Starting /dee2/code/volunteer_pipeline.sh SRR7169585 current disk space = 3055624867840 free memory = 1189417504 SRR7169585 SRAfilesize b2805d1c8927eafe83b838abb7e01c86 SRR7169585.sra SRR7169585.sra file validated SRR7169585 is paired end SRR7169585 is conventional basespace SRR7169585 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169585_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.87375 34.0 33.0 34.0 33.0 34.0 2 33.368 34.0 33.0 34.0 33.0 34.0 3 33.412 34.0 34.0 34.0 33.0 34.0 4 33.43875 34.0 34.0 34.0 33.0 34.0 5 33.465 34.0 34.0 34.0 33.0 34.0 6 37.09375 38.0 37.0 38.0 36.0 38.0 7 37.2635 38.0 38.0 38.0 36.0 38.0 8 37.00075 38.0 38.0 38.0 36.0 38.0 9 37.4045 38.0 38.0 38.0 37.0 38.0 10-14 37.47245 38.0 38.0 38.0 37.2 38.0 15-19 37.4584 38.0 38.0 38.0 37.0 38.0 20-24 37.49465 38.0 38.0 38.0 37.4 38.0 25-29 37.4728 38.0 38.0 38.0 37.0 38.0 30-34 37.4497 38.0 38.0 38.0 37.2 38.0 35-39 37.32525 38.0 38.0 38.0 37.0 38.0 40-44 37.198 38.0 38.0 38.0 36.6 38.0 45-49 37.3009 38.0 38.0 38.0 37.0 38.0 50-54 37.228649999999995 38.0 38.0 38.0 37.0 38.0 55-59 37.1337 38.0 38.0 38.0 36.0 38.0 60-64 37.1511 38.0 38.0 38.0 36.0 38.0 65-69 37.117999999999995 38.0 38.0 38.0 36.0 38.0 70-74 36.954649999999994 38.0 38.0 38.0 36.0 38.0 75-79 36.871599999999994 38.0 38.0 38.0 35.6 38.0 80-84 36.82675 38.0 38.0 38.0 35.6 38.0 85-89 36.715199999999996 38.0 38.0 38.0 35.0 38.0 90-94 36.62915 38.0 38.0 38.0 34.8 38.0 95-99 36.46695 38.0 38.0 38.0 34.0 38.0 100-104 36.382099999999994 38.0 38.0 38.0 34.0 38.0 105-109 36.18555 38.0 38.0 38.0 33.6 38.0 110-114 36.0792 38.0 37.4 38.0 33.4 38.0 115-119 35.943349999999995 38.0 37.0 38.0 33.0 38.0 120-124 35.7598 38.0 37.0 38.0 32.4 38.0 125-129 35.673 38.0 36.8 38.0 31.8 38.0 130-134 35.37395 38.0 36.0 38.0 30.4 38.0 135-139 35.1567 38.0 36.0 38.0 29.8 38.0 140-144 34.668899999999994 38.0 35.0 38.0 27.4 38.0 145-149 34.03335 38.0 35.0 38.0 23.8 38.0 150-151 30.381500000000003 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 4.0 14 2.0 15 2.0 16 1.0 17 3.0 18 5.0 19 8.0 20 3.0 21 4.0 22 7.0 23 2.0 24 11.0 25 15.0 26 17.0 27 16.0 28 17.0 29 35.0 30 47.0 31 65.0 32 59.0 33 94.0 34 119.0 35 219.0 36 600.0 37 2643.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.4743687834736 13.899515429737312 10.68604947717419 34.94006630961489 2 24.65 14.075 30.175 31.1 3 21.349999999999998 16.225 25.474999999999998 36.95 4 22.55 22.35 22.7 32.4 5 22.675 28.425 23.825 25.074999999999996 6 21.3 31.65 24.925 22.125 7 15.725 29.825000000000003 37.45 17.0 8 18.025 28.999999999999996 29.925 23.05 9 17.775 27.025 33.650000000000006 21.55 10-14 18.970000000000002 31.78 26.85 22.400000000000002 15-19 19.540977048852444 29.746487324366218 27.701385069253465 23.011150557527877 20-24 20.07 29.404999999999998 27.38 23.145 25-29 19.939999999999998 29.645 27.055 23.36 30-34 19.919999999999998 29.5 26.75 23.830000000000002 35-39 20.085 29.04 27.52 23.355 40-44 19.98 28.67 27.445000000000004 23.905 45-49 19.744999999999997 29.104999999999997 27.51 23.64 50-54 20.09 29.185 27.47 23.255 55-59 20.075000000000003 28.634999999999998 27.355 23.935000000000002 60-64 20.001000050002503 28.39141957097855 27.466373318665934 24.141207060353018 65-69 20.19 29.349999999999998 26.810000000000002 23.65 70-74 19.985 28.785 27.16 24.07 75-79 20.32101605080254 29.19145957297865 27.086354317715887 23.401170058502927 80-84 20.45 28.494999999999997 26.724999999999998 24.33 85-89 20.355 28.325 27.229999999999997 24.09 90-94 20.046002300115006 