Starting /dee2/code/volunteer_pipeline.sh SRR7169586 current disk space = 3055659323392 free memory = 1498249976 SRR7169586 SRAfilesize 6e66492d36cafe8f26888aa310a4373d SRR7169586.sra SRR7169586.sra file validated SRR7169586 is paired end SRR7169586 is conventional basespace SRR7169586 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169586_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.651 34.0 33.0 34.0 32.0 34.0 2 33.2915 34.0 33.0 34.0 32.0 34.0 3 33.3275 34.0 33.0 34.0 33.0 34.0 4 33.323 34.0 33.0 34.0 33.0 34.0 5 33.332 34.0 33.0 34.0 33.0 34.0 6 36.96575 38.0 37.0 38.0 36.0 38.0 7 37.26925 38.0 38.0 38.0 37.0 38.0 8 37.4295 38.0 38.0 38.0 37.0 38.0 9 37.49 38.0 38.0 38.0 37.0 38.0 10-14 37.4288 38.0 38.0 38.0 37.0 38.0 15-19 37.415800000000004 38.0 38.0 38.0 37.2 38.0 20-24 37.4034 38.0 38.0 38.0 37.0 38.0 25-29 37.3772 38.0 38.0 38.0 37.0 38.0 30-34 37.35695 38.0 38.0 38.0 37.0 38.0 35-39 37.2487 38.0 38.0 38.0 36.8 38.0 40-44 37.111200000000004 38.0 38.0 38.0 36.0 38.0 45-49 37.02545 38.0 38.0 38.0 36.0 38.0 50-54 36.90575 38.0 38.0 38.0 35.6 38.0 55-59 36.949650000000005 38.0 38.0 38.0 35.8 38.0 60-64 36.851350000000004 38.0 38.0 38.0 35.4 38.0 65-69 36.7193 38.0 38.0 38.0 35.0 38.0 70-74 36.73115 38.0 38.0 38.0 34.8 38.0 75-79 36.6567 38.0 38.0 38.0 34.4 38.0 80-84 36.544399999999996 38.0 38.0 38.0 34.2 38.0 85-89 36.459700000000005 38.0 38.0 38.0 34.0 38.0 90-94 36.31295 38.0 38.0 38.0 33.8 38.0 95-99 36.1916 38.0 37.8 38.0 33.6 38.0 100-104 35.951699999999995 38.0 37.0 38.0 33.0 38.0 105-109 35.74125 38.0 37.0 38.0 31.4 38.0 110-114 35.5619 38.0 36.8 38.0 30.6 38.0 115-119 35.26835 38.0 36.2 38.0 28.8 38.0 120-124 35.052800000000005 38.0 36.0 38.0 28.4 38.0 125-129 34.8595 38.0 35.6 38.0 27.8 38.0 130-134 34.575 38.0 35.0 38.0 26.6 38.0 135-139 34.333999999999996 38.0 35.0 38.0 24.2 38.0 140-144 33.8351 38.0 34.8 38.0 22.6 38.0 145-149 33.137 38.0 34.0 38.0 17.0 38.0 150-151 29.36275 36.0 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 1.0 8 1.0 9 2.0 10 0.0 11 0.0 12 1.0 13 0.0 14 1.0 15 3.0 16 5.0 17 1.0 18 4.0 19 8.0 20 5.0 21 11.0 22 17.0 23 13.0 24 17.0 25 16.0 26 19.0 27 20.0 28 30.0 29 48.0 30 38.0 31 60.0 32 97.0 33 109.0 34 140.0 35 290.0 36 724.0 37 2318.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.5308831036243 11.587544665645739 9.826442062276671 38.055130168453296 2 23.175 13.350000000000001 33.4 30.075000000000003 3 19.8 16.325 26.525 37.35 4 23.075000000000003 26.75 23.974999999999998 26.200000000000003 5 22.95 30.825000000000003 23.325000000000003 22.900000000000002 6 20.0 34.175 24.65 21.175 7 14.2 27.025 40.975 17.8 8 18.6 25.0 31.275 25.124999999999996 9 16.325 24.85 35.25 23.575 10-14 19.325 29.854999999999997 27.255000000000003 23.565 15-19 20.215 27.935 28.194999999999997 23.655 20-24 19.875 28.465 27.35 24.310000000000002 25-29 20.125 28.549999999999997 27.775 23.549999999999997 30-34 20.02 28.985 27.315 23.68 35-39 20.01 28.77 27.29 23.93 40-44 20.335 29.154999999999998 27.3 23.21 45-49 