Starting /dee2/code/volunteer_pipeline.sh SRR7169587 current disk space = 3055763492864 free memory = 1580174760 SRR7169587 SRAfilesize 58a438ab0ea80fa9afdfa844b59d79db SRR7169587.sra SRR7169587.sra file validated SRR7169587 is paired end SRR7169587 is conventional basespace SRR7169587 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169587_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.67175 34.0 33.0 34.0 32.0 34.0 2 33.2915 34.0 33.0 34.0 33.0 34.0 3 33.3835 34.0 33.0 34.0 33.0 34.0 4 33.35975 34.0 33.0 34.0 33.0 34.0 5 33.36625 34.0 33.0 34.0 33.0 34.0 6 36.9615 38.0 37.0 38.0 35.0 38.0 7 37.26525 38.0 38.0 38.0 37.0 38.0 8 37.39475 38.0 38.0 38.0 37.0 38.0 9 37.49125 38.0 38.0 38.0 37.0 38.0 10-14 37.36665 38.0 38.0 38.0 37.0 38.0 15-19 37.33630000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.340999999999994 38.0 38.0 38.0 37.0 38.0 25-29 37.2731 38.0 38.0 38.0 37.0 38.0 30-34 37.18455 38.0 38.0 38.0 36.4 38.0 35-39 37.13535 38.0 38.0 38.0 36.4 38.0 40-44 37.029300000000006 38.0 38.0 38.0 36.0 38.0 45-49 36.84504999999999 38.0 38.0 38.0 35.0 38.0 50-54 36.7082 38.0 38.0 38.0 34.6 38.0 55-59 36.6955 38.0 38.0 38.0 34.6 38.0 60-64 36.617149999999995 38.0 38.0 38.0 34.0 38.0 65-69 36.53835 38.0 38.0 38.0 34.0 38.0 70-74 36.4979 38.0 38.0 38.0 34.0 38.0 75-79 36.3017 38.0 37.8 38.0 33.6 38.0 80-84 36.2534 38.0 37.0 38.0 33.6 38.0 85-89 36.092749999999995 38.0 37.0 38.0 33.0 38.0 90-94 35.9196 38.0 37.0 38.0 32.2 38.0 95-99 35.68415 38.0 37.0 38.0 31.2 38.0 100-104 35.4052 38.0 36.4 38.0 29.8 38.0 105-109 35.21875 38.0 36.0 38.0 29.0 38.0 110-114 34.98545 38.0 36.0 38.0 28.2 38.0 115-119 34.701299999999996 38.0 35.6 38.0 26.8 38.0 120-124 34.417100000000005 38.0 35.0 38.0 25.6 38.0 125-129 33.95285 38.0 34.8 38.0 22.6 38.0 130-134 33.688199999999995 38.0 34.0 38.0 22.2 38.0 135-139 33.511700000000005 38.0 34.0 38.0 19.8 38.0 140-144 32.8648 38.0 33.6 38.0 14.4 38.0 145-149 32.09015 38.0 33.0 38.0 11.2 38.0 150-151 28.172375000000002 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 3.0 14 6.0 15 4.0 16 6.0 17 9.0 18 9.0 19 8.0 20 12.0 21 11.0 22 14.0 23 14.0 24 21.0 25 23.0 26 31.0 27 33.0 28 53.0 29 40.0 30 49.0 31 62.0 32 75.0 33 131.0 34 193.0 35 365.0 36 841.0 37 1986.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.104134762634 12.200102092904542 9.188361408882082 34.50740173557938 2 24.625 13.0 31.65 30.725 3 21.275 17.75 26.474999999999998 34.5 4 23.775 25.775 23.724999999999998 26.724999999999998 5 23.549999999999997 31.15 23.775 21.525 6 19.425 33.925 25.575 21.075 7 14.575 26.900000000000002 41.5 17.025000000000002 8 19.025 25.924999999999997 30.325000000000003 24.725 9 17.7 25.525 33.324999999999996 23.45 10-14 20.125 30.125 27.155 22.595000000000002 15-19 19.955000000000002 28.33 27.950000000000003 23.765 20-24 20.03 28.255000000000003 27.605 24.11 25-29 19.905 29.49 27.245 23.36 30-34 20.075000000000003 28.99 27.18 23.755000000000003 35-39 19.805 28.78 27.62 23.794999999999998 40-44 20.355 28.854999999999997 27.18 23.61 45-49 20.015 28.42 27.935 23.630000000000003 50-54 20.7 28.610000000000003 26.75 23.94 55-59 20.07 29.060000000000002 26.99 23.880000000000003 60-64 20.080000000000002 28.715000000000003 26.979999999999997 24.224999999999998 65-69 20.345 28.125 27.295 24.235 70-74 20.225 28.935 26.810000000000002 24.03 75-79 20.62 28.13 27.24 24.01 80-84 20.115 28.115000000000002 27.63 24.14 85-89 20.48 28.939999999999998 27.38 23.200000000000003 