28.991449572478622 27.44637231861593 23.51617580879044 95-99 20.16600830041502 28.15640782039102 27.76638831941597 23.91119555977799 100-104 20.56602830141507 28.7964398219911 26.94634731736587 23.691184559227963 105-109 20.420105026256564 28.877219304826205 26.456614153538382 24.246061515378845 110-114 19.73 28.78 27.439999999999998 24.05 115-119 19.93 28.910000000000004 27.155 24.005000000000003 120-124 20.285 28.18 27.405 24.13 125-129 21.16 28.16 26.729999999999997 23.95 130-134 21.15 27.83 26.83 24.19 135-139 20.724999999999998 28.110000000000003 27.18 23.985 140-144 20.691034551727586 27.951397569878495 26.631331566578332 24.72623631181559 145-149 21.645 27.700000000000003 26.63 24.025 150-151 21.475 27.762500000000003 26.5125 24.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 0.5 23 1.5 24 3.5 25 2.5 26 1.5 27 6.0 28 7.5 29 9.5 30 21.5 31 31.5 32 42.5 33 59.0 34 69.0 35 71.0 36 93.5 37 108.5 38 114.5 39 147.0 40 179.5 41 207.5 42 235.0 43 250.0 44 247.5 45 248.5 46 256.0 47 257.5 48 244.0 49 219.0 50 187.5 51 151.5 52 122.5 53 93.5 54 75.5 55 63.0 56 47.0 57 36.0 58 23.0 59 14.0 60 10.5 61 9.5 62 7.5 63 4.0 64 3.0 65 3.0 66 2.5 67 3.5 68 2.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.975 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.005 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.005 65-69 0.0 70-74 0.0 75-79 0.005 80-84 0.0 85-89 0.0 90-94 0.005 95-99 0.005 100-104 0.005 105-109 0.025 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49622166246851 98.75 2 0.4030226700251889 0.8 3 0.05037783375314861 0.15 4 0.025188916876574305 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025188916876574305 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGGCCGATCTCGTATGC 8 0.2 TruSeq Adapter, Index 13 (97% over 37bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.6375 0.0 0.0 0.0 0.0 106-107 0.725 0.025 0.0 0.0 0.0 108-109 0.825 0.025 0.0 0.0 0.0 110-111 0.95 0.025 0.0 0.0 0.0 112-113 1.025 0.025 0.0 0.0 0.0 114-115 1.1625 0.025 0.0 0.0 0.0 116-117 1.45 0.025 0.0 0.0 0.0 118-119 1.7125 0.025 0.0 0.0 0.0 120-121 1.9625 0.025 0.0 0.0 0.0 122-123 2.1625 0.025 0.0 0.0 0.0 124-125 2.3125 0.025 0.0 0.0 0.0 126-127 2.5625 0.025 0.0 0.0 0.0 128-129 2.95 0.025 0.0 0.0 0.0 130-131 3.2125 0.025 0.0 0.0 0.0 132-133 3.4749999999999996 0.025 0.0 0.0 0.0 134-135 3.8625 0.025 0.0 0.0 0.0 136-137 4.1625 0.025 0.0 0.0 0.0 138-139 4.6 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 150 2.0688036E-4 9.6658325 65-69 >>END_MODULE SRR7169585 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169585_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.78075 33.0 33.0 34.0 32.0 34.0 2 32.87075 34.0 33.0 34.0 32.0 34.0 3 32.90875 34.0 33.0 34.0 32.0 34.0 4 32.86475 34.0 33.0 34.0 32.0 34.0 5 32.919 34.0 33.0 34.0 32.0 34.0 6 36.95575 38.0 38.0 38.0 37.0 38.0 7 37.029 38.0 38.0 38.0 36.0 38.0 8 37.02425 38.0 38.0 38.0 37.0 38.0 9 37.067 38.0 38.0 38.0 37.0 38.0 10-14 36.99655 38.0 38.0 38.0 37.0 38.0 15-19 37.0531 38.0 38.0 38.0 37.0 38.0 20-24 37.0059 38.0 38.0 38.0 37.0 38.0 25-29 36.83485 38.0 38.0 38.0 36.2 38.0 30-34 36.82465 38.0 38.0 38.0 36.0 38.0 35-39 36.82385000000001 38.0 38.0 38.0 36.0 38.0 40-44 36.8308 38.0 38.0 38.0 36.2 38.0 45-49 36.862750000000005 38.0 38.0 38.0 36.0 38.0 50-54 36.78555 38.0 38.0 38.0 36.0 38.0 55-59 36.8024 38.0 38.0 38.0 36.0 38.0 60-64 36.760650000000005 38.0 38.0 38.0 36.0 38.0 65-69 36.6712 38.0 38.0 38.0 36.0 38.0 70-74 36.4832 38.0 38.0 38.0 35.0 38.0 75-79 36.32795 38.0 