20.705000000000002 27.74 27.685 23.87 50-54 20.025000000000002 28.09 27.785 24.099999999999998 55-59 20.075000000000003 28.744999999999997 27.815 23.365 60-64 20.1 28.775000000000002 27.310000000000002 23.815 65-69 20.325 28.194999999999997 27.18 24.3 70-74 19.985 28.355000000000004 27.88 23.78 75-79 20.715 28.470000000000002 27.145000000000003 23.669999999999998 80-84 20.4 28.57 27.24 23.79 85-89 20.18 29.01 26.939999999999998 23.87 90-94 20.82 28.71 26.334999999999997 24.135 95-99 19.97 29.09 27.284999999999997 23.655 100-104 19.88093451398269 28.770823953174247 27.390064535494524 23.95817699734854 105-109 20.369999999999997 28.265 27.43 23.935000000000002 110-114 20.292248411149476 28.39913926837812 27.493369363959363 23.815242956513035 115-119 20.8372930525684 27.989796428750065 27.759715900565197 23.41319461811634 120-124 20.861473810595825 28.255540547301017 27.219970984041225 23.663014658061936 125-129 20.705000000000002 27.98 27.744999999999997 23.57 130-134 20.488195278111245 28.761504601840738 27.200880352140857 23.54941976790716 135-139 21.07 28.095 27.18 23.655 140-144 20.979999999999997 29.085 27.0 22.935 145-149 20.830000000000002 28.18 27.48 23.51 150-151 20.5 28.349999999999998 27.0 24.15 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 2.0 26 1.5 27 3.5 28 7.0 29 8.0 30 10.5 31 20.5 32 31.5 33 33.0 34 40.0 35 57.5 36 83.5 37 109.5 38 126.5 39 148.5 40 177.5 41 216.5 42 249.5 43 259.5 44 263.0 45 277.0 46 285.0 47 274.0 48 261.5 49 234.0 50 192.5 51 158.5 52 117.0 53 83.0 54 65.0 55 54.5 56 45.5 57 31.5 58 21.5 59 12.0 60 8.0 61 6.0 62 4.5 63 5.0 64 5.0 65 3.5 66 1.0 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.0500000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.055 105-109 0.0 110-114 0.08499999999999999 115-119 0.034999999999999996 120-124 0.055 125-129 0.0 130-134 0.04 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42167462911743 98.85000000000001 2 0.5783253708825749 1.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.07500000000000001 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.42500000000000004 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.5874999999999999 0.0 0.0 0.0 0.0 108-109 0.7 0.0 0.0 0.0 0.0 110-111 0.775 0.0 0.0 0.0 0.0 112-113 0.8875 0.0 0.0 0.0 0.0 114-115 1.0 0.0 0.0 0.0 0.0 116-117 1.125 0.0 0.0 0.0 0.0 118-119 1.2125 0.0 0.0 0.0 0.0 120-121 1.3125 0.0 0.0 0.0 0.0 122-123 1.425 0.0 0.0 0.0 0.0 124-125 1.5375 0.0 0.0 0.0 0.0 126-127 1.625 0.0 0.0 0.0 0.0 128-129 1.8125 0.0 0.0 0.0 0.0 130-131 2.0125 0.0 0.0 0.0 0.0 132-133 2.2 0.0 0.0 0.0 0.0 134-135 2.4625 0.0 0.0 0.0 0.0 136-137 2.825 0.0 0.0 0.0 0.0 138-139 3.