Starting /dee2/code/volunteer_pipeline.sh SRR7169591 current disk space = 3055765565440 free memory = 1453569984 SRR7169591 SRAfilesize 596bbf7db31933ed6847af7b7f5f6442 SRR7169591.sra SRR7169591.sra file validated SRR7169591 is paired end SRR7169591 is conventional basespace SRR7169591 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169591_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.85475 34.0 33.0 34.0 33.0 34.0 2 33.273 34.0 33.0 34.0 33.0 34.0 3 33.419 34.0 34.0 34.0 33.0 34.0 4 33.43175 34.0 34.0 34.0 33.0 34.0 5 33.43625 34.0 34.0 34.0 33.0 34.0 6 37.1405 38.0 38.0 38.0 36.0 38.0 7 37.401 38.0 38.0 38.0 37.0 38.0 8 37.4215 38.0 38.0 38.0 37.0 38.0 9 37.48825 38.0 38.0 38.0 37.0 38.0 10-14 37.45835 38.0 38.0 38.0 37.2 38.0 15-19 37.45675 38.0 38.0 38.0 37.2 38.0 20-24 37.48774999999999 38.0 38.0 38.0 37.2 38.0 25-29 37.474000000000004 38.0 38.0 38.0 37.4 38.0 30-34 37.43085 38.0 38.0 38.0 37.2 38.0 35-39 37.34475 38.0 38.0 38.0 37.0 38.0 40-44 37.25205 38.0 38.0 38.0 36.8 38.0 45-49 37.211400000000005 38.0 38.0 38.0 36.8 38.0 50-54 37.217699999999994 38.0 38.0 38.0 36.6 38.0 55-59 37.1318 38.0 38.0 38.0 36.0 38.0 60-64 37.1307 38.0 38.0 38.0 36.0 38.0 65-69 37.01505 38.0 38.0 38.0 36.0 38.0 70-74 36.99395 38.0 38.0 38.0 36.0 38.0 75-79 36.897149999999996 38.0 38.0 38.0 36.0 38.0 80-84 36.8798 38.0 38.0 38.0 35.8 38.0 85-89 36.81325 38.0 38.0 38.0 35.4 38.0 90-94 36.73459999999999 38.0 38.0 38.0 35.2 38.0 95-99 36.625249999999994 38.0 38.0 38.0 34.6 38.0 100-104 36.46275 38.0 38.0 38.0 34.0 38.0 105-109 36.382850000000005 38.0 38.0 38.0 34.0 38.0 110-114 36.25965 38.0 38.0 38.0 34.0 38.0 115-119 36.0958 38.0 37.4 38.0 33.4 38.0 120-124 35.79495 38.0 37.0 38.0 31.8 38.0 125-129 35.7038 38.0 36.6 38.0 31.4 38.0 130-134 35.53845 38.0 36.4 38.0 31.0 38.0 135-139 35.278800000000004 38.0 36.0 38.0 30.6 38.0 140-144 34.9174 38.0 36.0 38.0 28.2 38.0 145-149 34.335150000000006 38.0 35.0 38.0 27.2 38.0 150-151 31.611375000000002 36.5 31.5 38.0 13.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 1.0 11 0.0 12 1.0 13 0.0 14 0.0 15 3.0 16 4.0 17 0.0 18 3.0 19 4.0 20 7.0 21 1.0 22 8.0 23 6.0 24 7.0 25 14.0 26 12.0 27 28.0 28 29.0 29 34.0 30 48.0 31 45.0 32 66.0 33 62.0 34 125.0 35 200.0 36 548.0 37 2743.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.282442748091604 12.391857506361323 8.21882951653944 36.10687022900763 2 23.225 14.35 35.05 27.375 3 20.1 18.85 27.125 33.925 4 22.3 27.6 24.125 25.974999999999998 5 23.849999999999998 31.574999999999996 23.875 20.7 6 17.849999999999998 35.25 25.575 21.325 7 13.950000000000001 25.775 42.25 18.025 8 17.1 25.624999999999996 31.974999999999998 25.3 9 17.0 23.849999999999998 34.025 25.124999999999996 10-14 19.814999999999998 29.675 27.49 23.02 15-19 20.055 28.395 27.605 23.945 20-24 20.07 28.34 28.194999999999997 23.395 25-29 19.6 28.89 27.500000000000004 24.01 30-34 19.869999999999997 28.349999999999998 27.560000000000002 24.22 35-39 20.235 27.815 27.950000000000003 24.0 40-44 20.06 28.895 27.235 23.810000000000002 45-49 20.165 28.59 27.644999999999996 23.599999999999998 50-54 20.05 28.134999999999998 27.97 23.845 55-59 20.419999999999998 28.449999999999996 27.72 23.41 60-64 20.244999999999997 28.904999999999998 26.915 23.935000000000002 65-69 20.145 