Starting /dee2/code/volunteer_pipeline.sh SRR7169590 current disk space = 3055747084288 free memory = 1487820740 SRR7169590 SRAfilesize a3c31da81533c2b4015296f25b10f396 SRR7169590.sra SRR7169590.sra file validated SRR7169590 is paired end SRR7169590 is conventional basespace SRR7169590 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169590_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.02775 34.0 33.0 34.0 33.0 34.0 2 33.437 34.0 34.0 34.0 33.0 34.0 3 33.45075 34.0 34.0 34.0 33.0 34.0 4 33.4685 34.0 34.0 34.0 33.0 34.0 5 33.52575 34.0 34.0 34.0 33.0 34.0 6 37.1855 38.0 38.0 38.0 36.0 38.0 7 37.3295 38.0 38.0 38.0 37.0 38.0 8 37.07525 38.0 38.0 38.0 36.0 38.0 9 37.481 38.0 38.0 38.0 37.0 38.0 10-14 37.5556 38.0 38.0 38.0 37.6 38.0 15-19 37.5481 38.0 38.0 38.0 37.6 38.0 20-24 37.494600000000005 38.0 38.0 38.0 37.6 38.0 25-29 37.46755 38.0 38.0 38.0 37.4 38.0 30-34 37.442899999999995 38.0 38.0 38.0 37.6 38.0 35-39 37.31855 38.0 38.0 38.0 36.8 38.0 40-44 37.2466 38.0 38.0 38.0 36.8 38.0 45-49 37.27875 38.0 38.0 38.0 37.0 38.0 50-54 37.2378 38.0 38.0 38.0 36.8 38.0 55-59 37.154700000000005 38.0 38.0 38.0 36.4 38.0 60-64 37.133050000000004 38.0 38.0 38.0 36.4 38.0 65-69 37.1248 38.0 38.0 38.0 36.0 38.0 70-74 37.04165 38.0 38.0 38.0 36.0 38.0 75-79 36.95245 38.0 38.0 38.0 36.0 38.0 80-84 36.857600000000005 38.0 38.0 38.0 35.6 38.0 85-89 36.8147 38.0 38.0 38.0 35.6 38.0 90-94 36.70445 38.0 38.0 38.0 35.4 38.0 95-99 36.57725 38.0 38.0 38.0 34.8 38.0 100-104 36.42545 38.0 38.0 38.0 34.0 38.0 105-109 36.368399999999994 38.0 38.0 38.0 34.0 38.0 110-114 36.1542 38.0 38.0 38.0 33.8 38.0 115-119 36.06355 38.0 37.8 38.0 33.4 38.0 120-124 35.807050000000004 38.0 37.0 38.0 32.2 38.0 125-129 35.85475 38.0 37.0 38.0 32.8 38.0 130-134 35.52105 38.0 36.6 38.0 31.8 38.0 135-139 35.21385 38.0 36.0 38.0 30.6 38.0 140-144 34.7842 38.0 35.6 38.0 28.4 38.0 145-149 34.139599999999994 38.0 35.0 38.0 25.6 38.0 150-151 30.668750000000003 36.5 29.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 1.0 9 1.0 10 0.0 11 1.0 12 2.0 13 3.0 14 0.0 15 2.0 16 3.0 17 3.0 18 8.0 19 7.0 20 1.0 21 2.0 22 5.0 23 6.0 24 6.0 25 15.0 26 15.0 27 19.0 28 27.0 29 31.0 30 25.0 31 47.0 32 66.0 33 85.0 34 136.0 35 205.0 36 530.0 37 2747.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.74707973590655 12.2397155916709 9.268664296597258 36.74454037582529 2 24.05 15.15 31.25 29.549999999999997 3 20.724999999999998 19.475 25.074999999999996 34.725 4 23.599999999999998 26.6 22.45 27.35 5 23.05 29.349999999999998 25.174999999999997 22.425 6 21.375 32.824999999999996 25.35 20.45 7 14.099999999999998 28.799999999999997 39.925 17.175 8 17.224999999999998 26.325 32.300000000000004 24.15 9 16.650000000000002 26.55 32.6 24.2 10-14 19.61 30.23 27.6 22.56 15-19 19.7 29.439999999999998 27.445000000000004 23.415 20-24 20.62 29.03 26.939999999999998 23.41 25-29 19.67 28.98 27.584999999999997 23.765 30-34 19.634999999999998 28.810000000000002 28.025 23.53 35-39 19.869999999999997 28.71 27.685 23.735 