90-94 20.474999999999998 28.225 27.41 23.89 95-99 20.65 28.749999999999996 27.279999999999998 23.32 100-104 20.66033016508254 28.959479739869938 27.20360180090045 23.176588294147074 105-109 20.565 28.139999999999997 27.284999999999997 24.01 110-114 20.81728605011754 28.534987245535937 27.104486570299606 23.54324013404692 115-119 20.73603680184009 28.466423321166058 27.67138356917846 23.12615630781539 120-124 21.10844337735094 28.526410564225692 26.90576230492197 23.4593837535014 125-129 20.905 27.505000000000003 27.435 24.154999999999998 130-134 20.888133219982997 28.194229134370158 27.549132369855478 23.368505275791367 135-139 20.82 27.944999999999997 27.395000000000003 23.84 140-144 21.205 28.465 26.6 23.73 145-149 21.32 28.63 26.86 23.189999999999998 150-151 20.8125 28.549999999999997 26.3 24.337500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 2.0 22 3.0 23 2.0 24 2.0 25 3.0 26 3.5 27 6.0 28 9.5 29 11.0 30 15.0 31 20.5 32 23.5 33 28.5 34 41.5 35 53.5 36 70.5 37 100.0 38 130.0 39 160.0 40 183.0 41 208.5 42 238.5 43 242.0 44 257.5 45 293.0 46 301.5 47 275.0 48 246.5 49 229.5 50 191.5 51 140.5 52 112.0 53 106.5 54 91.0 55 54.5 56 31.5 57 24.0 58 18.5 59 20.0 60 16.0 61 8.5 62 4.5 63 6.5 64 4.5 65 1.0 66 2.0 67 2.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.0500000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.05 105-109 0.0 110-114 0.034999999999999996 115-119 0.005 120-124 0.04 125-129 0.0 130-134 0.015 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42152917505031 98.825 2 0.5533199195171026 1.0999999999999999 3 0.025150905432595575 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.42500000000000004 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.5875 0.0 0.0 0.0 0.0 102-103 0.7125 0.0 0.0 0.0 0.0 104-105 0.825 0.0 0.0 0.0 0.0 106-107 0.875 0.0 0.0 0.0 0.0 108-109 1.0 0.0 0.0 0.0 0.0 110-111 1.1125 0.0 0.0 0.0 0.0 112-113 1.2875 0.0 0.0 0.0 0.0 114-115 1.375 0.0 0.0 0.0 0.0 116-117 1.45 0.0 0.0 0.0 0.0 118-119 1.6124999999999998 0.0 0.0 0.0 0.0 120-121 1.9 0.0 0.0 0.0 0.0 122-123 2.1500000000000004 0.0 0.0 0.0 0.0 124-125 2.425 0.0 0.0 0.0 0.0 126-127 2.5250000000000004 0.0 0.0 0.0 0.0 128-129 2.8375 0.0 0.0 0.0 0.0 130-131 3.1125 0.0 0.0 0.0 0.0 132-133 3.3375 0.0 0.0 0.0 0.0 134-135 3.7375 0.0 0.0 0.0 0.0 136-137 4.025 0.0 0.0 0.0 0.0 138-139 4.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCCCCC 40 0.0077818553 18.073437 25-29 >>END_MODULE SRR7169587 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169587_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5555 33.0 33.0 34.0 32.0 34.0 2 32.8005 33.0 33.0 34.0 32.0 34.0 3 32.896 34.0 33.0 34.0 32.0 34.0 4 32.799 34.0 33.0 34.0 32.0 34.0 5 32.80425 34.0 33.0 34.0 32.0 34.0 6 36.9495 38.0 38.0 38.0 36.0 38.0 7 36.98675 38.0 38.0 38.0 36.0 38.0 8 36.97375 38.0 38.0 38.0 36.0 38.0 9 36.98075 38.0 38.0 38.0 36.0 38.0 10-14 36.90005 38.0 38.0 38.0 36.0 38.0 15-19 36.928850000000004 38.0 38.0 38.0 36.0 38.0 20-24 36.972750000000005 38.0 38.0 38.0 36.2 38.0 25-29 36.9323 38.0 38.0 38.0 36.0 38.0 30-34 36.927800000000005 38.0 38.0 38.0 36.2 38.0 35-39 36.86505 38.0 38.0 38.0 36.0 38.0 40-44 36.853750000000005 38.0 38.0 38.0 36.0 38.0 45-49 36.81255 38.0 38.0 38.0 36.0 38.0 50-54 36.60385 38.0 38.0 38.0 35.4 38.0 55-59 36.218900000000005 38.0 38.0 38.0 34.4 38.0 60-64 36.05785 38.0 38.0 38.0 34.0 38.0 65-69 35.8981 38.0 38.0 38.0 34.0 38.0 70-74 35.784949999999995 38.0 38.0 38.0 33.6 