38.0 38.0 34.4 38.0 80-84 36.282450000000004 38.0 38.0 38.0 34.2 38.0 85-89 36.1736 38.0 38.0 38.0 34.0 38.0 90-94 36.12675 38.0 38.0 38.0 34.0 38.0 95-99 36.01745 38.0 38.0 38.0 33.6 38.0 100-104 35.9003 38.0 38.0 38.0 33.2 38.0 105-109 35.8837 38.0 38.0 38.0 33.0 38.0 110-114 35.67305 38.0 37.2 38.0 32.2 38.0 115-119 35.521699999999996 38.0 37.0 38.0 31.4 38.0 120-124 35.27045 38.0 36.8 38.0 30.6 38.0 125-129 34.876 38.0 36.0 38.0 27.8 38.0 130-134 34.66155 38.0 36.0 38.0 27.4 38.0 135-139 34.3409 38.0 35.2 38.0 25.0 38.0 140-144 33.7547 38.0 33.8 38.0 21.8 38.0 145-149 33.2273 38.0 33.2 38.0 18.2 38.0 150-151 28.63175 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 23.0 3 1.0 4 2.0 5 1.0 6 1.0 7 1.0 8 2.0 9 0.0 10 4.0 11 4.0 12 2.0 13 1.0 14 3.0 15 3.0 16 5.0 17 10.0 18 4.0 19 5.0 20 6.0 21 9.0 22 11.0 23 17.0 24 15.0 25 15.0 26 18.0 27 22.0 28 29.0 29 38.0 30 44.0 31 60.0 32 72.0 33 99.0 34 120.0 35 217.0 36 606.0 37 2530.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.09022556390977 23.734335839598998 14.260651629072681 25.914786967418546 2 27.994987468671678 29.598997493734338 26.36591478696742 16.040100250626566 3 20.350877192982455 30.30075187969925 29.348370927318296 20.0 4 24.091250940085235 33.71772374028579 23.66507896715969 18.52594635246929 5 25.112781954887218 35.388471177944865 21.152882205513784 18.345864661654137 6 21.979949874686717 36.2155388471178 23.408521303258144 18.395989974937343 7 20.336008024072218 23.169508525576727 36.484453360080245 20.01003009027081 8 23.684210526315788 26.81704260651629 25.413533834586467 24.085213032581454 9 22.706766917293233 25.413533834586467 29.624060150375943 22.25563909774436 10-14 24.22145328719723 28.644501278772378 26.011734617120506 21.122310816909884 15-19 23.596068993180907 27.652426795026074 27.015643802647414 21.73586040914561 20-24 24.073423943026228 28.30633431967501 26.65128642359196 20.968955313706804 25-29 23.599056840415393 28.144283349219883 27.42688004816134 20.829779762203383 30-34 23.739780307970108 28.605106084165122 26.709133771379847 20.945979836484927 35-39 23.903123903123902 28.034899463470893 27.006969864112722 21.055006769292483 40-44 24.312800963081862 27.819020866773673 27.27728731942215 20.590890850722314 45-49 24.071009477959983 27.66661651873025 27.01469334536884 21.247680657940926 50-54 24.08744484556759 27.697553148816688 26.85519454472523 21.359807460890494 55-59 24.364438650152938 27.277741563455848 27.7992277992278 20.558591987163418 60-64 23.982150020056157 27.3164861612515 27.747693541917368 20.953670276774968 65-69 24.138449962377727 27.890644594933534 26.997742663656886 20.973162779031853 70-74 23.911516853932586 27.307383627608345 27.79895666131621 20.982142857142858 75-79 23.50905351858354 27.45147213723228 27.978131113005965 21.061343231178213 80-84 24.489591171306746 27.56458490092802 27.409079508402307 20.53674441936293 85-89 23.61647684511565 28.428076865184888 27.901259344739348 20.05418694496011 90-94 24.340455411776507 27.194302337245464 28.11716320593841 20.348079045039622 95-99 24.197431781701447 27.62841091492777 27.66352327447833 20.510634028892454 100-104 24.394767179589998 27.562528194075487 27.45225803217884 20.590446594155683 105-109 23.614312919715346 27.668637867094315 27.593464969429686 21.12358424376065 110-114 24.38070404172099 28.096479791395048 27.45963293551299 20.063183231370978 115-119 24.08224674022066 27.80842527582748 27.37713139418255 20.73219658976931 120-124 24.189826427209795 28.022474164743656 