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCACAT 10 0.006630061 146.43037 1 TCACATC 10 0.0068874825 144.6 2 CGTCTTG 10 0.0068874825 144.6 4 >>END_MODULE SRR7169586 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169586_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.395 33.0 33.0 34.0 32.0 34.0 2 32.70075 33.0 33.0 34.0 32.0 34.0 3 32.76825 33.0 33.0 34.0 32.0 34.0 4 32.73525 34.0 33.0 34.0 32.0 34.0 5 32.66575 34.0 33.0 34.0 32.0 34.0 6 36.799 38.0 38.0 38.0 36.0 38.0 7 36.83625 38.0 38.0 38.0 36.0 38.0 8 36.844 38.0 38.0 38.0 36.0 38.0 9 36.74675 38.0 38.0 38.0 36.0 38.0 10-14 36.7048 38.0 38.0 38.0 35.8 38.0 15-19 36.7333 38.0 38.0 38.0 35.8 38.0 20-24 36.78835 38.0 38.0 38.0 36.0 38.0 25-29 36.8078 38.0 38.0 38.0 36.0 38.0 30-34 36.80595 38.0 38.0 38.0 36.0 38.0 35-39 36.660000000000004 38.0 38.0 38.0 35.2 38.0 40-44 36.6796 38.0 38.0 38.0 35.6 38.0 45-49 36.711400000000005 38.0 38.0 38.0 35.8 38.0 50-54 36.47685 38.0 38.0 38.0 35.0 38.0 55-59 36.007400000000004 38.0 38.0 38.0 34.0 38.0 60-64 35.8272 38.0 38.0 38.0 33.6 38.0 65-69 35.698 38.0 38.0 38.0 33.2 38.0 70-74 35.575100000000006 38.0 38.0 38.0 32.2 38.0 75-79 35.37455 38.0 38.0 38.0 30.6 38.0 80-84 35.54125 38.0 38.0 38.0 31.4 38.0 85-89 35.6344 38.0 38.0 38.0 32.2 38.0 90-94 35.5732 38.0 38.0 38.0 31.0 38.0 95-99 35.500350000000005 38.0 37.8 38.0 31.0 38.0 100-104 35.3823 38.0 37.2 38.0 30.2 38.0 105-109 35.3019 38.0 37.0 38.0 29.6 38.0 110-114 35.14895 38.0 37.0 38.0 29.2 38.0 115-119 34.8548 38.0 37.0 38.0 27.2 38.0 120-124 34.5894 38.0 36.0 38.0 25.6 38.0 125-129 34.52235 38.0 36.2 38.0 26.0 38.0 130-134 34.024 38.0 35.8 38.0 21.8 38.0 135-139 33.501850000000005 38.0 35.0 38.0 15.0 38.0 140-144 33.13925 38.0 35.0 38.0 14.0 38.0 145-149 32.171899999999994 38.0 33.8 38.0 6.4 38.0 150-151 28.331000000000003 36.0 18.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 6.0 4 1.0 5 1.0 6 0.0 7 1.0 8 2.0 9 5.0 10 3.0 11 5.0 12 8.0 13 23.0 14 17.0 15 4.0 16 6.0 17 7.0 18 5.0 19 15.0 20 8.0 21 17.0 22 25.0 23 28.0 24 24.0 25 19.0 26 41.0 27 31.0 28 46.0 29 47.0 30 63.0 31 70.0 32 64.0 33 95.0 34 134.0 35 214.0 36 475.0 37 2483.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.172118772018116 23.930548565676897 13.663814796175139 28.233517866129844 2 29.625 25.85 28.9 15.625 3 20.200000000000003 27.650000000000002 31.900000000000002 20.25 4 23.375 32.800000000000004 24.65 19.175 5 25.1 34.699999999999996 22.375 17.825 6 20.549999999999997 37.35 23.1 19.0 7 21.224999999999998 20.9 38.425 19.45 8 20.549999999999997 26.724999999999998 27.625 25.1 9 22.3 23.849999999999998 30.925000000000004 22.925 10-14 22.8978978978979 28.713713713713712 26.886886886886884 21.5015015015015 15-19 23.180498548403243 27.815597156872563 27.355090599659626 21.648813695064568 20-24 22.645 27.985 27.894999999999996 21.475 25-29 23.035 28.055000000000003 27.655 21.255 30-34 22.865 29.09 26.69 21.355 35-39 22.975 28.435 27.79 20.8 40-44 22.915 27.93 27.93 21.224999999999998 45-49 22.915 27.735 27.955000000000002 21.395 50-54 23.20872274143302 28.198171038086624 27.766053662948448 20.827052557531907 55-59 23.48880881084099 27.229355935644318 28.320560320763338 20.96127493275136 60-64 23.23706500663333 27.666088376364932 27.997754872946217 21.099091744055514 65-69 23.78951683148025 27.33001998257929 28.00635343546652 20.874109750473945 70-74 23.61687945444291 