38.0 75-79 35.63635 38.0 38.0 38.0 33.0 38.0 80-84 35.70125 38.0 38.0 38.0 33.2 38.0 85-89 35.790099999999995 38.0 38.0 38.0 33.0 38.0 90-94 35.7225 38.0 38.0 38.0 33.2 38.0 95-99 35.59105 38.0 38.0 38.0 31.4 38.0 100-104 35.51520000000001 38.0 37.8 38.0 31.2 38.0 105-109 35.39995 38.0 38.0 38.0 30.6 38.0 110-114 35.19835 38.0 37.2 38.0 29.4 38.0 115-119 34.858799999999995 38.0 37.0 38.0 27.2 38.0 120-124 34.722449999999995 38.0 36.4 38.0 27.0 38.0 125-129 34.5653 38.0 36.2 38.0 25.8 38.0 130-134 34.181799999999996 38.0 36.0 38.0 23.4 38.0 135-139 33.73045 38.0 35.0 38.0 19.0 38.0 140-144 33.093599999999995 38.0 35.0 38.0 14.0 38.0 145-149 32.2043 38.0 34.2 38.0 6.4 38.0 150-151 28.508875 36.0 18.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 5.0 4 1.0 5 0.0 6 3.0 7 4.0 8 3.0 9 0.0 10 1.0 11 2.0 12 8.0 13 22.0 14 25.0 15 4.0 16 4.0 17 7.0 18 7.0 19 10.0 20 12.0 21 16.0 22 14.0 23 23.0 24 22.0 25 21.0 26 23.0 27 46.0 28 36.0 29 58.0 30 52.0 31 51.0 32 83.0 33 97.0 34 108.0 35 220.0 36 448.0 37 2560.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.99598191863385 23.78201908588649 13.209442491210446 25.012556504269213 2 30.099999999999998 25.825 26.724999999999998 17.349999999999998 3 19.925 28.575 31.225 20.275000000000002 4 22.725 34.375 24.525 18.375 5 24.525 33.800000000000004 22.525000000000002 19.15 6 21.45 36.775000000000006 23.45 18.325 7 20.4 21.625 37.875 20.1 8 22.125 27.250000000000004 25.025 25.6 9 21.9 25.424999999999997 29.025000000000002 23.65 10-14 23.44109698728856 28.59573616254629 26.67400660594535 21.289160244219797 15-19 22.77207905929447 28.15111333500125 27.32049036777583 21.756317237928446 20-24 22.564999999999998 28.32 27.68 21.435000000000002 25-29 23.355 28.294999999999998 27.625 20.724999999999998 30-34 22.965 28.005000000000003 28.050000000000004 20.979999999999997 35-39 23.22 28.694999999999997 27.265 20.82 40-44 23.515 28.335 27.3 20.849999999999998 45-49 23.505000000000003 28.18 27.450000000000003 20.865000000000002 50-54 23.733239592226184 28.047004469442072 27.188268970019585 21.03148696831216 55-59 23.45578920699265 28.381048897897138 27.39295667595642 20.770205219153787 60-64 23.188922262383546 28.035432469582037 27.3379829964873 21.43766227154712 65-69 23.544148473848356 28.120047037169588 28.20185081036863 20.133953678613427 70-74 23.824387248631222 27.319244742362997 27.687663101877913 21.16870490712787 75-79 23.903463824554212 27.239188358270138 27.74646443943431 21.11088337774134 80-84 24.15884991843393 27.334828711256115 27.508156606851546 20.9981647634584 85-89 23.48765275594544 28.076669540084175 27.787637543735105 20.648040160235283 90-94 23.772609819121445 27.587779297765618 28.266707199675732 20.372903683437197 95-99 23.895551844542283 27.64030160416983 27.64030160416983 20.82384494711806 100-104 24.133919991908158 26.89526121478784 28.144439387042937 20.826379406261065 105-109 23.89250896600495 27.584987624387537 27.56983381320402 20.952669596403496 110-114 23.666279715338415 27.426437187705044 28.006864180083785 20.90041891687276 115-119 24.576356667339116 27.582206980028246 27.577163607020378 20.264272745612267 120-124 24.316829686397096 27.31672884945044 28.17384289603711 20.192598568115358 125-129 24.372215471850954 27.789590927501013 27.506075334143375 20.332118266504658 130-134 24.606638919906608 28.154502081007003 27.09877169830474 20.140087300781648 135-139 24.25462514652668 28.061770551959636 26.81820498445543 