Starting /dee2/code/volunteer_pipeline.sh SRR7169589 current disk space = 3055610216448 free memory = 1579292892 SRR7169589 SRAfilesize 6be578bc50f7eecf0d1b651ccefee132 SRR7169589.sra SRR7169589.sra file validated SRR7169589 is paired end SRR7169589 is conventional basespace SRR7169589 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169589_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.978 34.0 33.0 34.0 33.0 34.0 2 33.3005 34.0 33.0 34.0 33.0 34.0 3 33.4565 34.0 34.0 34.0 33.0 34.0 4 33.50225 34.0 34.0 34.0 33.0 34.0 5 33.463 34.0 34.0 34.0 33.0 34.0 6 37.23675 38.0 38.0 38.0 36.0 38.0 7 37.4145 38.0 38.0 38.0 37.0 38.0 8 37.539 38.0 38.0 38.0 37.0 38.0 9 37.49075 38.0 38.0 38.0 37.0 38.0 10-14 37.567750000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.52719999999999 38.0 38.0 38.0 38.0 38.0 20-24 37.50795 38.0 38.0 38.0 37.8 38.0 25-29 37.48505 38.0 38.0 38.0 37.6 38.0 30-34 37.4816 38.0 38.0 38.0 37.4 38.0 35-39 37.41175 38.0 38.0 38.0 37.2 38.0 40-44 37.35075 38.0 38.0 38.0 37.0 38.0 45-49 37.31695 38.0 38.0 38.0 37.0 38.0 50-54 37.29039999999999 38.0 38.0 38.0 37.0 38.0 55-59 37.2088 38.0 38.0 38.0 36.8 38.0 60-64 37.185950000000005 38.0 38.0 38.0 36.4 38.0 65-69 37.182599999999994 38.0 38.0 38.0 36.4 38.0 70-74 37.09335000000001 38.0 38.0 38.0 36.0 38.0 75-79 37.02455 38.0 38.0 38.0 36.0 38.0 80-84 36.989999999999995 38.0 38.0 38.0 36.0 38.0 85-89 36.95165000000001 38.0 38.0 38.0 35.8 38.0 90-94 36.872899999999994 38.0 38.0 38.0 35.4 38.0 95-99 36.7383 38.0 38.0 38.0 35.0 38.0 100-104 36.68805 38.0 38.0 38.0 34.8 38.0 105-109 36.54835 38.0 38.0 38.0 34.0 38.0 110-114 36.37625 38.0 38.0 38.0 34.0 38.0 115-119 36.185500000000005 38.0 37.8 38.0 33.8 38.0 120-124 36.1143 38.0 37.6 38.0 33.6 38.0 125-129 35.99015 38.0 37.2 38.0 33.2 38.0 130-134 35.75515 38.0 37.0 38.0 32.6 38.0 135-139 35.392 38.0 36.0 38.0 31.0 38.0 140-144 35.12475 38.0 36.0 38.0 30.2 38.0 145-149 34.675850000000004 38.0 35.8 38.0 28.8 38.0 150-151 31.572625 36.5 31.5 38.0 13.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 2.0 15 2.0 16 1.0 17 3.0 18 4.0 19 2.0 20 2.0 21 4.0 22 8.0 23 9.0 24 17.0 25 9.0 26 14.0 27 21.0 28 13.0 29 21.0 30 36.0 31 41.0 32 64.0 33 62.0 34 115.0 35 207.0 36 502.0 37 2839.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.88612731422774 11.716966776566066 7.811311184377377 37.58559472482881 2 22.975 13.575000000000001 33.6 29.849999999999998 3 19.425 17.675 26.325 36.575 4 22.525000000000002 28.249999999999996 23.125 26.1 5 22.475 31.075000000000003 25.25 21.2 6 19.275000000000002 34.599999999999994 25.275 20.849999999999998 7 13.125 27.500000000000004 41.5 17.875 8 18.275 25.674999999999997 30.95 25.1 9 16.625 24.3 34.725 24.349999999999998 10-14 19.84 29.86 26.945000000000004 23.355 15-19 19.965 28.634999999999998 27.605 23.794999999999998 20-24 19.765 28.83 27.325 24.08 25-29 19.509999999999998 29.24 27.865000000000002 23.385 30-34 19.509999999999998 28.955 27.334999999999997 24.2 35-39 20.085 28.935 26.68 24.3 40-44 19.765 28.67 27.794999999999998 23.77 45-49 20.044999999999998 28.675 27.029999999999998 24.25 50-54 20.455000000000002 28.435 27.889999999999997 23.22 55-59 19.915 28.449999999999996 27.525 24.11 60-64 20.255000000000003 28.685 27.439999999999998 23.62 65-69 20.5 28.175 27.355 23.97 70-74 19.885 28.465 28.04 23.61 75-79 19.835 28.765 