27.693175408911447 28.16489770804492 20.52504742860073 75-79 23.761307565789476 28.017064144736842 27.852590460526315 20.369037828947366 80-84 23.17166658148924 27.88368170899985 27.766136863085805 21.178514846425102 85-89 24.031913812379308 27.807704034962903 27.970322187214148 20.190059965443645 90-94 23.36140422077922 27.394480519480517 28.510551948051948 20.73356331168831 95-99 24.042499367568933 27.54363774348596 28.110295977738424 20.303566911206676 100-104 23.679684338324563 27.154997976527724 27.913800080938888 21.25151760420882 105-109 24.020623767881514 27.650002527422537 28.05944497801142 20.269928726684526 110-114 23.31985851440121 28.064679130874183 27.837291561394643 20.778170793329963 115-119 24.254051597919926 27.778058262230527 27.227747765941334 20.740142373908213 120-124 23.474486448291525 28.11285519608338 27.53242820370464 20.880230151920458 125-129 23.823514512942605 27.56192695405501 27.506205359404284 21.108353173598097 130-134 23.681667937960842 27.66844647851513 27.815916603101957 20.833968980422068 135-139 23.7698635736549 27.617393081600326 27.69914669664299 20.913596648101784 140-144 24.233584113823632 28.10788679052152 27.048467168227646 20.610061927427196 145-149 24.296517310561246 27.820361129687743 27.352230052986265 20.53089150676475 150-151 23.84396796693361 27.75768535262206 27.654352880392665 20.743993800051665 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.5 19 2.5 20 4.5 21 8.0 22 7.0 23 5.0 24 5.5 25 8.0 26 9.5 27 6.0 28 5.0 29 10.0 30 13.5 31 15.5 32 24.0 33 32.5 34 40.0 35 59.0 36 85.5 37 111.5 38 134.5 39 163.0 40 193.5 41 212.5 42 264.0 43 292.5 44 288.0 45 288.0 46 267.0 47 255.0 48 228.5 49 197.0 50 169.5 51 136.0 52 121.5 53 93.0 54 54.5 55 45.5 56 37.0 57 27.5 58 24.5 59 15.5 60 10.5 61 8.0 62 4.5 63 2.5 64 1.5 65 3.0 66 2.5 67 1.5 68 1.5 69 0.5 70 0.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.65 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.1 15-19 0.11 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.49 55-59 1.485 60-64 2.01 65-69 2.415 70-74 2.485 75-79 2.7199999999999998 80-84 2.165 85-89 1.6099999999999999 90-94 1.44 95-99 1.175 100-104 1.16 105-109 1.085 110-114 1.05 115-119 0.9650000000000001 120-124 0.935 125-129 1.295 130-134 1.675 135-139 2.145 140-144 2.305 145-149 2.8049999999999997 150-151 3.225 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67377666248431 99.3 2 0.301129234629862 0.6 3 0.0 0.0 4 0.02509410288582183 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.025 0.0 3 0.0 0.0 0.0 0.025 0.0 4 0.0 0.0 0.0 0.025 0.0 5 0.0 0.0 0.0 0.025 0.0 6 0.0 0.0 0.0 0.025 0.0 7 0.0 0.0 0.0 0.025 0.0 8 0.0 0.0 0.0 0.025 0.0 9 0.0 0.0 0.0 0.025 0.0 10-11 0.0 0.0 0.0 0.025 0.0 12-13 0.0 0.0 0.0 0.025 0.0 14-15 0.0 0.0 0.0 0.025 0.0 16-17 0.0 0.0 0.0 0.025 0.0 18-19 0.0 0.0 0.0 0.025 0.0 20-21 0.0 0.0 0.0 0.025 0.0 22-23 0.0 0.0 0.0 0.025 0.0 24-25 0.0 0.0 0.0 0.025 0.0 26-27 0.0 0.0 0.0 0.025 0.0 28-29 0.0 0.0 0.0 0.025 0.0 30-31 0.0 0.0 0.0 0.025 0.0 32-33 