28.73 27.295 23.830000000000002 70-74 20.16 28.144999999999996 27.515 24.18 75-79 20.1 28.560000000000002 27.83 23.51 80-84 20.595 28.494999999999997 27.025 23.885 85-89 20.599999999999998 28.09 27.07 24.240000000000002 90-94 20.52 28.075 27.200000000000003 24.205 95-99 19.945 28.38 27.67 24.005000000000003 100-104 20.625 28.689999999999998 27.185 23.5 105-109 20.325 27.88 27.93 23.865 110-114 20.765 28.64 27.060000000000002 23.535 115-119 20.5 28.29 27.125 24.085 120-124 20.915 28.265 27.11 23.71 125-129 21.02 27.62 27.33 24.03 130-134 20.9 27.500000000000004 26.97 24.63 135-139 21.415 28.044999999999998 26.784999999999997 23.755000000000003 140-144 20.555 27.82 26.950000000000003 24.675 145-149 20.8 28.28 26.474999999999998 24.445 150-151 20.9375 28.075 25.825 25.162499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 1.0 19 1.0 20 0.5 21 0.5 22 1.0 23 2.0 24 2.0 25 2.0 26 3.0 27 4.5 28 7.0 29 10.5 30 17.0 31 22.5 32 28.5 33 40.0 34 48.0 35 69.5 36 87.5 37 101.0 38 128.0 39 153.0 40 186.0 41 214.0 42 237.0 43 253.0 44 270.5 45 265.0 46 253.0 47 267.5 48 254.0 49 218.0 50 186.5 51 149.0 52 118.0 53 98.5 54 83.5 55 60.5 56 39.0 57 33.0 58 21.0 59 15.0 60 13.0 61 9.0 62 7.0 63 4.0 64 2.5 65 2.5 66 1.0 67 1.5 68 2.5 69 1.5 70 0.5 71 0.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62339944765253 99.2 2 0.3263871453678132 0.65 3 0.05021340697966357 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.8125 0.0 0.0 0.0 0.0 102-103 0.8999999999999999 0.0 0.0 0.0 0.0 104-105 1.1125 0.0 0.0 0.0 0.0 106-107 1.2625000000000002 0.0 0.0 0.0 0.0 108-109 1.425 0.0 0.0 0.0 0.0 110-111 1.6375000000000002 0.0 0.0 0.0 0.0 112-113 1.95 0.0 0.0 0.0 0.0 114-115 2.2750000000000004 0.0 0.0 0.0 0.0 116-117 2.55 0.0 0.0 0.0 0.0 118-119 2.7750000000000004 0.0 0.0 0.0 0.0 120-121 3.2874999999999996 0.0 0.0 0.0 0.0 122-123 3.6625 0.0 0.0 0.0 0.0 124-125 3.95 0.0 0.0 0.0 0.0 126-127 4.275 0.0 0.0 0.0 0.0 128-129 4.6875 0.0 0.0 0.0 0.0 130-131 5.1875 0.0 0.0 0.0 0.0 132-133 5.5625 0.0 0.0 0.0 0.0 134-135 5.85 0.0 0.0 0.0 0.0 136-137 6.237500000000001 0.0 0.0 0.0 0.0 138-139 6.7125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCATAA 10 0.0060887975 150.61038 1 CAACTCA 10 0.006836113 144.9625 5 >>END_MODULE SRR7169591 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169591_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.80925 33.0 33.0 34.0 32.0 34.0 2 32.8825 34.0 33.0 34.0 32.0 34.0 3 32.949 34.0 33.0 34.0 32.0 34.0 4 32.91575 34.0 33.0 34.0 32.0 34.0 5 32.88625 34.0 33.0 34.0 32.0 34.0 6 37.0415 38.0 38.0 38.0 37.0 38.0 7 37.0265 38.0 38.0 38.0 37.0 38.0 8 37.01425 38.0 38.0 38.0 37.0 38.0 9 37.035 38.0 38.0 38.0 37.0 38.0 10-14 37.0156 38.0 38.0 38.0 37.0 38.0 15-19 36.9528 38.0 38.0 38.0 36.8 38.0 20-24 36.87215 38.0 38.0 38.0 36.2 38.0 25-29 36.9114 38.0 38.0 38.0 36.2 38.0 30-34 36.8307 38.0 38.0 38.0 36.0 38.0 35-39 36.8079 38.0 38.0 38.0 36.0 38.0 40-44 36.82515 38.0 38.0 38.0 36.0 38.0 45-49 36.85625 38.0 38.0 38.0 36.0 38.0 50-54 36.8672 38.0 38.0 38.0 36.4 38.0 55-59 36.72795 38.0 38.0 38.0 36.0 38.0 60-64 36.66515 38.0 38.0 38.0 36.0 38.0 65-69 36.6202 38.0 38.0 38.0 35.8 38.0 70-74 36.48515 38.0 38.0 38.0 35.2 38.0 75-79 36.4114 38.0 38.0 38.0 34.6 38.0 80-84 36.3217 38.0 38.0 38.0 34.4 38.0 85-89 