27.43 23.97 80-84 20.424999999999997 28.32 27.6 23.655 85-89 20.36 28.605000000000004 27.305 23.73 90-94 20.035 28.405 27.18 24.38 95-99 20.215 28.349999999999998 27.205000000000002 24.23 100-104 20.755000000000003 28.560000000000002 27.310000000000002 23.375 105-109 20.330000000000002 28.305000000000003 27.47 23.895 110-114 20.426021301065052 28.21141057052853 27.35636781839092 24.0062003100155 115-119 20.455000000000002 28.965000000000003 27.1 23.48 120-124 20.84 28.475 27.38 23.305 125-129 20.9 28.08 27.485 23.535 130-134 20.830000000000002 28.21 27.384999999999998 23.575 135-139 20.695 28.07 26.97 24.265 140-144 21.08 28.38 27.095000000000002 23.445 145-149 20.79 28.615000000000002 27.26 23.335 150-151 20.5 28.000000000000004 27.224999999999998 24.275 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 2.0 24 1.5 25 2.5 26 4.5 27 6.0 28 10.5 29 17.0 30 19.5 31 20.5 32 26.5 33 39.0 34 59.5 35 71.0 36 81.0 37 89.0 38 109.0 39 149.5 40 185.0 41 217.5 42 236.0 43 256.0 44 284.0 45 277.0 46 265.5 47 260.5 48 248.5 49 217.5 50 184.5 51 156.5 52 118.5 53 99.5 54 81.0 55 52.5 56 33.0 57 32.0 58 25.0 59 16.0 60 11.0 61 7.0 62 5.5 63 3.0 64 2.0 65 1.5 66 2.0 67 1.5 68 2.5 69 4.0 70 2.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.425 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.005 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.44999999999999996 0.0 0.0 0.0 0.0 100-101 0.5625 0.0 0.0 0.0 0.0 102-103 0.675 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 0.9 0.0 0.0 0.0 0.0 108-109 1.0125 0.0 0.0 0.0 0.0 110-111 1.25 0.0 0.0 0.0 0.0 112-113 1.4625 0.0 0.0 0.0 0.0 114-115 1.6875 0.0 0.0 0.0 0.0 116-117 1.9749999999999999 0.0 0.0 0.0 0.0 118-119 2.15 0.0 0.0 0.0 0.0 120-121 2.3875 0.0 0.0 0.0 0.0 122-123 2.5125 0.0 0.0 0.0 0.0 124-125 2.7 0.0 0.0 0.0 0.0 126-127 2.925 0.0 0.0 0.0 0.0 128-129 3.2249999999999996 0.0 0.0 0.0 0.0 130-131 3.4625 0.0 0.0 0.0 0.0 132-133 3.825 0.0 0.0 0.0 0.0 134-135 4.375 0.0 0.0 0.0 0.0 136-137 4.6875 0.0 0.0 0.0 0.0 138-139 4.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169589 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169589_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.94375 33.0 33.0 34.0 32.0 34.0 2 33.01575 34.0 33.0 34.0 32.0 34.0 3 33.07925 34.0 33.0 34.0 33.0 34.0 4 33.001 34.0 33.0 34.0 33.0 34.0 5 33.04225 34.0 33.0 34.0 33.0 34.0 6 37.18325 38.0 38.0 38.0 37.0 38.0 7 37.27675 38.0 38.0 38.0 37.0 38.0 8 37.24675 38.0 38.0 38.0 37.0 38.0 9 37.253 38.0 38.0 38.0 37.0 38.0 10-14 37.199650000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.19585 38.0 38.0 38.0 37.0 38.0 20-24 37.1342 38.0 38.0 38.0 37.0 38.0 25-29 37.10025 38.0 38.0 38.0 37.0 38.0 30-34 37.0417 38.0 38.0 38.0 37.0 38.0 35-39 37.0708 38.0 38.0 38.0 37.0 38.0 40-44 37.03685 38.0 38.0 38.0 37.0 38.0 45-49 37.06575 38.0 38.0 38.0 37.0 38.0 50-54 37.09165 38.0 38.0 38.0 37.0 38.0 55-59 36.9991 38.0 38.0 38.0 36.6 38.0 60-64 36.932849999999995 38.0 38.0 38.0 36.0 38.0 65-69 36.932399999999994 38.0 38.0 38.0 36.0 38.0 70-74 36.8313 38.0 38.0 38.0 36.0 38.0 75-79 36.7756 38.0 38.0 38.0 36.0 38.0 80-84 36.66155 38.0 38.0 38.0 35.4 38.0 85-89 36.568200000000004 38.0 38.0 38.0 34.8 38.0 90-94 36.565549999999995 38.0 38.0 38.0 35.0 38.0 95-99 36.48755 38.0 38.0 38.0 34.8 38.0 100-104 36.4489 38.0 38.0 38.0 34.6 38.0 105-109 36.3293 38.0 38.0 38.0 34.0 38.0 110-114 36.26855 38.0 38.0 38.0 34.0 38.0 115-119 35.9979 38.0 38.0 38.0 33.6 38.0 120-124 35.7664 38.0 37.2 38.0 32.4 38.0 125-129 35.561449999999994 38.0 37.0 38.0 31.8 38.0 130-134 35.3784 38.0 36.6 38.0 31.0 38.0 135-139 35.1221 38.0 36.2 38.0 29.2 38.0 140-144 34.78615 38.0 36.0 38.0 28.0 38.0 145-149 34.185050000000004 38.0 35.6 38.0 26.0 38.0 150-151 30.603500000000004 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 3.0 4 4.