Starting /dee2/code/volunteer_pipeline.sh SRR7169588 current disk space = 3055730393088 free memory = 1492255504 SRR7169588 SRAfilesize 6084183ff9f62c541deb491edb581e43 SRR7169588.sra SRR7169588.sra file validated SRR7169588 is paired end SRR7169588 is conventional basespace SRR7169588 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169588_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.862 34.0 33.0 34.0 33.0 34.0 2 33.39125 34.0 34.0 34.0 33.0 34.0 3 33.378 34.0 34.0 34.0 33.0 34.0 4 33.48175 34.0 34.0 34.0 33.0 34.0 5 33.50975 34.0 34.0 34.0 33.0 34.0 6 37.0895 38.0 37.0 38.0 36.0 38.0 7 37.4085 38.0 38.0 38.0 37.0 38.0 8 37.49425 38.0 38.0 38.0 37.0 38.0 9 37.5285 38.0 38.0 38.0 38.0 38.0 10-14 37.494249999999994 38.0 38.0 38.0 37.6 38.0 15-19 37.534200000000006 38.0 38.0 38.0 37.8 38.0 20-24 37.55264999999999 38.0 38.0 38.0 37.4 38.0 25-29 37.508449999999996 38.0 38.0 38.0 37.6 38.0 30-34 37.47580000000001 38.0 38.0 38.0 37.6 38.0 35-39 37.36325 38.0 38.0 38.0 37.0 38.0 40-44 37.32915 38.0 38.0 38.0 37.0 38.0 45-49 37.31830000000001 38.0 38.0 38.0 37.0 38.0 50-54 37.2187 38.0 38.0 38.0 36.4 38.0 55-59 37.173950000000005 38.0 38.0 38.0 36.0 38.0 60-64 37.1111 38.0 38.0 38.0 36.0 38.0 65-69 37.05705 38.0 38.0 38.0 36.0 38.0 70-74 37.055 38.0 38.0 38.0 36.0 38.0 75-79 37.0497 38.0 38.0 38.0 36.0 38.0 80-84 36.888850000000005 38.0 38.0 38.0 35.2 38.0 85-89 36.79755 38.0 38.0 38.0 35.0 38.0 90-94 36.79774999999999 38.0 38.0 38.0 35.0 38.0 95-99 36.65825 38.0 38.0 38.0 34.4 38.0 100-104 36.5972 38.0 38.0 38.0 34.0 38.0 105-109 36.4151 38.0 38.0 38.0 34.0 38.0 110-114 36.3418 38.0 37.8 38.0 34.0 38.0 115-119 36.2315 38.0 37.0 38.0 33.6 38.0 120-124 35.96319999999999 38.0 36.8 38.0 32.4 38.0 125-129 35.8957 38.0 36.8 38.0 32.6 38.0 130-134 35.72865 38.0 36.4 38.0 31.8 38.0 135-139 35.3534 38.0 36.0 38.0 29.6 38.0 140-144 35.04475 38.0 35.6 38.0 29.8 38.0 145-149 34.4092 38.0 35.0 38.0 26.8 38.0 150-151 31.562375000000003 36.5 31.5 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 2.0 11 1.0 12 0.0 13 0.0 14 1.0 15 2.0 16 0.0 17 0.0 18 1.0 19 1.0 20 1.0 21 6.0 22 4.0 23 6.0 24 5.0 25 10.0 26 16.0 27 24.0 28 18.0 29 21.0 30 37.0 31 41.0 32 72.0 33 79.0 34 158.0 35 221.0 36 612.0 37 2661.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.12101910828025 11.566878980891719 9.757961783439491 37.554140127388536 2 23.1 15.049999999999999 32.300000000000004 29.549999999999997 3 20.325 19.400000000000002 26.150000000000002 34.125 4 22.75 27.375 22.75 27.125 5 21.925 32.025 24.625 21.425 6 20.65 33.900000000000006 25.1 20.349999999999998 7 14.625 27.175 39.65 18.55 8 17.275 27.725 31.275 23.724999999999998 9 18.25 23.875 34.175 23.7 10-14 19.905 29.39 27.495000000000005 23.21 15-19 19.86 28.615000000000002 27.62 23.905 20-24 20.369999999999997 28.875 27.185 23.57 25-29 19.515 29.744999999999997 27.455000000000002 23.285 30-34 19.805 29.195 27.33 23.669999999999998 35-39 19.66 29.134999999999998 27.22 23.985 40-44 20.19 