36.18175 38.0 38.0 38.0 34.0 38.0 90-94 36.151300000000006 38.0 38.0 38.0 34.0 38.0 95-99 36.08624999999999 38.0 38.0 38.0 33.8 38.0 100-104 35.978300000000004 38.0 38.0 38.0 33.4 38.0 105-109 35.9301 38.0 38.0 38.0 33.6 38.0 110-114 35.6477 38.0 37.6 38.0 31.8 38.0 115-119 35.467150000000004 38.0 37.0 38.0 31.0 38.0 120-124 35.215 38.0 37.0 38.0 29.2 38.0 125-129 34.99255 38.0 36.2 38.0 28.2 38.0 130-134 34.79235 38.0 36.0 38.0 27.8 38.0 135-139 34.28535000000001 38.0 35.2 38.0 24.0 38.0 140-144 33.96315 38.0 35.0 38.0 23.0 38.0 145-149 33.429199999999994 38.0 34.6 38.0 18.4 38.0 150-151 30.1325 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 3.0 4 3.0 5 4.0 6 1.0 7 2.0 8 1.0 9 3.0 10 0.0 11 2.0 12 3.0 13 2.0 14 1.0 15 5.0 16 4.0 17 5.0 18 7.0 19 7.0 20 10.0 21 8.0 22 9.0 23 11.0 24 16.0 25 22.0 26 25.0 27 25.0 28 30.0 29 32.0 30 51.0 31 54.0 32 65.0 33 83.0 34 116.0 35 215.0 36 501.0 37 2654.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.639188173390124 22.67602104735655 11.400651465798045 26.284139313455274 2 26.591478696741856 26.917293233082706 30.15037593984962 16.340852130325814 3 19.403359237904237 29.957382802707443 31.085485083980945 19.553772875407372 4 23.458646616541355 33.53383458646616 24.160401002506266 18.847117794486216 5 23.909774436090224 36.19047619047619 22.681704260651628 17.218045112781954 6 21.759839558786666 37.17723740285786 23.263975933818 17.798947104537476 7 19.90972918756269 22.642928786359075 36.86058174523571 20.58676028084253 8 20.526315789473685 26.71679197994987 27.142857142857142 25.6140350877193 9 20.676691729323306 24.586466165413533 31.629072681704262 23.107769423558896 10-14 22.76190476190476 28.69172932330827 26.551378446115287 21.994987468671678 15-19 23.003659331294802 27.254498972379572 28.09664644844353 21.6451952478821 20-24 22.821618369597914 27.67973528527023 27.774992479695175 21.723653865436678 25-29 23.02215983154517 28.135967111200237 27.3638824827033 21.47799057455129 30-34 22.6265664160401 27.884711779448622 28.115288220551378 21.3734335839599 35-39 22.779225987567674 28.27351112893523 27.927611790655703 21.01965109284139 40-44 23.127819548872182 28.731829573934835 27.408521303258144 20.73182957393484 45-49 22.832080200501252 28.426065162907264 27.859649122807017 20.88220551378446 50-54 22.50125313283208 28.54636591478697 27.839598997493738 21.112781954887218 55-59 23.398496240601503 27.984962406015036 27.88972431077694 20.726817042606516 60-64 23.794486215538846 27.87468671679198 27.729323308270676 20.601503759398497 65-69 23.20032083416884 28.193302586725487 27.89753358732705 20.708842991778624 70-74 23.52970669340687 27.525695663073453 28.172474304336927 20.772123339182752 75-79 23.474860895282973 27.089077146724144 28.342272795628855 21.09378916236403 80-84 23.58131140966513 27.90755965510327 28.072989773410868 20.438139161820736 85-89 23.57364885190013 27.594505163942646 28.125940038102875 20.705905946054344 90-94 23.972328052937637 27.220774012432326 28.13815921395629 20.66873872067375 95-99 23.35338345864662 27.45363408521303 28.676691729323306 20.516290726817044 100-104 24.117882919005613 27.596230954290295 27.731555733761027 20.55433039294306 105-109 23.959899749373434 27.869674185463662 27.343358395989974 20.827067669172934 110-114 