40-44 20.674999999999997 29.07 26.834999999999997 23.419999999999998 45-49 20.345 28.804999999999996 27.189999999999998 23.66 50-54 20.125 28.88 26.884999999999998 24.11 55-59 20.095 29.07 27.095000000000002 23.74 60-64 19.705000000000002 28.99 27.05 24.255 65-69 20.169999999999998 28.505000000000003 27.51 23.815 70-74 20.385 29.115000000000002 26.729999999999997 23.77 75-79 20.145 28.775000000000002 26.875 24.205 80-84 20.4 28.199999999999996 27.1 24.3 85-89 20.845 28.199999999999996 26.779999999999998 24.175 90-94 20.54 27.865000000000002 26.915 24.68 95-99 20.275000000000002 27.93 27.634999999999998 24.16 100-104 19.744999999999997 28.665000000000003 27.445000000000004 24.145 105-109 20.71603580179009 28.361418070903543 26.976348817440872 23.946197309865493 110-114 20.905 28.345 26.669999999999998 24.08 115-119 20.64 28.470000000000002 27.235 23.655 120-124 20.825 28.110000000000003 26.96 24.104999999999997 125-129 20.815 27.73 27.465 23.990000000000002 130-134 20.674999999999997 27.925 26.915 24.485 135-139 20.915 27.985 27.02 24.08 140-144 20.855 28.115000000000002 26.650000000000002 24.38 145-149 20.64 28.52 26.455000000000002 24.385 150-151 21.25 28.275 26.2875 24.1875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 1.5 22 2.0 23 1.5 24 3.5 25 5.5 26 6.5 27 6.0 28 7.5 29 14.0 30 27.0 31 36.0 32 39.0 33 48.0 34 52.5 35 58.5 36 82.0 37 109.5 38 128.0 39 142.5 40 167.5 41 190.5 42 208.0 43 242.5 44 257.0 45 244.5 46 259.0 47 264.0 48 241.5 49 217.0 50 185.5 51 151.5 52 122.5 53 113.5 54 95.5 55 62.5 56 43.5 57 37.5 58 30.0 59 22.5 60 18.5 61 14.0 62 11.0 63 6.0 64 3.0 65 3.0 66 2.0 67 1.0 68 2.0 69 1.5 70 0.5 71 1.5 72 1.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.55 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.005 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24318869828456 98.35000000000001 2 0.6559031281533804 1.3 3 0.050454086781029264 0.15 4 0.050454086781029264 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0125 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.425 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.8125 0.0 0.0 0.0 0.0 104-105 1.125 0.0 0.0 0.0 0.0 106-107 1.35 0.0 0.0 0.0 0.0 108-109 1.5375 0.0 0.0 0.0 0.0 110-111 1.725 0.0 0.0 0.0 0.0 112-113 1.95 0.0 0.0 0.0 0.0 114-115 2.2125 0.0 0.0 0.0 0.0 116-117 2.4625 0.0 0.0 0.0 0.0 118-119 2.7750000000000004 0.0 0.0 0.0 0.0 120-121 3.0875 0.0 0.0 0.0 0.0 122-123 3.475 0.0 0.0 0.0 0.0 124-125 3.8375000000000004 0.0 0.0 0.0 0.0 126-127 4.1875 0.0 0.0 0.0 0.0 128-129 4.575 0.0 0.0 0.0 0.0 130-131 5.0125 0.0 0.0 0.0 0.0 132-133 5.325 0.0 0.0 0.0 0.0 134-135 5.6375 0.0 0.0 0.0 0.0 136-137 6.050000000000001 0.0 0.0 0.0 0.0 138-139 6.