29.325000000000003 26.985 23.5 45-49 19.845 28.87 27.36 23.925 50-54 19.915 28.27 27.875 23.94 55-59 20.385 27.99 27.97 23.655 60-64 20.23 28.57 27.33 23.87 65-69 20.5 27.944999999999997 27.284999999999997 24.27 70-74 20.715 28.970000000000002 27.395000000000003 22.919999999999998 75-79 20.105 28.565 27.905 23.425 80-84 20.285 28.610000000000003 27.415 23.69 85-89 20.549999999999997 28.34 27.134999999999998 23.974999999999998 90-94 20.285 28.1 27.455000000000002 24.16 95-99 20.075000000000003 28.725 27.224999999999998 23.974999999999998 100-104 20.495 28.810000000000002 26.93 23.765 105-109 20.305 28.32 27.07 24.305 110-114 20.485 28.515 27.169999999999998 23.830000000000002 115-119 20.669999999999998 29.07 26.46 23.799999999999997 120-124 20.845 29.005 26.685 23.465 125-129 21.005 28.055000000000003 26.715 24.224999999999998 130-134 20.419999999999998 27.91 27.089999999999996 24.58 135-139 20.585 28.060000000000002 27.405 23.95 140-144 21.48 28.57 26.085 23.865 145-149 20.94 28.33 26.534999999999997 24.195 150-151 21.0375 28.787499999999998 25.95 24.224999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 2.0 21 1.0 22 1.5 23 1.5 24 0.5 25 1.5 26 5.0 27 6.5 28 9.0 29 11.5 30 16.5 31 21.5 32 24.5 33 38.5 34 52.0 35 63.5 36 90.0 37 111.0 38 115.5 39 133.0 40 169.0 41 201.5 42 237.5 43 279.5 44 290.0 45 283.5 46 286.5 47 280.5 48 245.5 49 206.5 50 181.0 51 147.5 52 121.5 53 97.0 54 65.0 55 45.0 56 31.5 57 31.5 58 29.5 59 15.0 60 10.0 61 10.0 62 6.5 63 4.0 64 3.5 65 2.5 66 1.5 67 0.5 68 1.5 69 2.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.875 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.36250000000000004 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.675 0.0 0.0 0.0 0.0 94-95 0.8125 0.0 0.0 0.0 0.0 96-97 0.9 0.0 0.0 0.0 0.0 98-99 1.0 0.0 0.0 0.0 0.0 100-101 1.225 0.0 0.0 0.0 0.0 102-103 1.375 0.0 0.0 0.0 0.0 104-105 1.6375 0.0 0.0 0.0 0.0 106-107 1.85 0.0 0.0 0.0 0.0 108-109 2.0999999999999996 0.0 0.0 0.0 0.0 110-111 2.45 0.0 0.0 0.0 0.0 112-113 2.7750000000000004 0.0 0.0 0.0 0.0 114-115 3.0125 0.0 0.0 0.0 0.0 116-117 3.2375 0.0 0.0 0.0 0.0 118-119 3.5375 0.0 0.0 0.0 0.0 120-121 3.8375 0.0 0.0 0.0 0.0 122-123 4.2 0.0 0.0 0.0 0.0 124-125 4.5 0.0 0.0 0.0 0.0 126-127 4.8375 0.0 0.0 0.0 0.0 128-129 5.175000000000001 0.0 0.0 0.0 0.0 130-131 5.5 0.0 0.0 0.0 0.0 132-133 6.074999999999999 0.0 0.0 0.0 0.0 134-135 6.3125 0.0 0.0 0.0 0.0 136-137 6.85 0.0 0.0 0.0 0.0 138-139 7.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169588 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169588_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.891 33.0 33.0 34.0 32.0 34.0 2 32.997 34.0 33.0 34.0 32.0 34.0 3 33.05975 34.0 33.0 34.0 33.0 34.0 4 32.9885 34.0 33.0 34.0 33.0 34.0 5 33.001 34.0 33.0 34.0 33.0 34.0 6 37.05875 38.0 38.0 38.0 37.0 38.0 7 37.13125 38.0 38.0 38.0 37.0 38.0 8 37.119 38.0 38.0 38.0 37.0 38.0 9 37.159 38.0 38.0 38.0 37.0 38.0 10-14 37.13975000000001 38.0 38.0 38.0 37.0 38.0 15-19 37.07025 38.0 38.0 38.0 