0.0 0.0 0.0 0.025 0.0 34-35 0.0 0.0 0.0 0.025 0.0 36-37 0.0 0.0 0.0 0.025 0.0 38-39 0.0 0.0 0.0 0.025 0.0 40-41 0.0 0.0 0.0 0.025 0.0 42-43 0.0 0.0 0.0 0.025 0.0 44-45 0.0 0.0 0.0 0.025 0.0 46-47 0.0 0.0 0.0 0.025 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.025 0.0 0.0 0.025 0.0 64-65 0.025 0.0 0.0 0.025 0.0 66-67 0.025 0.0 0.0 0.025 0.0 68-69 0.025 0.0 0.0 0.025 0.0 70-71 0.025 0.0 0.0 0.025 0.0 72-73 0.025 0.0 0.0 0.025 0.0 74-75 0.025 0.0 0.0 0.025 0.0 76-77 0.025 0.0 0.0 0.025 0.0 78-79 0.05 0.0 0.0 0.025 0.0 80-81 0.05 0.0 0.0 0.025 0.0 82-83 0.05 0.0 0.0 0.025 0.0 84-85 0.07500000000000001 0.0 0.0 0.025 0.0 86-87 0.1125 0.0 0.0 0.025 0.0 88-89 0.15 0.0 0.0 0.025 0.0 90-91 0.175 0.0 0.0 0.025 0.0 92-93 0.2 0.0 0.0 0.025 0.0 94-95 0.2 0.0 0.0 0.025 0.0 96-97 0.2875 0.0 0.0 0.025 0.0 98-99 0.35 0.0 0.0 0.025 0.0 100-101 0.4 0.0 0.0 0.025 0.0 102-103 0.425 0.0 0.0 0.025 0.0 104-105 0.4625 0.0 0.0 0.025 0.0 106-107 0.5375000000000001 0.0 0.0 0.025 0.0 108-109 0.625 0.0 0.0 0.025 0.0 110-111 0.7 0.0 0.0 0.025 0.0 112-113 0.8125 0.0 0.0 0.025 0.0 114-115 0.925 0.0 0.0 0.025 0.0 116-117 1.0499999999999998 0.0 0.0 0.025 0.0 118-119 1.1375 0.0 0.0 0.025 0.0 120-121 1.2125 0.0 0.0 0.025 0.0 122-123 1.325 0.0 0.0 0.025 0.0 124-125 1.4375 0.0 0.0 0.025 0.0 126-127 1.55 0.0 0.0 0.025 0.0 128-129 1.7625 0.0 0.0 0.025 0.0 130-131 1.9625 0.0 0.0 0.025 0.0 132-133 2.125 0.0 0.0 0.025 0.0 134-135 2.3625 0.0 0.0 0.025 0.0 136-137 2.7375 0.0 0.0 0.025 0.0 138-139 3.025 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 873871 spots for SRR7169586.sra Written 873871 spots for SRR7169586.sra Read 873871 spots for SRR7169586.sra Written 873871 spots for SRR7169586.sra Read 873871 spots for SRR7169586.sra Written 873871 spots for SRR7169586.sra Read 873871 spots for SRR7169586.sra Written 873871 spots for SRR7169586.sra Read 873871 spots for SRR7169586.sra Written 873871 spots for SRR7169586.sra Read 873871 spots for SRR7169586.sra Written 873871 spots for SRR7169586.sra Read 873871 spots for SRR7169586.sra Written 873871 spots for SRR7169586.sra Read 873871 spots for SRR7169586.sra Written 873871 spots for SRR7169586.sra Read 873871 spots for SRR7169586.sra Written 873871 spots for SRR7169586.sra Read 873871 spots for SRR7169586.sra Written 873871 spots for SRR7169586.sra Read 873871 spots for SRR7169586.sra Written 873871 spots for SRR7169586.sra Read 873871 spots for SRR7169586.sra Written 873871 spots for SRR7169586.sra Read 873871 spots for SRR7169586.sra Written 873871 spots for SRR7169586.sra Read 873871 spots for SRR7169586.sra Written 873871 spots for SRR7169586.sra Read 873871 spots for SRR7169586.sra Written 873871 spots for SRR7169586.sra Read 873871 spots for SRR7169586.sra Written 873871 spots for SRR7169586.sra Read 873872 spots for SRR7169586.sra Written 873872 spots for SRR7169586.sra Read 873871 spots for SRR7169586.sra Written 873871 spots for SRR7169586.sra Read 873871 spots for SRR7169586.sra Written 873871 spots for SRR7169586.sra Read 873871 spots for SRR7169586.sra Written 873871 spots for SRR7169586.sra SRR ids: ['SRR7169586.