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTGAGT 10 0.006832588 144.9875 8 >>END_MODULE SRR7169590 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169590_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7635 33.0 33.0 34.0 32.0 34.0 2 32.90125 34.0 33.0 34.0 32.0 34.0 3 32.92125 34.0 33.0 34.0 32.0 34.0 4 32.881 34.0 33.0 34.0 32.0 34.0 5 32.9175 34.0 33.0 34.0 33.0 34.0 6 36.93475 38.0 38.0 38.0 37.0 38.0 7 37.01225 38.0 38.0 38.0 37.0 38.0 8 37.015 38.0 38.0 38.0 37.0 38.0 9 37.028 38.0 38.0 38.0 37.0 38.0 10-14 36.984899999999996 38.0 38.0 38.0 37.0 38.0 15-19 36.970000000000006 38.0 38.0 38.0 37.0 38.0 20-24 36.89685 38.0 38.0 38.0 37.0 38.0 25-29 36.8153 38.0 38.0 38.0 36.6 38.0 30-34 36.736749999999994 38.0 38.0 38.0 36.0 38.0 35-39 36.74735 38.0 38.0 38.0 36.0 38.0 40-44 36.82875 38.0 38.0 38.0 36.8 38.0 45-49 36.824749999999995 38.0 38.0 38.0 37.0 38.0 50-54 36.8087 38.0 38.0 38.0 36.4 38.0 55-59 36.78075 38.0 38.0 38.0 36.0 38.0 60-64 36.77075 38.0 38.0 38.0 36.0 38.0 65-69 36.65955 38.0 38.0 38.0 36.0 38.0 70-74 36.6007 38.0 38.0 38.0 36.0 38.0 75-79 36.49485 38.0 38.0 38.0 35.4 38.0 80-84 36.41925 38.0 38.0 38.0 34.8 38.0 85-89 36.3197 38.0 38.0 38.0 34.4 38.0 90-94 36.237 38.0 38.0 38.0 34.2 38.0 95-99 36.22885000000001 38.0 38.0 38.0 34.0 38.0 100-104 36.1165 38.0 38.0 38.0 33.8 38.0 105-109 35.97935 38.0 38.0 38.0 33.8 38.0 110-114 35.725649999999995 38.0 37.6 38.0 32.6 38.0 115-119 35.67645 38.0 37.8 38.0 32.2 38.0 120-124 35.3947 38.0 37.2 38.0 31.0 38.0 125-129 35.08505 38.0 36.2 38.0 29.4 38.0 130-134 34.80165 38.0 36.0 38.0 28.2 38.0 135-139 34.47 38.0 35.4 38.0 25.8 38.0 140-144 33.93749999999999 38.0 34.4 38.0 23.2 38.0 145-149 33.263400000000004 38.0 33.4 38.0 18.2 38.0 150-151 28.7095 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 28.0 3 4.0 4 4.0 5 1.0 6 0.0 7 4.0 8 1.0 9 2.0 10 2.0 11 1.0 12 2.0 13 1.0 14 3.0 15 5.0 16 4.0 17 6.0 18 3.0 19 7.0 20 11.0 21 10.0 22 6.0 23 13.0 24 14.0 25 12.0 26 15.0 27 25.0 28 24.0 29 28.0 30 34.0 31 52.0 32 59.0 33 94.0 34 127.0 35 234.0 36 516.0 37 2648.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.6034093757834 21.684632740035095 14.113812985710705 26.598144898470792 2 26.949110052644777 27.099523690147908 27.65104036099273 18.300325896214588 3 19.38801103586657 30.122899423125155 30.147980938048658 20.34110860295962 4 23.225482819162277 33.33333333333333 23.727113117632307 19.714070729872084 5 24.94984954864594 35.05516549648947 21.639919759277834 18.35506519558676 6 22.974667669927264 36.418359668924005 22.573363431151243 18.03360922999749 7 20.24586051179127 21.751128951329655 38.68539889613648 19.317611640742598 8 23.013286537979443 25.294560040110305 26.472800200551518 25.219353221358737 9 22.336425169215342 25.444973677613437 29.355728252694913 22.86287290047631 10-14 24.255041637403433 28.679642821310324 25.2884518912411 21.77686365004515 15-19 23.48013643659711 27.593298555377206 27.372592295345104 21.553972712680576 20-24 24.134644326276714 27.84689475268386 26.818501053476474 21.19995986756296 25-29 23.99879554351099 27.923316270199738 27.090233865301617 20.98765432098765 30-34 23.51347282854132 27.8037031461689 26.985799588539315 21.697024436750464 35-39 24.246224853258415 28.32990518236091 26.553955751768427 20.86991421261225 40-44 23.81334671349724 