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 2.0 13 5.0 14 0.0 15 2.0 16 4.0 17 1.0 18 2.0 19 3.0 20 6.0 21 5.0 22 9.0 23 11.0 24 10.0 25 13.0 26 16.0 27 16.0 28 28.0 29 37.0 30 37.0 31 52.0 32 64.0 33 74.0 34 135.0 35 178.0 36 480.0 37 2788.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.334001503382616 23.552994237033325 11.325482335254321 27.787521924329745 2 27.969924812030072 27.017543859649123 29.423558897243108 15.588972431077694 3 18.88638073739654 29.0945573112616 31.778279408076248 20.240782543265613 4 22.035597894209076 33.7678616194535 24.51742291301078 19.67911757332665 5 24.3920782150915 37.202306342441716 22.035597894209076 16.37001754825771 6 20.491597692500626 38.675696012039126 22.774015550539254 18.058690744920995 7 20.140456483571608 21.896162528216703 38.650614497115626 19.312766491096063 8 21.639919759277834 24.77432296890672 28.109327983951854 25.47642928786359 9 21.057909250438705 24.868388067184757 31.210829781900223 22.86287290047631 10-14 22.816166883963493 28.953966502858293 26.69240798315114 21.53745863002708 15-19 23.04914744232698 27.68304914744233 27.748244734202608 21.519558676028083 20-24 22.814145974416856 27.82543265613243 28.136443441183843 21.22397792826687 25-29 22.83808186195827 27.573234349919744 28.17516051364366 21.41352327447833 30-34 23.22771483004111 28.186102476687054 28.166048330492327 20.420134362779503 35-39 23.27983951855567 27.913741223671014 27.713139418254762 21.093279839518555 40-44 22.758724428399518 28.198957079823504 28.15383072603289 20.88848776574408 45-49 22.90298320381048 27.625971421408874 28.533467034344444 20.9375783404362 50-54 23.098520932564554 28.012033091000248 28.2978190022562 20.591626974178993 55-59 23.212674220395066 27.920385039606938 27.97052040509375 20.896420334904242 60-64 22.89796941589371 27.681123088493358 28.944597643519682 20.476309852093255 65-69 23.469234241010984 27.64655734416529 27.982548518128482 20.90165989669525 70-74 23.743605176045744 27.605577289597754 28.152272043334335 20.49854549102217 75-79 23.665997993981946 27.763289869608826 27.933801404212637 20.63691073219659 80-84 23.383982749109876 27.882252645303645 28.117947946442 20.615816659144475 85-89 23.334670947030496 27.69863563402889 28.190208667736762 20.776484751203853 90-94 24.08224674022066 27.823470411233703 27.64794383149448 20.446339017051155 95-99 23.77920385039607 27.263611751729673 28.055750526421335 20.901433871452923 100-104 24.138968265904648 27.322404371584703 28.149596430540935 20.38903093196972 105-109 23.75438596491228 27.358395989974937 27.844611528822057 21.042606516290725 110-114 23.426766283909142 28.16527102241388 28.105099533670963 20.30286316000602 115-119 23.9518555667001 27.23169508525577 28.425275827482448 20.391173520561683 120-124 24.332998996990973 27.878635907723172 27.41223671013039 20.376128385155468 125-129 24.345339620748472 27.365305508176984 