27.11949433129327 20.668205076753285 125-129 24.75789051131517 27.783631893220935 26.880425510562496 20.5780520849014 130-134 24.69897652016857 27.182420228777843 27.679108970499698 20.439494280553884 135-139 24.76792613778915 27.000853028250287 27.86893471824979 20.362286115710774 140-144 24.449571192136016 28.015447113696773 27.353427955263555 20.181553738903656 145-149 25.19929806969165 27.520681875156683 27.099523690147908 20.180496365003762 150-151 25.416510083928344 28.09720656394839 27.358136039083053 19.128147313040213 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 10.0 1 5.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.5 13 1.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 2.5 26 2.5 27 2.0 28 3.0 29 5.0 30 7.5 31 9.0 32 12.0 33 17.5 34 24.5 35 35.5 36 57.5 37 78.5 38 113.0 39 147.0 40 174.0 41 221.5 42 252.0 43 289.0 44 309.0 45 304.0 46 294.0 47 279.5 48 260.0 49 229.0 50 196.0 51 147.5 52 125.5 53 114.5 54 84.0 55 52.5 56 37.0 57 30.5 58 19.5 59 15.0 60 11.5 61 6.5 62 4.0 63 3.0 64 3.0 65 1.5 66 1.0 67 0.5 68 1.5 69 1.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.25 3 0.25 4 0.27499999999999997 5 0.25 6 0.25 7 0.3 8 0.25 9 0.25 10-14 0.295 15-19 0.27999999999999997 20-24 0.305 25-29 0.335 30-34 0.315 35-39 0.28500000000000003 40-44 0.32 45-49 0.295 50-54 0.27999999999999997 55-59 0.28500000000000003 60-64 0.27999999999999997 65-69 0.325 70-74 0.32 75-79 0.315 80-84 0.325 85-89 0.345 90-94 0.31 95-99 0.32 100-104 0.245 105-109 0.22999999999999998 110-114 0.29 115-119 0.3 120-124 0.33 125-129 0.35500000000000004 130-134 0.33999999999999997 135-139 0.35500000000000004 140-144 0.305 145-149 0.27499999999999997 150-151 0.21250000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52092788703983 98.675 2 0.4034291477559254 0.8 3 0.02521432173474534 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.02521432173474534 0.2 9 0.0 0.0 >10 0.02521432173474534 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 10 0.25 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 8 0.2 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.5375 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 0.9 0.0 0.0 0.0 0.0 110-111 1.025 0.0 0.0 0.0 0.0 112-113 1.1 0.0 0.0 0.0 0.0 114-115 1.25 0.0 0.0 0.0 0.0 116-117 1.5375 0.0 0.0 0.0 0.0 118-119 1.8125 0.0 0.0 0.0 0.0 120-121 2.05 0.0 0.0 0.0 0.0 122-123 2.25 0.0 0.0 0.0 0.0 124-125 2.4125 0.0 0.0 0.0 0.0 126-127 2.6625 0.0 0.0 0.0 0.0 128-129 3.0 0.0 0.0 0.0 0.0 130-131 3.2125 0.0 0.0 0.0 0.0 132-133 3.45 0.0 0.0 0.0 0.0 134-135 3.825 0.0 0.0 0.0 0.0 136-137 4.125 0.0 0.0 0.0 0.0 138-139 4.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 75 3.4954483E-6 17.400002 60-64 >>END_MODULE Read 1215663 spots for SRR7169585.sra Written 1215663 spots for SRR7169585.sra Read 1215663 spots for SRR7169585.sra Written 1215663 spots for SRR7169585.sra Read 1215663 spots for SRR7169585.sra Written 1215663 spots for SRR7169585.sra Read 1215663 spots for SRR7169585.sra Written 1215663 spots for SRR7169585.sra Read 1215678 spots for SRR7169585.sra Written 1215678 spots for SRR7169585.sra Read 1215663 spots for SRR7169585.sra Written 1215663 spots for SRR7169585.sra Read 1215663 spots for SRR7169585.sra Written 1215663 spots for SRR7169585.sra Read 1215663 spots for SRR7169585.sra Written 1215663 spots for SRR7169585.sra Read 1215663 spots for SRR7169585.sra Written 1215663 spots for SRR7169585.sra Read 1215663 spots for SRR7169585.sra Written 1215663 spots for SRR7169585.sra Read 