37.0 38.0 20-24 37.02275 38.0 38.0 38.0 37.0 38.0 25-29 37.0308 38.0 38.0 38.0 37.0 38.0 30-34 36.992200000000004 38.0 38.0 38.0 37.0 38.0 35-39 36.9499 38.0 38.0 38.0 37.0 38.0 40-44 36.96985000000001 38.0 38.0 38.0 37.0 38.0 45-49 36.9936 38.0 38.0 38.0 37.0 38.0 50-54 36.93964999999999 38.0 38.0 38.0 36.4 38.0 55-59 36.41365 38.0 37.8 38.0 33.8 38.0 60-64 36.81305 38.0 38.0 38.0 36.0 38.0 65-69 36.7996 38.0 38.0 38.0 36.0 38.0 70-74 36.729850000000006 38.0 38.0 38.0 36.0 38.0 75-79 36.65845 38.0 38.0 38.0 36.0 38.0 80-84 36.5503 38.0 38.0 38.0 35.0 38.0 85-89 36.578950000000006 38.0 38.0 38.0 35.0 38.0 90-94 36.4456 38.0 38.0 38.0 34.8 38.0 95-99 36.4409 38.0 38.0 38.0 35.0 38.0 100-104 36.2963 38.0 38.0 38.0 34.0 38.0 105-109 36.1836 38.0 38.0 38.0 34.0 38.0 110-114 36.044200000000004 38.0 38.0 38.0 34.0 38.0 115-119 35.9174 38.0 38.0 38.0 33.4 38.0 120-124 35.73025 38.0 37.6 38.0 33.0 38.0 125-129 35.366699999999994 38.0 36.8 38.0 31.0 38.0 130-134 35.074850000000005 38.0 36.0 38.0 29.4 38.0 135-139 34.86935 38.0 36.0 38.0 28.4 38.0 140-144 34.402499999999996 38.0 35.6 38.0 25.2 38.0 145-149 33.88505 38.0 35.0 38.0 23.2 38.0 150-151 30.370874999999998 36.5 29.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 3.0 4 1.0 5 1.0 6 3.0 7 2.0 8 4.0 9 2.0 10 3.0 11 3.0 12 1.0 13 1.0 14 0.0 15 2.0 16 3.0 17 4.0 18 6.0 19 6.0 20 7.0 21 7.0 22 9.0 23 14.0 24 7.0 25 7.0 26 11.0 27 17.0 28 31.0 29 32.0 30 38.0 31 42.0 32 77.0 33 75.0 34 126.0 35 199.0 36 501.0 37 2738.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.0648635111445 21.487603305785125 14.575507137490609 26.872026045579766 2 27.751316119328152 25.946352469290552 29.681624467285033 16.620706944096263 3 20.155427425419905 29.88217598395588 30.08272750062672 19.879669089997492 4 24.993732765104035 33.642516921534224 23.0383554775633 18.325394835798445 5 24.51742291301078 35.44748057157182 21.83504637753823 18.200050137879167 6 20.26045579764588 37.29025795141497 23.491109441522664 18.95817680941648 7 20.435762584522916 21.96343601302279 38.39218632607062 19.208615076383673 8 23.785678517776667 25.162744116174263 26.69003505257887 24.361542313470206 9 21.162033558727774 25.569747057350362 29.927372902579513 23.340846481342346 10-14 23.766591535186578 28.78537440520912 26.190833959429 21.257200100175307 15-19 23.478435104944147 27.751339978961077 27.771377047537943 20.99884786855683 20-24 23.669972948602343 28.068329826670674 27.291854523594832 20.96984270113215 25-29 23.641100145283303 28.410400280547066 26.92750864185161 21.02099093231802 30-34 23.416833667334668 27.75551102204409 27.660320641282567 21.16733466933868 35-39 23.34669338677355 28.20140280561122 27.51503006012024 20.936873747494992 40-44 23.623703852126436 28.066923809046735 27.500876621750237 20.808495717076593 45-49 23.65758365057103 27.840112201963535 27.71989581246243 20.782408335003005 50-54 23.583913457204385 28.201532528672306 27.53042520158261 20.684128812540692 55-59 23.33466893719323 27.757187218271064 