27.741547105447978 20.54780776562657 130-134 24.826928865255343 27.811778870271898 27.014146684057387 20.347145580415372 135-139 24.62256106736219 27.66213572754176 27.366203541154636 20.349099663941416 140-144 24.680338966053252 27.774156345584917 27.26269869127012 20.28280599709171 145-149 24.35820296831127 27.481949458483758 27.732651423987164 20.42719614921781 150-151 24.480600750938674 27.48435544430538 27.546933667083856 20.48811013767209 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 9.0 1 5.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 1.0 23 2.0 24 2.0 25 2.0 26 1.5 27 2.5 28 5.5 29 8.0 30 14.5 31 15.5 32 21.5 33 35.5 34 46.5 35 57.5 36 77.0 37 108.0 38 139.5 39 156.0 40 191.5 41 251.0 42 279.0 43 283.0 44 287.5 45 277.5 46 276.5 47 260.5 48 207.5 49 183.0 50 176.5 51 154.0 52 125.0 53 92.5 54 65.5 55 55.0 56 40.5 57 25.0 58 20.0 59 14.0 60 8.5 61 6.0 62 2.5 63 2.0 64 1.5 65 0.5 66 0.5 67 0.5 68 1.0 69 1.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.25 3 0.325 4 0.27499999999999997 5 0.27499999999999997 6 0.325 7 0.325 8 0.3 9 0.27499999999999997 10-14 0.29 15-19 0.3 20-24 0.325 25-29 0.32 30-34 0.27 35-39 0.3 40-44 0.27999999999999997 45-49 0.27499999999999997 50-54 0.27499999999999997 55-59 0.27 60-64 0.27499999999999997 65-69 0.295 70-74 0.31 75-79 0.3 80-84 0.295 85-89 0.32 90-94 0.3 95-99 0.27 100-104 0.265 105-109 0.25 110-114 0.28500000000000003 115-119 0.3 120-124 0.3 125-129 0.33 130-134 0.33 135-139 0.315 140-144 0.28500000000000003 145-149 0.27999999999999997 150-151 0.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44584382871537 98.7 2 0.5037783375314862 1.0 3 0.025188916876574305 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025188916876574305 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.5875 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.775 0.0 0.0 0.0 0.0 106-107 0.925 0.0 0.0 0.0 0.0 108-109 1.0375 0.0 0.0 0.0 0.0 110-111 1.275 0.0 0.0 0.0 0.0 112-113 1.4875 0.0 0.0 0.0 0.0 114-115 1.7125 0.0 0.0 0.0 0.0 116-117 1.9874999999999998 0.0 0.0 0.0 0.0 118-119 2.1625 0.0 0.0 0.0 0.0 120-121 2.3875 0.0 0.0 0.0 0.0 122-123 2.5125 0.0 0.0 0.0 0.0 124-125 2.7 0.0 0.0 0.0 0.0 126-127 2.925 0.0 0.0 0.0 0.0 128-129 3.175 0.0 0.0 0.0 0.0 130-131 3.4375 0.0 0.0 0.0 0.0 132-133 3.8 0.0 0.0 0.0 0.0 134-135 4.35 0.0 0.0 0.0 0.0 136-137 4.675 0.0 0.0 0.0 0.0 138-139 4.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTCAAA 10 0.006830828 145.0 7 CCCCCCC 35 0.0035366106 20.714287 30-34 >>END_MODULE Read 877776 spots for SRR7169589.sra Written 877776 spots for SRR7169589.sra Read 877776 spots for SRR7169589.sra Written 877776 spots for SRR7169589.sra Read 877776 spots for SRR7169589.sra Written 877776 spots for SRR7169589.sra Read 877776 spots for SRR7169589.sra Written 877776 spots for SRR7169589.sra Read 877776 spots for SRR7169589.sra Written 877776 spots for SRR7169589.sra Read 877776 spots for SRR7169589.sra Written 877776 spots for SRR7169589.sra Read 877788 spots for SRR7169589.sra Written 877788 spots for SRR7169589.sra Read 877776 spots for SRR7169589.sra Written 877776 spots for SRR7169589.sra Read 877776 spots for SRR7169589.sra Written 877776 spots for SRR7169589.sra Read 877776 spots for SRR7169589.sra Written 877776 spots for SRR7169589.sra Read 877776 spots for SRR7169589.sra Written 877776 spots