28.314099347717008 27.13998996487707 20.73256397390868 45-49 23.913915922544398 27.856927861944413 27.14959365907495 21.07956255643624 50-54 23.88239426019768 28.011640158546985 27.37945913401234 20.726506447242986 55-59 24.31144333517283 27.246275021321427 26.970350674760446 21.471930968745298 60-64 23.752194632555806 27.67494356659142 27.715073990469026 20.857787810383748 65-69 24.09674829385789 28.141308711360903 27.10256924929747 20.65937374548374 70-74 24.282416700120432 27.850260939381776 27.338418305901246 20.52890405459655 75-79 23.877376950479153 27.575134213034968 27.825999698961418 20.72148913752446 80-84 24.286216067037987 27.82879221235386 27.056048973857195 20.82894274675097 85-89 24.65368399919695 27.64505119453925 27.128086729572377 20.573178076691427 90-94 23.80474589876085 27.31651030953695 28.099132092509908 20.779611699192294 95-99 23.966486052578766 27.528597230583983 27.734296608468796 20.770620108368455 100-104 24.324459818519077 27.48282949817015 27.48282949817015 20.70988118514062 105-109 24.29953385795198 26.610194977695357 28.013633401834493 21.076637762518168 110-114 24.16733547351525 27.593298555377206 27.944422150882826 20.29494382022472 115-119 24.295174074445672 27.47065315541286 27.831845088793017 20.40232768134845 120-124 24.386572331777813 27.633097496111198 26.905514576747454 21.074815595363543 125-129 24.826824616002412 27.532376267443027 27.030418632667402 20.610380483887162 130-134 24.96611956030718 27.646438789338955 26.958791346684734 20.428650303669126 135-139 24.82557847713698 27.214776891030468 27.716709330924054 20.2429353009085 140-144 24.328934825146757 28.23240178616226 27.37945913401234 20.05920425467864 145-149 25.33487182059901 27.35664475994582 27.487081723774644 19.821401695680528 150-151 24.97807841663535 27.796567706376045 27.583615182262307 19.641738694726293 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 10.0 1 5.0 2 0.5 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.5 21 1.5 22 1.0 23 0.5 24 0.5 25 1.5 26 2.0 27 2.0 28 3.0 29 3.0 30 6.0 31 10.5 32 19.0 33 22.5 34 23.5 35 45.5 36 63.0 37 74.5 38 118.0 39 151.5 40 188.0 41 223.0 42 230.0 43 257.0 44 284.5 45 287.0 46 286.0 47 279.5 48 251.0 49 223.5 50 197.0 51 162.0 52 133.0 53 97.0 54 77.5 55 72.5 56 50.5 57 30.5 58 22.0 59 20.0 60 15.5 61 13.0 62 10.5 63 7.5 64 5.5 65 4.0 66 3.5 67 1.5 68 0.0 69 0.5 70 1.0 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.27499999999999997 3 0.325 4 0.325 5 0.3 6 0.325 7 0.35000000000000003 8 0.27499999999999997 9 0.27499999999999997 10-14 0.33 15-19 0.32 20-24 0.33 25-29 0.37 30-34 0.35500000000000004 35-39 0.335 40-44 0.35000000000000003 45-49 0.33 50-54 0.345 55-59 0.335 60-64 0.325 65-69 0.36 70-74 0.36 75-79 0.345 80-84 0.35500000000000004 85-89 0.38 90-94 0.335 95-99 0.33999999999999997 100-104 0.265 105-109 0.245 110-114 0.32 115-119 0.33 120-124 0.35500000000000004 125-129 0.38999999999999996 130-134 0.385 135-139 0.385 140-144 0.345 145-149 0.335 150-151 