20.86539931705825 140-144 24.541507024265645 27.969348659003828 27.315453384418902 20.173690932311622 145-149 24.484668239154956 27.658701671623426 27.509998974464157 20.34663111475746 150-151 25.067524115755628 28.231511254019292 26.983922829581992 19.717041800643088 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.5 17 2.5 18 3.0 19 2.5 20 5.0 21 8.5 22 7.5 23 9.5 24 10.0 25 4.0 26 2.5 27 4.0 28 4.0 29 5.5 30 8.5 31 13.0 32 20.0 33 27.5 34 36.0 35 54.5 36 74.5 37 94.0 38 126.0 39 163.0 40 193.5 41 223.5 42 249.0 43 266.0 44 283.5 45 302.0 46 297.5 47 270.5 48 242.0 49 205.5 50 167.0 51 138.5 52 106.5 53 91.0 54 82.0 55 59.5 56 36.5 57 26.0 58 22.0 59 12.5 60 12.0 61 9.0 62 7.0 63 4.0 64 1.0 65 2.0 66 1.5 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.44999999999999996 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.09 15-19 0.075 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.43499999999999994 55-59 1.325 60-64 1.7850000000000001 65-69 2.205 70-74 2.2849999999999997 75-79 2.42 80-84 1.92 85-89 1.395 90-94 1.315 95-99 1.195 100-104 1.135 105-109 1.015 110-114 0.935 115-119 0.86 120-124 0.83 125-129 1.24 130-134 1.49 135-139 1.8950000000000002 140-144 2.125 145-149 2.4899999999999998 150-151 2.8125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44668008048289 98.85000000000001 2 0.5030181086519114 1.0 3 0.05030181086519115 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1625 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.45 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.6125 0.0 0.0 0.0 0.0 102-103 0.7625 0.0 0.0 0.0 0.0 104-105 0.875 0.0 0.0 0.0 0.0 106-107 0.925 0.0 0.0 0.0 0.0 108-109 1.0499999999999998 0.0 0.0 0.0 0.0 110-111 1.1625 0.0 0.0 0.0 0.0 112-113 1.3375 0.0 0.0 0.0 0.0 114-115 1.4500000000000002 0.0 0.0 0.0 0.0 116-117 1.525 0.0 0.0 0.0 0.0 118-119 1.6875 0.0 0.0 0.0 0.0 120-121 1.9749999999999999 0.0 0.0 0.0 0.0 122-123 2.2249999999999996 0.0 0.0 0.0 0.0 124-125 2.5250000000000004 0.0 0.0 0.0 0.0 126-127 2.6500000000000004 0.0 0.0 0.0 0.0 128-129 2.9625 0.0 0.0 0.0 0.0 130-131 3.2249999999999996 0.0 0.0 0.0 0.0 132-133 3.45 0.0 0.0 0.0 0.0 134-135 3.8625 0.0 0.0 0.0 0.0 136-137 4.125 0.0 0.0 0.0 0.0 138-139 4.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCTTAA 10 0.007235208 142.2375 1 >>END_MODULE Read 777858 spots for SRR7169587.sra Written 777858 spots for SRR7169587.sra Read 777858 spots for SRR7169587.sra Written 777858 spots for SRR7169587.sra Read 777858 spots for SRR7169587.sra Written 777858 spots for SRR7169587.sra Read 777858 spots for SRR7169587.sra Written 777858 spots for SRR7169587.sra Read 777858 spots for SRR7169587.sra Written 777858 spots for SRR7169587.sra Read 777858 spots for SRR7169587.sra Written 777858 spots for SRR7169587.sra Read 777858 spots for SRR7169587.sra Written 777858 spots for SRR7169587.sra Read 777858 spots for SRR7169587.sra Written 777858 spots for SRR7169587.sra Read 777858 spots for SRR7169587.sra Written 777858 spots for SRR7169587.sra Read 777858 spots for SRR7169587.sra Written 777858 spots for SRR7169587.sra Read 777858 spots for SRR7169587.sra Written 777858 spots for SRR7169587.sra Read 777858 spots for SRR7169587.sra Written 777858 spots for SRR7169587.sra Read 777858 spots for SRR7169587.sra Written 777858 spots for SRR7169587.sra Read 777858 spots for SRR7169587.sra Written 777858 spots for SRR7169587.sra Read 777858 spots for SRR7169587.sra Written 777858 spots for SRR7169587.sra Read 777873 spots for SRR7169587.sra Written 777873 spots for SRR7169587.sra Read 777858 spots for SRR7169587.sra Written 777858 spots for SRR7169587.sra Read 777858 spots for SRR7169587.sra Written 777858 spots for SRR7169587.sra Read 777858 spots for SRR7169587.sra Written 777858 spots for SRR7169587.sra Read 777858 spots for SRR7169587.sra Written 777858 spots for SRR7169587.sra SRR ids: ['SRR7169587.