27.88740859461084 21.020735249924872 60-64 23.279575277972555 28.067715115696686 27.576880697185214 21.075828909145546 65-69 23.990784333366726 27.697085044575783 27.812280877491734 20.49984974456576 70-74 24.273692646764175 27.349228611500703 27.69985974754558 20.67721899418954 75-79 24.12583909427913 27.061416691714257 28.19857729686404 20.61416691714257 80-84 23.886578828715997 27.989579680376735 27.724061920745452 20.399779570161815 85-89 24.22481590943245 27.375644943144817 27.535941491759758 20.86359765566298 90-94 23.56978258691514 27.537320909728486 28.098386935176833 20.794509568179542 95-99 23.98838141025641 27.088341346153843 28.52063301282051 20.402644230769234 100-104 24.078525641025642 28.400440705128204 27.088341346153843 20.432692307692307 105-109 24.01862607650711 28.414780692970158 27.057881033446822 20.50871219707591 110-114 24.12601422418111 28.14785134729039 27.311429430031055 20.414704998497445 115-119 24.019435956519562 27.701247307518912 27.84150678755698 20.43780994840455 120-124 24.332448274134563 27.5687590802064 27.533690696858876 20.56510194880016 125-129 24.50155295060615 27.066426209798617 27.938082356477306 20.493938483117923 130-134 24.31741896698562 28.410400280547066 27.21807524673113 20.054105505736185 135-139 24.61800510996443 27.598817694504284 27.34832924202194 20.434847953509344 140-144 25.145261470647164 27.42436385493889 27.183931075936684 20.24644359847726 145-149 25.664780409634936 27.933296609745106 26.78651910461215 19.61540387600781 150-151 25.431573680260193 27.845884413309985 26.870152614460846 19.85238929196898 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 6.0 1 3.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 1.0 16 0.5 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 1.5 24 1.5 25 0.5 26 2.0 27 4.0 28 6.0 29 6.0 30 7.0 31 14.5 32 17.0 33 24.5 34 43.5 35 58.0 36 70.0 37 93.0 38 116.5 39 136.5 40 168.5 41 219.5 42 279.5 43 307.5 44 295.5 45 297.5 46 294.0 47 265.0 48 234.0 49 204.0 50 165.5 51 130.5 52 122.5 53 101.5 54 77.5 55 57.5 56 39.0 57 33.0 58 26.5 59 22.5 60 16.0 61 6.5 62 4.5 63 5.0 64 3.5 65 3.5 66 2.5 67 1.0 68 1.5 69 1.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.27499999999999997 3 0.27499999999999997 4 0.27499999999999997 5 0.27499999999999997 6 0.17500000000000002 7 0.17500000000000002 8 0.15 9 0.17500000000000002 10-14 0.17500000000000002 15-19 0.185 20-24 0.19 25-29 0.19499999999999998 30-34 0.2 35-39 0.2 40-44 0.185 45-49 0.18 50-54 0.165 55-59 0.16999999999999998 60-64 0.16999999999999998 65-69 0.16999999999999998 70-74 0.18 75-79 0.19 80-84 0.19499999999999998 85-89 0.185 90-94 0.19 95-99 0.16 100-104 0.16 105-109 0.13999999999999999 110-114 0.16999999999999998 115-119 0.185 120-124 0.19499999999999998 125-129 0.19 130-134 0.19499999999999998 135-139 0.19499999999999998 140-144 0.18 145-149 0.155 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67361285463218 99.25 2 0.3012804418779814 