696], [3355697, 4194620], [4194621, 5033544], [5033545, 5872468], [5872469, 6711392], [6711393, 7550316], [7550317, 8389240], [8389241, 9228164], [9228165, 10067088], [10067089, 10906012], [10906013, 11744936], [11744937, 12583860], [12583861, 13422784], [13422785, 14261708], [14261709, 15100632], [15100633, 15939556], [15939557, 16778487]] SRR7169584 file size 5663978 SRR7169584 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169584 SRR7169584_1.fastq SRR7169584_2.fastq Input file: SRR7169584_1.fastq Paired file: SRR7169584_2.fastq trimmed: SRR7169584-trimmed-pair1.fastq, SRR7169584-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 07:37:43 2025 >> started Tue Feb 11 07:38:03 2025 >> done (19.591s) 16778487 read pairs processed; of these: 32884 ( 0.20%) short read pairs filtered out after trimming by size control 34929 ( 0.21%) empty read pairs filtered out after trimming by size control 16710674 (99.60%) read pairs available; of these: 7889930 (47.21%) trimmed read pairs available after processing 8820744 (52.79%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 6 0.00% 21 3 0.00% 22 8 0.00% 23 8 0.00% 24 5 0.00% 25 6 0.00% 26 6 0.00% 27 8 0.00% 28 6 0.00% 29 7 0.00% 30 9 0.00% 31 2 0.00% 32 8 0.00% 33 4 0.00% 34 6 0.00% 35 14 0.00% 36 8 0.00% 37 6 0.00% 38 14 0.00% 39 16 0.00% 40 16 0.00% 41 23 0.00% 42 21 0.00% 43 19 0.00% 44 28 0.00% 45 21 0.00% 46 22 0.00% 47 40 0.00% 48 36 0.00% 49 51 0.00% 50 55 0.00% 51 53 0.00% 52 67 0.00% 53 88 0.00% 54 79 0.00% 55 104 0.00% 56 118 0.00% 57 125 0.00% 58 138 0.00% 59 142 0.00% 60 188 0.00% 61 220 0.00% 62 235 0.00% 63 308 0.00% 64 315 0.00% 65 345 0.00% 66 408 0.00% 67 460 0.00% 68 614 0.00% 69 964 0.01% 70 983 0.01% 71 883 0.01% 72 919 0.01% 73 1026 0.01% 74 1180 0.01% 75 1309 0.01% 76 1335 0.01% 77 1567 0.01% 78 1739 0.01% 79 1930 0.01% 80 2229 0.01% 81 2609 0.02% 82 2839 0.02% 83 3357 0.02% 84 4381 0.03% 85 4899 0.03% 86 5060 0.03% 87 5360 0.03% 88 6004 0.04% 89 6260 0.04% 90 6797 0.04% 91 7486 0.04% 92 8016 0.05% 93 8336 0.05% 94 9041 0.05% 95 9571 0.06% 96 10162 0.06% 97 10432 0.06% 98 10981 0.07% 99 11560 0.07% 100 12201 0.07% 101 13068 0.08% 102 14063 0.08% 103 14834 0.09% 104 15626 0.09% 105 16628 0.10% 106 17368 0.10% 107 18117 0.11% 108 18514 0.11% 109 19423 0.12% 110 19843 0.12% 111 21011 0.13% 112 22464 0.13% 113 23367 0.14% 114 24472 0.15% 115 25704 0.15% 116 26872 0.16% 117 27826 0.17% 118 28717 0.17% 119 29063 0.17% 120 30460 0.18% 121 31999 0.19% 122 33142 0.20% 123 34191 0.20% 124 37102 0.22% 125 38355 0.23% 126 40436 0.24% 127 42190 0.25% 128 43990 0.26% 129 45980 0.28% 130 48588 0.29% 131 50553 0.30% 132 53094 0.32% 133 56920 0.34% 134 60074 0.36% 135 64402 0.39% 136 69170 0.41% 137 74180 0.44% 138 79452 0.48% 139 84505 0.51% 140 91110 0.55% 141 99247 0.59% 142 109628 0.66% 143 122165 0.73% 144 141422 0.85% 145 167286 1.00% 146 204579 1.22% 147 278328 1.67% 148 428353 2.56% 149 848401 5.08% 150 3817738 22.85% 151 8820744 52.79% 16710674 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.61 fanout-score-rank=33 prefix-density=0.24 prefix-fanout=2.4 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.04 sequence-density-rank=41 fanout-score=102.25 fanout-score-rank=1 prefix-density=0.60 prefix-fanout=7.4 sequence=CCACCAACATGTTCCACACCGGGATAAGATGGGGCATCCTCAATGACGTGGGGCAGATCAAAGTTAATGCCCTTAATTGAAGGGTATTTAGAGACGATGGTGTTAACGACAGCTCCAGT criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.61 fanout-score-rank=35 prefix-density=0.33 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.16 sequence-density-rank=16 fanout-score=37.04 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=11.3 sequence=TGTTGGTGGTGGTACTGGA SRR7169584 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 07:38:46 Started mapping on | Feb 11 07:38:46 Finished on | Feb 11 07:40:24 Mapping speed, Million of reads per hour | 613.86 Number of input reads | 16710674 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 16095502 Uniquely mapped reads % | 96.32% Average mapped length | 294.30 Number of splices: Total | 15188384 Number of splices: Annotated (sjdb) | 14930022 Number of splices: GT/AG | 14981412 Number of splices: GC/AG | 163737 Number of splices: AT/AC | 13209 Number of splices: Non-canonical | 30026 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.02% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 262264 % of reads mapped to multiple loci | 1.57% Number of reads mapped to too many loci | 20125 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.96% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 368146 368146 368146 N_multimapping 262264 262264 262264 N_noFeature 402843 15877634 505373 N_ambiguous 182935 1088 66743 UnstrandedReadsAssigned:15509724 PositiveStrandReadsAssigned:216780 NegativeStrandReadsAssigned:15523386 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169584 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169584-trimmed-pair1.fastq SRR7169584-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,710,674 reads, 15,411,864 reads pseudoaligned [quant] estimated average fragment length: 253.045 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,091 rounds 52401 SRR7169584.ke.tsv 34699 SRR7169584.se.tsv 87100 total ==> SRR7169584.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1765.96 289 11.3817 Potri.005G024800.1.v4.1 1035 782.955 33 2.93133 Potri.004G059700.1.v4.1 961 709.001 7 0.686655 Potri.007G009000.2.v4.1 1416 1163.96 0 0 Potri.003G141000.2.v4.1 2943 2690.96 292.059 7.54835 Potri.016G087400.1.v4.1 270 78.7928 896.832 791.611 Potri.015G069301.1.v4.1 564 319.107 0 0 Potri.010G195200.1.v4.1 1773 1520.96 14 0.640175 Potri.012G127500.1.v4.1 977 724.978 2360 226.399 ==> SRR7169584.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1918 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 277 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 15 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169584 completed mapping pipeline successfully