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_49767pvd SRR7169586.sra spots: 17477421 blocks: [[1, 873871], [873872, 1747742], [1747743, 2621613], [2621614, 3495484], [3495485, 4369355], [4369356, 5243226], [5243227, 6117097], [6117098, 6990968], [6990969, 7864839], [7864840, 8738710], [8738711, 9612581], [9612582, 10486452], [10486453, 11360323], [11360324, 12234194], [12234195, 13108065], [13108066, 13981936], [13981937, 14855807], [14855808, 15729678], [15729679, 16603549], [16603550, 17477421]] SRR7169586 file size 5900824 SRR7169586 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169586 SRR7169586_1.fastq SRR7169586_2.fastq Input file: SRR7169586_1.fastq Paired file: SRR7169586_2.fastq trimmed: SRR7169586-trimmed-pair1.fastq, SRR7169586-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 07:38:10 2025 >> started Tue Feb 11 07:38:29 2025 >> done (18.753s) 17477421 read pairs processed; of these: 14310 ( 0.08%) short read pairs filtered out after trimming by size control 12331 ( 0.07%) empty read pairs filtered out after trimming by size control 17450780 (99.85%) read pairs available; of these: 9131375 (52.33%) trimmed read pairs available after processing 8319405 (47.67%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 6 0.00% 20 2 0.00% 21 5 0.00% 22 5 0.00% 23 4 0.00% 24 8 0.00% 25 10 0.00% 26 6 0.00% 27 7 0.00% 28 9 0.00% 29 9 0.00% 30 16 0.00% 31 9 0.00% 32 12 0.00% 33 13 0.00% 34 7 0.00% 35 6 0.00% 36 14 0.00% 37 21 0.00% 38 21 0.00% 39 23 0.00% 40 21 0.00% 41 21 0.00% 42 25 0.00% 43 40 0.00% 44 29 0.00% 45 36 0.00% 46 38 0.00% 47 40 0.00% 48 53 0.00% 49 60 0.00% 50 57 0.00% 51 68 0.00% 52 89 0.00% 53 92 0.00% 54 116 0.00% 55 113 0.00% 56 112 0.00% 57 132 0.00% 58 138 0.00% 59 156 0.00% 60 182 0.00% 61 221 0.00% 62 293 0.00% 63 262 0.00% 64 313 0.00% 65 362 0.00% 66 391 0.00% 67 462 0.00% 68 579 0.00% 69 680 0.00% 70 829 0.00% 71 776 0.00% 72 866 0.00% 73 1016 0.01% 74 1233 0.01% 75 1656 0.01% 76 1425 0.01% 77 1089 0.01% 78 1579 0.01% 79 2817 0.02% 80 4168 0.02% 81 1752 0.01% 82 1987 0.01% 83 2240 0.01% 84 3106 0.02% 85 3705 0.02% 86 4389 0.03% 87 4529 0.03% 88 4328 0.02% 89 4515 0.03% 90 5066 0.03% 91 5154 0.03% 92 5798 0.03% 93 6277 0.04% 94 6757 0.04% 95 7338 0.04% 96 7987 0.05% 97 8565 0.05% 98 9849 0.06% 99 12342 0.07% 100 15715 0.09% 101 14305 0.08% 102 10822 0.06% 103 10872 0.06% 104 11528 0.07% 105 12313 0.07% 106 12964 0.07% 107 13696 0.08% 108 14547 0.08% 109 15137 0.09% 110 15865 0.09% 111 16923 0.10% 112 18034 0.10% 113 18898 0.11% 114 19918 0.11% 115 21279 0.12% 116 22440 0.13% 117 24002 0.14% 118 24791 0.14% 119 25570 0.15% 120 27407 0.16% 121 29178 0.17% 122 30645 0.18% 123 32411 0.19% 124 34545 0.20% 125 36886 0.21% 126 38986 0.22% 127 41168 0.24% 128 43395 0.25% 129 45689 0.26% 130 48593 0.28% 131 51000 0.29% 132 54545 0.31% 133 59204 0.34% 134 63042 0.36% 135 68149 0.39% 136 74061 0.42% 137 80158 0.46% 138 87320 