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_aur14956 SRR7169587.sra spots: 15557175 blocks: [[1, 777858], [777859, 1555716], [1555717, 2333574], [2333575, 3111432], [3111433, 3889290], [3889291, 4667148], [4667149, 5445006], [5445007, 6222864], [6222865, 7000722], [7000723, 7778580], [7778581, 8556438], [8556439, 9334296], [9334297, 10112154], [10112155, 10890012], [10890013, 11667870], [11667871, 12445728], [12445729, 13223586], [13223587, 14001444], [14001445, 14779302], [14779303, 15557175]] SRR7169587 file size 5250115 SRR7169587 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169587 SRR7169587_1.fastq SRR7169587_2.fastq Input file: SRR7169587_1.fastq Paired file: SRR7169587_2.fastq trimmed: SRR7169587-trimmed-pair1.fastq, SRR7169587-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 08:13:53 2025 >> started Tue Feb 11 08:14:10 2025 >> done (17.491s) 15557175 read pairs processed; of these: 19234 ( 0.12%) short read pairs filtered out after trimming by size control 15373 ( 0.10%) empty read pairs filtered out after trimming by size control 15522568 (99.78%) read pairs available; of these: 8916527 (57.44%) trimmed read pairs available after processing 6606041 (42.56%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 7 0.00% 20 4 0.00% 21 5 0.00% 22 6 0.00% 23 3 0.00% 24 8 0.00% 25 7 0.00% 26 15 0.00% 27 6 0.00% 28 8 0.00% 29 9 0.00% 30 19 0.00% 31 12 0.00% 32 13 0.00% 33 6 0.00% 34 16 0.00% 35 18 0.00% 36 34 0.00% 37 21 0.00% 38 22 0.00% 39 23 0.00% 40 19 0.00% 41 28 0.00% 42 39 0.00% 43 33 0.00% 44 39 0.00% 45 38 0.00% 46 44 0.00% 47 56 0.00% 48 67 0.00% 49 69 0.00% 50 90 0.00% 51 109 0.00% 52 121 0.00% 53 105 0.00% 54 132 0.00% 55 112 0.00% 56 168 0.00% 57 158 0.00% 58 184 0.00% 59 219 0.00% 60 235 0.00% 61 268 0.00% 62 286 0.00% 63 358 0.00% 64 421 0.00% 65 398 0.00% 66 509 0.00% 67 533 0.00% 68 642 0.00% 69 853 0.01% 70 1129 0.01% 71 1273 0.01% 72 1342 0.01% 73 1295 0.01% 74 1430 0.01% 75 1914 0.01% 76 1706 0.01% 77 1480 0.01% 78 1829 0.01% 79 2800 0.02% 80 4230 0.03% 81 2359 0.02% 82 2702 0.02% 83 3070 0.02% 84 4035 0.03% 85 4908 0.03% 86 5276 0.03% 87 5588 0.04% 88 5613 0.04% 89 5981 0.04% 90 6526 0.04% 91 6928 0.04% 92 7549 0.05% 93 8152 0.05% 94 8830 0.06% 95 9431 0.06% 96 10076 0.06% 97 10994 0.07% 98 12280 0.08% 99 14894 0.10% 100 18307 0.12% 101 15266 0.10% 102 13995 0.09% 103 14010 0.09% 104 15350 0.10% 105 16009 0.10% 106 17033 0.11% 107 17611 0.11% 108 18341 0.12% 109 19385 0.12% 110 20242 0.13% 111 21243 0.14% 112 22208 0.14% 113 23621 0.15% 114 25047 0.16% 115 26595 0.17% 116 27559 0.18% 117 29109 0.19% 118 30063 0.19% 119 30942 0.20% 120 32615 0.21% 121 34150 0.22% 122 36608 0.24% 123 38430 0.25% 124 40217 0.26% 125 42506 0.27% 126 44295 0.29% 127 47413 0.31% 128 48871 0.31% 129 51006 0.33% 130 53584 0.35% 131 56592 0.36% 132 59798 0.39% 133 65397 0.42% 134 69909 0.45% 135 75617 0.49% 136 80915 0.52% 137 87287 0.56% 138 94967 0.61% 139 105222 0.68% 140 114040 0.73% 141 124549 0.80% 142 138525 0.89% 143 158233 1.02% 144 186979 1.20% 145 