1215663 spots for SRR7169585.sra Written 1215663 spots for SRR7169585.sra Read 1215663 spots for SRR7169585.sra Written 1215663 spots for SRR7169585.sra Read 1215663 spots for SRR7169585.sra Written 1215663 spots for SRR7169585.sra Read 1215663 spots for SRR7169585.sra Written 1215663 spots for SRR7169585.sra Read 1215663 spots for SRR7169585.sra Written 1215663 spots for SRR7169585.sra Read 1215663 spots for SRR7169585.sra Written 1215663 spots for SRR7169585.sra Read 1215663 spots for SRR7169585.sra Written 1215663 spots for SRR7169585.sra Read 1215663 spots for SRR7169585.sra Written 1215663 spots for SRR7169585.sra Read 1215663 spots for SRR7169585.sra Written 1215663 spots for SRR7169585.sra Read 1215663 spots for SRR7169585.sra Written 1215663 spots for SRR7169585.sra SRR ids: ['SRR7169585.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_237dbsql SRR7169585.sra spots: 24313275 blocks: [[1, 1215663], [1215664, 2431326], [2431327, 3646989], [3646990, 4862652], [4862653, 6078315], [6078316, 7293978], [7293979, 8509641], [8509642, 9725304], [9725305, 10940967], [10940968, 12156630], [12156631, 13372293], [13372294, 14587956], [14587957, 15803619], [15803620, 17019282], [17019283, 18234945], [18234946, 19450608], [19450609, 20666271], [20666272, 21881934], [21881935, 23097597], [23097598, 24313275]] SRR7169585 file size 8217270 SRR7169585 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169585 SRR7169585_1.fastq SRR7169585_2.fastq Input file: SRR7169585_1.fastq Paired file: SRR7169585_2.fastq trimmed: SRR7169585-trimmed-pair1.fastq, SRR7169585-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 07:39:55 2025 >> started Tue Feb 11 07:40:20 2025 >> done (25.436s) 24313275 read pairs processed; of these: 41734 ( 0.17%) short read pairs filtered out after trimming by size control 111393 ( 0.46%) empty read pairs filtered out after trimming by size control 24160148 (99.37%) read pairs available; of these: 11861228 (49.09%) trimmed read pairs available after processing 12298920 (50.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 9 0.00% 20 6 0.00% 21 12 0.00% 22 10 0.00% 23 13 0.00% 24 16 0.00% 25 17 0.00% 26 16 0.00% 27 14 0.00% 28 18 0.00% 29 34 0.00% 30 26 0.00% 31 20 0.00% 32 17 0.00% 33 26 0.00% 34 16 0.00% 35 21 0.00% 36 33 0.00% 37 31 0.00% 38 32 0.00% 39 28 0.00% 40 37 0.00% 41 42 0.00% 42 64 0.00% 43 53 0.00% 44 68 0.00% 45 80 0.00% 46 104 0.00% 47 107 0.00% 48 145 0.00% 49 145 0.00% 50 150 0.00% 51 179 0.00% 52 232 0.00% 53 210 0.00% 54 210 0.00% 55 264 0.00% 56 276 0.00% 57 285 0.00% 58 315 0.00% 59 285 0.00% 60 291 0.00% 61 326 0.00% 62 405 0.00% 63 455 0.00% 64 568 0.00% 65 817 0.00% 66 1252 0.01% 67 2562 0.01% 68 8270 0.03% 69 24628 0.10% 70 12867 0.05% 71 3203 0.01% 72 2152 0.01% 73 1734 0.01% 74 1858 0.01% 75 1819 0.01% 76 1921 0.01% 77 2108 0.01% 78 2234 0.01% 79 2478 0.01% 80 2676 0.01% 81 2987 0.01% 82 3359 0.01% 83 3876 0.02% 84 5559 0.02% 85 6892 0.03% 86 7452 0.03% 87 7850 0.03% 88 8573 0.04% 89 8965 0.04% 90 9289 0.04% 91 9526 0.04% 92 10140 0.04% 93 11025 0.05% 94 11832 0.05% 95 12862 0.05% 96 13627 0.06% 97 14554 0.06% 98 15338 0.06% 99 15738 0.07% 100 17250 0.07% 101 17779 0.07% 102 18991 0.08% 103 20252 0.08% 104 21531 0.09% 105 22795 0.09% 106 24370 0.10% 107 25553 0.11% 108 26749 0.11% 109 28082 0.12% 110 29174 0.12% 111 30707 0.13% 112 32210 0.13% 113 34777 0.14% 114 35763 0.15% 115 37332 0.15% 116 39514 0.16% 117 41361 0.17% 118 42294 0.18% 119 44214 0.18% 120 46515 0.19% 121 47962 0.20% 122 