for SRR7169589.sra Read 877776 spots for SRR7169589.sra Written 877776 spots for SRR7169589.sra Read 877776 spots for SRR7169589.sra Written 877776 spots for SRR7169589.sra Read 877776 spots for SRR7169589.sra Written 877776 spots for SRR7169589.sra Read 877776 spots for SRR7169589.sra Written 877776 spots for SRR7169589.sra Read 877776 spots for SRR7169589.sra Written 877776 spots for SRR7169589.sra Read 877776 spots for SRR7169589.sra Written 877776 spots for SRR7169589.sra Read 877776 spots for SRR7169589.sra Written 877776 spots for SRR7169589.sra Read 877776 spots for SRR7169589.sra Written 877776 spots for SRR7169589.sra Read 877776 spots for SRR7169589.sra Written 877776 spots for SRR7169589.sra SRR ids: ['SRR7169589.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6pei_y8k SRR7169589.sra spots: 17555532 blocks: [[1, 877776], [877777, 1755552], [1755553, 2633328], [2633329, 3511104], [3511105, 4388880], [4388881, 5266656], [5266657, 6144432], [6144433, 7022208], [7022209, 7899984], [7899985, 8777760], [8777761, 9655536], [9655537, 10533312], [10533313, 11411088], [11411089, 12288864], [12288865, 13166640], [13166641, 14044416], [14044417, 14922192], [14922193, 15799968], [15799969, 16677744], [16677745, 17555532]] SRR7169589 file size 5927293 SRR7169589 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169589 SRR7169589_1.fastq SRR7169589_2.fastq Input file: SRR7169589_1.fastq Paired file: SRR7169589_2.fastq trimmed: SRR7169589-trimmed-pair1.fastq, SRR7169589-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 08:58:29 2025 >> started Tue Feb 11 08:58:47 2025 >> done (18.414s) 17555532 read pairs processed; of these: 11460 ( 0.07%) short read pairs filtered out after trimming by size control 51359 ( 0.29%) empty read pairs filtered out after trimming by size control 17492713 (99.64%) read pairs available; of these: 7164488 (40.96%) trimmed read pairs available after processing 10328225 (59.04%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 8 0.00% 20 3 0.00% 21 7 0.00% 22 8 0.00% 23 9 0.00% 24 5 0.00% 25 4 0.00% 26 9 0.00% 27 5 0.00% 28 10 0.00% 29 6 0.00% 30 12 0.00% 31 9 0.00% 32 10 0.00% 33 10 0.00% 34 11 0.00% 35 17 0.00% 36 17 0.00% 37 9 0.00% 38 14 0.00% 39 18 0.00% 40 17 0.00% 41 22 0.00% 42 18 0.00% 43 27 0.00% 44 36 0.00% 45 36 0.00% 46 30 0.00% 47 35 0.00% 48 42 0.00% 49 38 0.00% 50 43 0.00% 51 53 0.00% 52 61 0.00% 53 73 0.00% 54 94 0.00% 55 73 0.00% 56 92 0.00% 57 107 0.00% 58 114 0.00% 59 164 0.00% 60 149 0.00% 61 185 0.00% 62 222 0.00% 63 244 0.00% 64 277 0.00% 65 290 0.00% 66 304 0.00% 67 374 0.00% 68 446 0.00% 69 494 0.00% 70 643 0.00% 71 675 0.00% 72 732 0.00% 73 830 0.00% 74 912 0.01% 75 1033 0.01% 76 1112 0.01% 77 1177 0.01% 78 1309 0.01% 79 1480 0.01% 80 1783 0.01% 81 2007 0.01% 82 2308 0.01% 83 2616 0.01% 84 3390 0.02% 85 3944 0.02% 86 4110 0.02% 87 4500 0.03% 88 4981 0.03% 89 5297 0.03% 90 5658 0.03% 91 6199 0.04% 92 6676 0.04% 93 7332 0.04% 94 7875 0.05% 95 8444 0.05% 96 9238 0.05% 97 9465 0.05% 98 9998 0.06% 99 10617 0.06% 100 11286 0.06% 101 12115 0.07% 102 12922 0.07% 103 14036 0.08% 104 14747 0.08% 105 15804 0.09% 106 16622 0.10% 107 17018 0.10% 108 17673 0.10% 109 18406 0.11% 110 19252 0.11% 111 20359 0.12% 112 21241 0.12% 113 22798 0.13% 114 23778 0.14% 115 25387 0.15% 116 26247 0.15% 117 27507 0.16% 118 28380 0.16% 119 29060 0.17% 