24.220551378446114 27.518796992481203 27.69924812030075 20.56140350877193 115-119 24.40344896731502 27.67194706236214 27.611790655704834 20.312813314618005 120-124 24.30318828955284 28.27852416282334 27.551634249047524 19.8666532985763 125-129 24.136375031336176 27.831536725996493 27.1346202055653 20.89746803710203 130-134 24.88340604784113 28.0577704227471 27.11498921819367 19.943834311218094 135-139 24.706708111902138 27.64464052942946 27.529329188809786 20.11932216985862 140-144 24.8345698816924 27.72709043513134 27.411269300180468 20.02707038299579 145-149 24.962406015037594 28.857142857142858 26.776942355889727 19.403508771929825 150-151 25.215867851332753 27.856338380678263 27.155549993742962 19.772243774246025 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 10.0 1 5.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.5 25 2.5 26 1.0 27 2.0 28 4.0 29 7.0 30 13.5 31 21.0 32 21.0 33 31.0 34 46.0 35 58.5 36 89.5 37 119.5 38 145.0 39 157.5 40 176.5 41 216.0 42 265.0 43 303.5 44 294.0 45 271.5 46 274.0 47 254.0 48 220.0 49 196.5 50 169.5 51 151.0 52 119.5 53 85.5 54 70.5 55 51.5 56 34.0 57 27.5 58 23.0 59 18.0 60 11.5 61 11.0 62 8.0 63 4.0 64 3.5 65 2.5 66 1.0 67 0.5 68 1.0 69 1.0 70 0.5 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.25 3 0.27499999999999997 4 0.25 5 0.25 6 0.27499999999999997 7 0.3 8 0.25 9 0.25 10-14 0.25 15-19 0.255 20-24 0.27 25-29 0.27 30-34 0.25 35-39 0.26 40-44 0.25 45-49 0.25 50-54 0.25 55-59 0.25 60-64 0.25 65-69 0.26 70-74 0.27499999999999997 75-79 0.255 80-84 0.26 85-89 0.27 90-94 0.26 95-99 0.25 100-104 0.24 105-109 0.25 110-114 0.25 115-119 0.26 120-124 0.26 125-129 0.27499999999999997 130-134 0.295 135-139 0.27 140-144 0.26 145-149 0.25 150-151 0.11249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47076612903226 98.675 2 0.4032258064516129 0.8 3 0.10080645161290322 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025201612903225805 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.5875 0.0 0.0 0.0 0.0 100-101 0.8125 0.0 0.0 0.0 0.0 102-103 0.8999999999999999 0.0 0.0 0.0 0.0 104-105 1.1125 0.0 0.0 0.0 0.0 106-107 1.2625000000000002 0.0 0.0 0.0 0.0 108-109 1.425 0.0 0.0 0.0 0.0 110-111 1.6375000000000002 0.0 0.0 0.0 0.0 112-113 1.925 0.0 0.0 0.0 0.0 114-115 2.2249999999999996 0.0 0.0 0.0 0.0 116-117 2.4875 0.0 0.0 0.0 0.0 118-119 2.7 0.0 0.0 0.0 0.0 120-121 3.1624999999999996 0.0 0.0 0.0 0.0 122-123 3.55 0.0 0.0 0.0 0.0 124-125 3.875 0.0 0.0 0.0 0.0 126-127 4.2 0.0 0.0 0.0 0.0 128-129 4.5875 0.0 0.0 0.0 0.0 130-131 5.112500000000001 0.0 0.0 0.0 0.0 132-133 5.475 0.0 0.0 0.0 0.0 134-135 5.762499999999999 0.0 0.0 0.0 0.0 136-137 6.137499999999999 0.0 0.0 0.0 0.0 138-139 6.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTCCC 10 0.006830828 145.0 4 AGTTTCC 10 0.006830828 145.0 3 >>END_MODULE Read 921720 spots for SRR7169591.sra Written 921720 spots for SRR7169591.sra Read 921720 spots for SRR7169591.sra Written 921720 spots for SRR7169591.sra Read 921720 spots for SRR7169591.sra Written 921720 spots for SRR7169591.sra Read 921720 spots for SRR7169591.sra Written 921720 spots for SRR7169591.sra Read 921720 spots for SRR7169591.sra Written 921720 spots for SRR7169591.sra Read 921720 spots for SRR7169591.sra Written 921720 spots for SRR7169591.sra Read 