49924 0.21% 123 52910 0.22% 124 56104 0.23% 125 58430 0.24% 126 61049 0.25% 127 64120 0.27% 128 66974 0.28% 129 69956 0.29% 130 74248 0.31% 131 76967 0.32% 132 81577 0.34% 133 86361 0.36% 134 91570 0.38% 135 98452 0.41% 136 103961 0.43% 137 112327 0.46% 138 119874 0.50% 139 130004 0.54% 140 139362 0.58% 141 151983 0.63% 142 167651 0.69% 143 188591 0.78% 144 215916 0.89% 145 254212 1.05% 146 310928 1.29% 147 418573 1.73% 148 633344 2.62% 149 1292680 5.35% 150 5690264 23.55% 151 12298920 50.91% 24160148 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=42 prefix-density=0.23 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTG criterion=fanout-score sequence-density=0.11 sequence-density-rank=17 fanout-score=111.39 fanout-score-rank=1 prefix-density=0.72 prefix-fanout=16.4 sequence=CCACCACCATGGGCTCCCCAGCCACC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=5.83 fanout-score-rank=22 prefix-density=0.42 prefix-fanout=3.5 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.13 sequence-density-rank=13 fanout-score=44.33 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=11.3 sequence=TGTTGGTGGTGGGACTGGAGCTGTCGTTAACACCATCGTCTCTAAATACCCTTCAATTAAGGGCATTAACTTTGATCTGCCCCACGTCATTGAGGATGCCCCATCTTATCCCGGTGTGGAGCATGTTGGTGGGGACATGTTTGTTAG SRR7169585 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 07:41:01 Started mapping on | Feb 11 07:41:02 Finished on | Feb 11 07:43:39 Mapping speed, Million of reads per hour | 553.99 Number of input reads | 24160148 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 22783014 Uniquely mapped reads % | 94.30% Average mapped length | 294.35 Number of splices: Total | 20247901 Number of splices: Annotated (sjdb) | 19894943 Number of splices: GT/AG | 19955274 Number of splices: GC/AG | 232557 Number of splices: AT/AC | 16230 Number of splices: Non-canonical | 43840 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 430648 % of reads mapped to multiple loci | 1.78% Number of reads mapped to too many loci | 26344 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.76% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 977886 977886 977886 N_multimapping 430648 430648 430648 N_noFeature 455486 22516707 560838 N_ambiguous 254326 1783 92171 UnstrandedReadsAssigned:22073202 PositiveStrandReadsAssigned:264524 NegativeStrandReadsAssigned:22130005 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169585 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169585-trimmed-pair1.fastq SRR7169585-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,160,148 reads, 22,023,080 reads pseudoaligned [quant] estimated average fragment length: 241.637 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,106 rounds 52401 SRR7169585.ke.tsv 34699 SRR7169585.se.tsv 87100 total ==> SRR7169585.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.36 368 8.02067 Potri.005G024800.1.v4.1 1035 794.363 49 2.38955 Potri.004G059700.1.v4.1 961 720.388 14 0.752836 Potri.007G009000.2.v4.1 1416 1175.36 0 0 Potri.003G141000.2.v4.1 2943 2702.36 371.031 5.3187 Potri.016G087400.1.v4.1 270 75.7869 2813.54 1438.13 Potri.015G069301.1.v4.1 564 326.456 0 0 Potri.010G195200.1.v4.1 1773 1532.36 95 2.4016 Potri.012G127500.1.v4.1 977 736.383 10115 532.11 ==> SRR7169585.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2187 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 516 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 39 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169585 completed mapping pipeline successfully