120 29828 0.17% 121 30964 0.18% 122 32724 0.19% 123 34352 0.20% 124 36140 0.21% 125 38147 0.22% 126 39777 0.23% 127 41598 0.24% 128 42522 0.24% 129 44736 0.26% 130 46368 0.27% 131 48716 0.28% 132 51502 0.29% 133 54126 0.31% 134 57130 0.33% 135 60278 0.34% 136 64562 0.37% 137 68089 0.39% 138 71543 0.41% 139 77214 0.44% 140 81613 0.47% 141 87898 0.50% 142 96118 0.55% 143 107021 0.61% 144 122757 0.70% 145 142156 0.81% 146 172514 0.99% 147 227698 1.30% 148 339315 1.94% 149 667869 3.82% 150 3623864 20.72% 151 10328225 59.04% 17492713 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=3.26 fanout-score-rank=34 prefix-density=0.19 prefix-fanout=2.7 sequence=CTGGCCATTCAATGTGACATCCTCTTGAGTGGCTTTCAAAAGCCTGATAAAAACGCTGAACTGACCACCTTTTTCTAGGACTTTGGTGACATTGGTTGGACCAGGTGGTGCTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=320.62 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=16.9 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.68 fanout-score-rank=35 prefix-density=0.36 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=30 fanout-score=225.57 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=25.5 sequence=GAAGAAGAAGAAA SRR7169589 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 08:59:28 Started mapping on | Feb 11 08:59:28 Finished on | Feb 11 09:00:55 Mapping speed, Million of reads per hour | 723.84 Number of input reads | 17492713 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 16781458 Uniquely mapped reads % | 95.93% Average mapped length | 295.06 Number of splices: Total | 16190125 Number of splices: Annotated (sjdb) | 15901428 Number of splices: GT/AG | 15955189 Number of splices: GC/AG | 189112 Number of splices: AT/AC | 13674 Number of splices: Non-canonical | 32150 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 307620 % of reads mapped to multiple loci | 1.76% Number of reads mapped to too many loci | 16183 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.19% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 415205 415205 415205 N_multimapping 307620 307620 307620 N_noFeature 475834 16594401 569059 N_ambiguous 161036 1122 66340 UnstrandedReadsAssigned:16144588 PositiveStrandReadsAssigned:185935 NegativeStrandReadsAssigned:16146059 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169589 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169589-trimmed-pair1.fastq SRR7169589-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,492,713 reads, 16,024,618 reads pseudoaligned [quant] estimated average fragment length: 247.327 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,090 rounds 52401 SRR7169589.ke.tsv 34699 SRR7169589.se.tsv 87100 total ==> SRR7169589.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1771.67 303 10.4032 Potri.005G024800.1.v4.1 1035 788.673 44 3.39361 Potri.004G059700.1.v4.1 961 714.713 8 0.68087 Potri.007G009000.2.v4.1 1416 1169.67 0 0 Potri.003G141000.2.v4.1 2943 2696.67 342.033 7.71517 Potri.016G087400.1.v4.1 270 78.1508 1261 981.494 Potri.015G069301.1.v4.1 564 323.552 0 0 Potri.010G195200.1.v4.1 1773 1526.67 21 0.836718 Potri.012G127500.1.v4.1 977 730.691 8626 718.095 ==> SRR7169589.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1535 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 282 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169589 completed mapping pipeline successfully