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.025106703489831784 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.38749999999999996 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.7 0.0 0.0 0.0 0.0 94-95 0.8374999999999999 0.0 0.0 0.0 0.0 96-97 0.925 0.0 0.0 0.0 0.0 98-99 1.025 0.0 0.0 0.0 0.0 100-101 1.25 0.0 0.0 0.0 0.0 102-103 1.4 0.0 0.0 0.0 0.0 104-105 1.6625 0.0 0.0 0.0 0.0 106-107 1.875 0.0 0.0 0.0 0.0 108-109 2.1500000000000004 0.0 0.0 0.0 0.0 110-111 2.475 0.0 0.0 0.0 0.0 112-113 2.7750000000000004 0.0 0.0 0.0 0.0 114-115 3.0125 0.0 0.0 0.0 0.0 116-117 3.2625 0.0 0.0 0.0 0.0 118-119 3.5625 0.0 0.0 0.0 0.0 120-121 3.8625 0.0 0.0 0.0 0.0 122-123 4.2 0.0 0.0 0.0 0.0 124-125 4.512499999999999 0.0 0.0 0.0 0.0 126-127 4.9125 0.0 0.0 0.0 0.0 128-129 5.225 0.0 0.0 0.0 0.0 130-131 5.55 0.0 0.0 0.0 0.0 132-133 6.1 0.0 0.0 0.0 0.0 134-135 6.3375 0.0 0.0 0.0 0.0 136-137 6.875 0.0 0.0 0.0 0.0 138-139 7.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTCCTT 10 0.006830828 145.0 9 AGCATCT 10 0.006830828 145.0 3 AAAAAAA 40 0.0076550315 18.125 15-19 >>END_MODULE Read 887212 spots for SRR7169588.sra Written 887212 spots for SRR7169588.sra Read 887212 spots for SRR7169588.sra Written 887212 spots for SRR7169588.sra Read 887212 spots for SRR7169588.sra Written 887212 spots for SRR7169588.sra Read 887212 spots for SRR7169588.sra Written 887212 spots for SRR7169588.sra Read 887219 spots for SRR7169588.sra Written 887219 spots for SRR7169588.sra Read 887212 spots for SRR7169588.sra Written 887212 spots for SRR7169588.sra Read 887212 spots for SRR7169588.sra Written 887212 spots for SRR7169588.sra Read 887212 spots for SRR7169588.sra Written 887212 spots for SRR7169588.sra Read 887212 spots for SRR7169588.sra Written 887212 spots for SRR7169588.sra Read 887212 spots for SRR7169588.sra Written 887212 spots for SRR7169588.sra Read 887212 spots for SRR7169588.sra Written 887212 spots for SRR7169588.sra Read 887212 spots for SRR7169588.sra Written 887212 spots for SRR7169588.sra Read 887212 spots for SRR7169588.sra Written 887212 spots for SRR7169588.sra Read 887212 spots for SRR7169588.sra Written 887212 spots for SRR7169588.sra Read 887212 spots for SRR7169588.sra Written 887212 spots for SRR7169588.sra Read 887212 spots for SRR7169588.sra Written 887212 spots for SRR7169588.sra Read 887212 spots for SRR7169588.sra Written 887212 spots for SRR7169588.sra Read 887212 spots for SRR7169588.sra Written 887212 spots for SRR7169588.sra Read 887212 spots for SRR7169588.sra Written 887212 spots for SRR7169588.sra Read 887212 spots for SRR7169588.sra Written 887212 spots for SRR7169588.sra SRR ids: ['SRR7169588.