224919 1.45% 146 285718 1.84% 147 385718 2.48% 148 586138 3.78% 149 1113570 7.17% 150 3848583 24.79% 151 6606041 42.56% 15522568 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=39 prefix-density=0.28 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=95.97 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=9.9 sequence=ATATTCATCATAACTCAATTACATTATTCTCACCCAGAACATCTCTTCCAGCAATAGATACAAACCATGGCAATTAACTAGAGCAGAACATCATTTCACAAGGTTTATAAGGAAAGAGACCTCCTTGACTTGGACAAACACTCGTCTATAAGAAACACCCAAATTTCCAACTATTCGGCTGTTTATTTCATTAATAACTGGAGAGCAGGAGATGCCAGTGCCTCAGACAAACTGATCAAGGTACTCTTC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=37 prefix-density=0.28 prefix-fanout=2.2 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.06 sequence-density-rank=36 fanout-score=38.17 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=9.8 sequence=TTCTTTTCTTTTCACCTTCTTCAACCTTTTGTTTCCTTAAAGAATTCAATCTTGATCAAGATGGGTTCGACAGGTGAAACTCAGATGACTCCAACTCAGGTATCAGATGAAGAGGCACACCTCTTTGCCATGCAACTAGCCAGTGCTTCAGTTCTACCAATGATCCTCAAAACAGCCATTGAACTCGACCTTCTTGAAATCATGGCTAAAGCTGGCCCTGGTGCTTTCTTGTCCACATCT SRR7169587 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 08:14:55 Started mapping on | Feb 11 08:14:55 Finished on | Feb 11 08:16:22 Mapping speed, Million of reads per hour | 642.31 Number of input reads | 15522568 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 14727225 Uniquely mapped reads % | 94.88% Average mapped length | 292.91 Number of splices: Total | 13206030 Number of splices: Annotated (sjdb) | 12975278 Number of splices: GT/AG | 13032270 Number of splices: GC/AG | 133941 Number of splices: AT/AC | 10475 Number of splices: Non-canonical | 29344 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.02% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 242230 % of reads mapped to multiple loci | 1.56% Number of reads mapped to too many loci | 13864 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.43% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 573032 573032 573032 N_multimapping 242230 242230 242230 N_noFeature 329110 14520366 402085 N_ambiguous 199497 1041 64826 UnstrandedReadsAssigned:14198618 PositiveStrandReadsAssigned:205818 NegativeStrandReadsAssigned:14260314 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169587 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169587-trimmed-pair1.fastq SRR7169587-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,522,568 reads, 14,159,188 reads pseudoaligned [quant] estimated average fragment length: 250.326 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,046 rounds 52401 SRR7169587.ke.tsv 34699 SRR7169587.se.tsv 87100 total ==> SRR7169587.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1768.67 269 11.1242 Potri.005G024800.1.v4.1 1035 785.674 12 1.11713 Potri.004G059700.1.v4.1 961 711.699 1 0.102771 Potri.007G009000.2.v4.1 1416 1166.67 0 0 Potri.003G141000.2.v4.1 2943 2693.67 258.037 7.00651 Potri.016G087400.1.v4.1 270 76.9535 947 900.093 Potri.015G069301.1.v4.1 564 319.828 0 0 Potri.010G195200.1.v4.1 1773 1523.67 7 0.336025 Potri.012G127500.1.v4.1 977 727.687 1745 175.395 ==> SRR7169587.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1853 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 240 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 22 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 11 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169587 completed mapping pipeline successfully