0.21250000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34409687184662 98.45 2 0.5802219979818365 1.15 3 0.050454086781029264 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025227043390514632 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 10 0.25 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.425 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.65 0.0 0.0 0.0 0.0 102-103 0.8500000000000001 0.0 0.0 0.0 0.0 104-105 1.1875 0.0 0.0 0.0 0.0 106-107 1.425 0.0 0.0 0.0 0.0 108-109 1.6124999999999998 0.0 0.0 0.0 0.0 110-111 1.8 0.0 0.0 0.0 0.0 112-113 2.0250000000000004 0.0 0.0 0.0 0.0 114-115 2.3 0.0 0.0 0.0 0.0 116-117 2.5875 0.0 0.0 0.0 0.0 118-119 2.9125 0.0 0.0 0.0 0.0 120-121 3.2125 0.0 0.0 0.0 0.0 122-123 3.575 0.0 0.0 0.0 0.0 124-125 3.9375 0.0 0.0 0.0 0.0 126-127 4.325 0.0 0.0 0.0 0.0 128-129 4.7125 0.0 0.0 0.0 0.0 130-131 5.112500000000001 0.0 0.0 0.0 0.0 132-133 5.4 0.0 0.0 0.0 0.0 134-135 5.699999999999999 0.0 0.0 0.0 0.0 136-137 6.0875 0.0 0.0 0.0 0.0 138-139 6.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1306493 spots for SRR7169590.sra Written 1306493 spots for SRR7169590.sra Read 1306493 spots for SRR7169590.sra Written 1306493 spots for SRR7169590.sra Read 1306493 spots for SRR7169590.sra Written 1306493 spots for SRR7169590.sra Read 1306493 spots for SRR7169590.sra Written 1306493 spots for SRR7169590.sra Read 1306493 spots for SRR7169590.sra Written 1306493 spots for SRR7169590.sra Read 1306493 spots for SRR7169590.sra Written 1306493 spots for SRR7169590.sra Read 1306493 spots for SRR7169590.sra Written 1306493 spots for SRR7169590.sra Read 1306493 spots for SRR7169590.sra Written 1306493 spots for SRR7169590.sra Read 1306493 spots for SRR7169590.sra Written 1306493 spots for SRR7169590.sra Read 1306493 spots for SRR7169590.sra Written 1306493 spots for SRR7169590.sra Read 1306493 spots for SRR7169590.sra Written 1306493 spots for SRR7169590.sra Read 1306493 spots for SRR7169590.sra Written 1306493 spots for SRR7169590.sra Read 1306493 spots for SRR7169590.sra Written 1306493 spots for SRR7169590.sra Read 1306493 spots for SRR7169590.sra Written 1306493 spots for SRR7169590.sra Read 1306504 spots for SRR7169590.sra Written 1306504 spots for SRR7169590.sra Read 1306493 spots for SRR7169590.sra Written 1306493 spots for SRR7169590.sra Read 1306493 spots for SRR7169590.sra Written 1306493 spots for SRR7169590.sra Read 1306493 spots for SRR7169590.sra Written 1306493 spots for SRR7169590.sra Read 1306493 spots for SRR7169590.sra Written 1306493 spots for SRR7169590.sra Read 1306493 spots for SRR7169590.sra Written 1306493 spots for SRR7169590.sra SRR ids: ['SRR7169590.