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_eukfkrtl SRR7169588.sra spots: 17744247 blocks: [[1, 887212], [887213, 1774424], [1774425, 2661636], [2661637, 3548848], [3548849, 4436060], [4436061, 5323272], [5323273, 6210484], [6210485, 7097696], [7097697, 7984908], [7984909, 8872120], [8872121, 9759332], [9759333, 10646544], [10646545, 11533756], [11533757, 12420968], [12420969, 13308180], [13308181, 14195392], [14195393, 15082604], [15082605, 15969816], [15969817, 16857028], [16857029, 17744247]] SRR7169588 file size 5991242 SRR7169588 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169588 SRR7169588_1.fastq SRR7169588_2.fastq Input file: SRR7169588_1.fastq Paired file: SRR7169588_2.fastq trimmed: SRR7169588-trimmed-pair1.fastq, SRR7169588-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 08:44:35 2025 >> started Tue Feb 11 08:44:55 2025 >> done (19.509s) 17744247 read pairs processed; of these: 15431 ( 0.09%) short read pairs filtered out after trimming by size control 57274 ( 0.32%) empty read pairs filtered out after trimming by size control 17671542 (99.59%) read pairs available; of these: 7565942 (42.81%) trimmed read pairs available after processing 10105600 (57.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 1 0.00% 20 9 0.00% 21 3 0.00% 22 2 0.00% 23 4 0.00% 24 5 0.00% 25 6 0.00% 26 3 0.00% 27 10 0.00% 28 5 0.00% 29 4 0.00% 30 13 0.00% 31 11 0.00% 32 13 0.00% 33 8 0.00% 34 14 0.00% 35 9 0.00% 36 15 0.00% 37 17 0.00% 38 29 0.00% 39 23 0.00% 40 22 0.00% 41 34 0.00% 42 33 0.00% 43 39 0.00% 44 38 0.00% 45 39 0.00% 46 44 0.00% 47 46 0.00% 48 47 0.00% 49 85 0.00% 50 90 0.00% 51 88 0.00% 52 93 0.00% 53 109 0.00% 54 121 0.00% 55 137 0.00% 56 140 0.00% 57 152 0.00% 58 191 0.00% 59 230 0.00% 60 255 0.00% 61 278 0.00% 62 349 0.00% 63 381 0.00% 64 448 0.00% 65 532 0.00% 66 536 0.00% 67 650 0.00% 68 879 0.00% 69 1345 0.01% 70 1613 0.01% 71 1339 0.01% 72 1363 0.01% 73 1462 0.01% 74 1539 0.01% 75 1829 0.01% 76 1902 0.01% 77 2057 0.01% 78 2415 0.01% 79 2670 0.02% 80 2949 0.02% 81 3369 0.02% 82 3975 0.02% 83 4414 0.02% 84 5558 0.03% 85 6593 0.04% 86 6850 0.04% 87 7230 0.04% 88 8020 0.05% 89 8411 0.05% 90 9103 0.05% 91 9700 0.05% 92 10515 0.06% 93 11546 0.07% 94 12431 0.07% 95 13445 0.08% 96 14065 0.08% 97 14634 0.08% 98 15374 0.09% 99 15870 0.09% 100 17158 0.10% 101 17999 0.10% 102 19387 0.11% 103 20763 0.12% 104 22141 0.13% 105 23220 0.13% 106 24389 0.14% 107 24776 0.14% 108 25340 0.14% 109 26740 0.15% 110 27557 0.16% 111 28507 0.16% 112 30270 0.17% 113 31902 0.18% 114 33600 0.19% 115 35447 0.20% 116 36900 0.21% 117 37907 0.21% 118 38679 0.22% 119 39337 0.22% 120 40440 0.23% 121 42298 0.24% 122 43517 0.25% 123 45433 0.26% 124 48319 0.27% 125 49673 0.28% 126 52018 0.29% 127 53074 0.30% 128 54904 0.31% 129 56561 0.32% 130 58095 0.33% 131 60499 0.34% 132 62917 0.36% 133 66041 0.37% 134 69753 0.39% 135 74122 0.42% 136 77494 0.44% 137 81248 0.46% 138 85646 0.48% 139 88456 0.50% 140 92584 0.52% 141 98607 0.56% 142 106638 0.60% 143 117573 0.67% 144 132635 0.75% 145 153631 0.87% 146 184153 1.04% 147 239459 1.36% 148 347221 1.96% 149 648419 3.67% 150 3462614 19.59% 151 10105600 57.19% 17671542 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=40 prefix-density=0.21 prefix-fanout=1.9 