0.50% 139 96927 0.56% 140 106494 0.61% 141 116257 0.67% 142 130579 0.75% 143 147999 0.85% 144 174162 1.00% 145 209815 1.20% 146 266692 1.53% 147 363128 2.08% 148 557017 3.19% 149 1121244 6.43% 150 4426524 25.37% 151 8319405 47.67% 17450780 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.61 fanout-score-rank=31 prefix-density=0.24 prefix-fanout=2.4 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.15 sequence-density-rank=6 fanout-score=72.50 fanout-score-rank=1 prefix-density=0.70 prefix-fanout=15.7 sequence=CCACCACCAACA criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.51 fanout-score-rank=34 prefix-density=0.34 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.13 sequence-density-rank=12 fanout-score=52.51 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=14.2 sequence=TGTTGGTGGTGG SRR7169586 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 07:39:11 Started mapping on | Feb 11 07:39:12 Finished on | Feb 11 07:40:47 Mapping speed, Million of reads per hour | 661.29 Number of input reads | 17450780 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 16696669 Uniquely mapped reads % | 95.68% Average mapped length | 294.72 Number of splices: Total | 16071524 Number of splices: Annotated (sjdb) | 15813414 Number of splices: GT/AG | 15845029 Number of splices: GC/AG | 179268 Number of splices: AT/AC | 12601 Number of splices: Non-canonical | 34626 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 297706 % of reads mapped to multiple loci | 1.71% Number of reads mapped to too many loci | 18504 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.47% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 473001 473001 473001 N_multimapping 297706 297706 297706 N_noFeature 354327 16515642 434635 N_ambiguous 171054 741 69792 UnstrandedReadsAssigned:16171288 PositiveStrandReadsAssigned:180286 NegativeStrandReadsAssigned:16192242 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169586 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169586-trimmed-pair1.fastq SRR7169586-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,450,780 reads, 16,107,959 reads pseudoaligned [quant] estimated average fragment length: 264.024 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,157 rounds 52401 SRR7169586.ke.tsv 34699 SRR7169586.se.tsv 87100 total ==> SRR7169586.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1754.98 321 11.1941 Potri.005G024800.1.v4.1 1035 771.976 21 1.66484 Potri.004G059700.1.v4.1 961 698.005 6 0.526077 Potri.007G009000.2.v4.1 1416 1152.98 0 0 Potri.003G141000.2.v4.1 2943 2679.98 233 5.32086 Potri.016G087400.1.v4.1 270 70.5161 1154 1001.55 Potri.015G069301.1.v4.1 564 308.529 0 0 Potri.010G195200.1.v4.1 1773 1509.98 18 0.729557 Potri.012G127500.1.v4.1 977 713.988 5710 489.443 ==> SRR7169586.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1074 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 211 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7169586 completed mapping pipeline successfully