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yzbvavlj SRR7169590.sra spots: 26129871 blocks: [[1, 1306493], [1306494, 2612986], [2612987, 3919479], [3919480, 5225972], [5225973, 6532465], [6532466, 7838958], [7838959, 9145451], [9145452, 10451944], [10451945, 11758437], [11758438, 13064930], [13064931, 14371423], [14371424, 15677916], [15677917, 16984409], [16984410, 18290902], [18290903, 19597395], [19597396, 20903888], [20903889, 22210381], [22210382, 23516874], [23516875, 24823367], [24823368, 26129871]] SRR7169590 file size 8832855 SRR7169590 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169590 SRR7169590_1.fastq SRR7169590_2.fastq Input file: SRR7169590_1.fastq Paired file: SRR7169590_2.fastq trimmed: SRR7169590-trimmed-pair1.fastq, SRR7169590-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 08:51:42 2025 >> started Tue Feb 11 08:52:13 2025 >> done (30.446s) 26129871 read pairs processed; of these: 57223 ( 0.22%) short read pairs filtered out after trimming by size control 144366 ( 0.55%) empty read pairs filtered out after trimming by size control 25928282 (99.23%) read pairs available; of these: 12740598 (49.14%) trimmed read pairs available after processing 13187684 (50.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 8 0.00% 20 18 0.00% 21 16 0.00% 22 13 0.00% 23 11 0.00% 24 18 0.00% 25 19 0.00% 26 25 0.00% 27 30 0.00% 28 30 0.00% 29 17 0.00% 30 21 0.00% 31 24 0.00% 32 25 0.00% 33 18 0.00% 34 27 0.00% 35 37 0.00% 36 40 0.00% 37 35 0.00% 38 31 0.00% 39 32 0.00% 40 42 0.00% 41 46 0.00% 42 53 0.00% 43 49 0.00% 44 67 0.00% 45 92 0.00% 46 70 0.00% 47 89 0.00% 48 98 0.00% 49 107 0.00% 50 133 0.00% 51 143 0.00% 52 178 0.00% 53 173 0.00% 54 156 0.00% 55 236 0.00% 56 208 0.00% 57 254 0.00% 58 280 0.00% 59 267 0.00% 60 362 0.00% 61 399 0.00% 62 473 0.00% 63 552 0.00% 64 615 0.00% 65 903 0.00% 66 922 0.00% 67 1018 0.00% 68 1336 0.01% 69 2963 0.01% 70 2896 0.01% 71 1752 0.01% 72 1628 0.01% 73 1905 0.01% 74 2014 0.01% 75 2267 0.01% 76 2444 0.01% 77 2689 0.01% 78 2876 0.01% 79 3351 0.01% 80 3897 0.02% 81 4370 0.02% 82 4980 0.02% 83 5901 0.02% 84 8375 0.03% 85 10589 0.04% 86 11087 0.04% 87 11899 0.05% 88 13052 0.05% 89 13709 0.05% 90 14299 0.06% 91 14862 0.06% 92 15708 0.06% 93 17024 0.07% 94 18147 0.07% 95 19590 0.08% 96 20883 0.08% 97 21873 0.08% 98 22579 0.09% 99 23214 0.09% 100 25280 0.10% 101 26483 0.10% 102 28672 0.11% 103 30254 0.12% 104 32181 0.12% 105 34474 0.13% 106 35735 0.14% 107 36973 0.14% 108 38466 0.15% 109 40447 0.16% 110 42086 0.16% 111 43439 0.17% 112 45646 0.18% 113 49197 0.19% 114 51532 0.20% 115 54077 0.21% 116 56344 0.22% 117 58813 0.23% 118 59605 0.23% 119 61381 0.24% 120 63217 0.24% 121 64522 0.25% 122 67697 0.26% 123 71225 0.27% 124 74366 0.29% 125 77637 0.30% 126 80831 0.31% 127 84010 0.32% 128 86992 0.34% 129 89458 0.35% 130 93155 0.36% 131 96886 0.37% 132 100984 0.39% 133 106322 0.41% 134 111830 0.43% 135 119931 0.46% 136 125820 0.49% 137 133536 0.52% 138 142025 0.55% 139 149739 0.58% 140 159561 0.62% 141 171048 0.66% 142 186559 0.72% 143 205080 0.79% 144 233027 0.90% 145 269125 1.04% 146 322560 1.24% 147 422136 1.63% 148 625878 2.41% 149 1255076 4.84% 150 5786632 22.32% 151 13187684 50.86% 25928282 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.93 fanout-score-rank=31 prefix-density=0.21 prefix-fanout=2.6 