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACGAACTGGATTGTGCGCTTGGTCTTGATGGTAGCCACAGCTGCATTCACATCCTTGGGCACAACATCACCTCTATACATCAGGCAGCAAGCCATGTACTTGCCATGACGTGGGTCACACTTGGCCATCATGGATGATGGCTCAAAAGCACTGTTGGTTATCTCAGCCACAGAGAGCTGCTCATGGTATGCCTTCTCTGCGGAGATGACAGGGGCATAAGAGGAAAGCATGAAATGGATCCTGGGGTATGGAACCAAGTTGGTTTGGAACTCAGTAACATCCACATTAAGAGCTCCATCAAACCTTAATGAGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=332.43 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=20.1 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.84 fanout-score-rank=33 prefix-density=0.30 prefix-fanout=2.5 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.04 sequence-density-rank=41 fanout-score=143.19 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=13.9 sequence=AGAAAGAAATGAGAATTCTCATGGTGGGTCTTGATGCTGCTGGTAAGACCACCATCTTGTACAAGCTCAA SRR7169588 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 08:45:38 Started mapping on | Feb 11 08:45:39 Finished on | Feb 11 08:47:08 Mapping speed, Million of reads per hour | 714.80 Number of input reads | 17671542 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 16877726 Uniquely mapped reads % | 95.51% Average mapped length | 293.26 Number of splices: Total | 15485505 Number of splices: Annotated (sjdb) | 15210076 Number of splices: GT/AG | 15254587 Number of splices: GC/AG | 182744 Number of splices: AT/AC | 13744 Number of splices: Non-canonical | 34430 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 302707 % of reads mapped to multiple loci | 1.71% Number of reads mapped to too many loci | 17889 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.64% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 506154 506154 506154 N_multimapping 302707 302707 302707 N_noFeature 402645 16673121 496303 N_ambiguous 177830 971 66407 UnstrandedReadsAssigned:16297251 PositiveStrandReadsAssigned:203634 NegativeStrandReadsAssigned:16315016 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169588 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169588-trimmed-pair1.fastq SRR7169588-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,671,542 reads, 16,221,953 reads pseudoaligned [quant] estimated average fragment length: 235.159 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,058 rounds 52401 SRR7169588.ke.tsv 34699 SRR7169588.se.tsv 87100 total ==> SRR7169588.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1783.84 261 8.56355 Potri.005G024800.1.v4.1 1035 800.841 57 4.1658 Potri.004G059700.1.v4.1 961 726.86 1 0.0805228 Potri.007G009000.2.v4.1 1416 1181.84 0 0 Potri.003G141000.2.v4.1 2943 2708.84 259 5.59611 Potri.016G087400.1.v4.1 270 84.7818 1410 973.388 Potri.015G069301.1.v4.1 564 334.994 0 0 Potri.010G195200.1.v4.1 1773 1538.84 27 1.02693 Potri.012G127500.1.v4.1 977 742.847 8885 700.048 ==> SRR7169588.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1613 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 424 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 34 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169588 completed mapping pipeline successfully