sequence=CTGGCCATTCAAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=260.41 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=15.4 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCAGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTAACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTT criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=6.48 fanout-score-rank=18 prefix-density=0.45 prefix-fanout=3.8 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.10 sequence-density-rank=24 fanout-score=52.67 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=12.4 sequence=GAGAAGGCATACCATGAGCAGCTCTCTGTGGCTGAGATAACCAACAGTGCTTTTGAGCCATCATCCATGATGGCCAAGTGTGACCCACGTCATGGCAAGTACATGGCTTGCTGCCTGATGTATAGAGGTGATGTTGTGCCCAAGGATGTGAATGCAGCTGTGGCTACCATCAAGACCAAGCGCACAATCCAGTT SRR7169590 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 08:53:05 Started mapping on | Feb 11 08:53:05 Finished on | Feb 11 08:58:34 Mapping speed, Million of reads per hour | 283.71 Number of input reads | 25928282 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 23390099 Uniquely mapped reads % | 90.21% Average mapped length | 292.90 Number of splices: Total | 20009604 Number of splices: Annotated (sjdb) | 19648001 Number of splices: GT/AG | 19721435 Number of splices: GC/AG | 222693 Number of splices: AT/AC | 18612 Number of splices: Non-canonical | 46864 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 433669 % of reads mapped to multiple loci | 1.67% Number of reads mapped to too many loci | 35270 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.91% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2144764 2144764 2144764 N_multimapping 433669 433669 433669 N_noFeature 498453 23063724 630914 N_ambiguous 290026 1874 94826 UnstrandedReadsAssigned:22601620 PositiveStrandReadsAssigned:324501 NegativeStrandReadsAssigned:22664359 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169590 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169590-trimmed-pair1.fastq SRR7169590-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,928,282 reads, 22,617,611 reads pseudoaligned [quant] estimated average fragment length: 228.702 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,098 rounds 52401 SRR7169590.ke.tsv 34699 SRR7169590.se.tsv 87100 total ==> SRR7169590.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1790.3 382 8.6824 Potri.005G024800.1.v4.1 1035 807.298 28 1.41132 Potri.004G059700.1.v4.1 961 733.318 3 0.166468 Potri.007G009000.2.v4.1 1416 1188.3 0 0 Potri.003G141000.2.v4.1 2943 2715.3 307 4.60069 Potri.016G087400.1.v4.1 270 82.4709 2617 1291.23 Potri.015G069301.1.v4.1 564 339.085 0 0 Potri.010G195200.1.v4.1 1773 1545.3 47 1.23762 Potri.012G127500.1.v4.1 977 749.308 7223 392.246 ==> SRR7169590.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2267 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 491 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 45 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7169590 completed mapping pipeline successfully