921720 spots for SRR7169591.sra Written 921720 spots for SRR7169591.sra Read 921720 spots for SRR7169591.sra Written 921720 spots for SRR7169591.sra Read 921720 spots for SRR7169591.sra Written 921720 spots for SRR7169591.sra Read 921720 spots for SRR7169591.sra Written 921720 spots for SRR7169591.sra Read 921720 spots for SRR7169591.sra Written 921720 spots for SRR7169591.sra Read 921720 spots for SRR7169591.sra Written 921720 spots for SRR7169591.sra Read 921737 spots for SRR7169591.sra Written 921737 spots for SRR7169591.sra Read 921720 spots for SRR7169591.sra Written 921720 spots for SRR7169591.sra Read 921720 spots for SRR7169591.sra Written 921720 spots for SRR7169591.sra Read 921720 spots for SRR7169591.sra Written 921720 spots for SRR7169591.sra Read 921720 spots for SRR7169591.sra Written 921720 spots for SRR7169591.sra Read 921720 spots for SRR7169591.sra Written 921720 spots for SRR7169591.sra Read 921720 spots for SRR7169591.sra Written 921720 spots for SRR7169591.sra Read 921720 spots for SRR7169591.sra Written 921720 spots for SRR7169591.sra SRR ids: ['SRR7169591.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jhohsw8q SRR7169591.sra spots: 18434417 blocks: [[1, 921720], [921721, 1843440], [1843441, 2765160], [2765161, 3686880], [3686881, 4608600], [4608601, 5530320], [5530321, 6452040], [6452041, 7373760], [7373761, 8295480], [8295481, 9217200], [9217201, 10138920], [10138921, 11060640], [11060641, 11982360], [11982361, 12904080], [12904081, 13825800], [13825801, 14747520], [14747521, 15669240], [15669241, 16590960], [16590961, 17512680], [17512681, 18434417]] SRR7169591 file size 6225118 SRR7169591 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169591 SRR7169591_1.fastq SRR7169591_2.fastq Input file: SRR7169591_1.fastq Paired file: SRR7169591_2.fastq trimmed: SRR7169591-trimmed-pair1.fastq, SRR7169591-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 08:13:37 2025 >> started Tue Feb 11 08:14:04 2025 >> done (27.242s) 18434417 read pairs processed; of these: 19320 ( 0.10%) short read pairs filtered out after trimming by size control 87404 ( 0.47%) empty read pairs filtered out after trimming by size control 18327693 (99.42%) read pairs available; of these: 8044467 (43.89%) trimmed read pairs available after processing 10283226 (56.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 2 0.00% 20 7 0.00% 21 5 0.00% 22 9 0.00% 23 13 0.00% 24 5 0.00% 25 6 0.00% 26 10 0.00% 27 8 0.00% 28 4 0.00% 29 7 0.00% 30 7 0.00% 31 9 0.00% 32 10 0.00% 33 8 0.00% 34 14 0.00% 35 15 0.00% 36 12 0.00% 37 24 0.00% 38 11 0.00% 39 26 0.00% 40 17 0.00% 41 26 0.00% 42 26 0.00% 43 26 0.00% 44 30 0.00% 45 30 0.00% 46 34 0.00% 47 46 0.00% 48 47 0.00% 49 56 0.00% 50 71 0.00% 51 69 0.00% 52 82 0.00% 53 85 0.00% 54 102 0.00% 55 110 0.00% 56 120 0.00% 57 135 0.00% 58 138 0.00% 59 162 0.00% 60 211 0.00% 61 221 0.00% 62 265 0.00% 63 269 0.00% 64 324 0.00% 65 353 0.00% 66 379 0.00% 67 492 0.00% 68 654 0.00% 69 848 0.00% 70 849 0.00% 71 832 0.00% 72 881 0.00% 73 1000 0.01% 74 1173 0.01% 75 1251 0.01% 76 1403 0.01% 77 1564 0.01% 78 1799 0.01% 79 1939 0.01% 80 2253 0.01% 81 2509 0.01% 82 2876 0.02% 83 3233 0.02% 84 4252 0.02% 85 5031 0.03% 86 5431 0.03% 87 5894 0.03% 88 6257 0.03% 89 6645 0.04% 90 7246 0.04% 91 7741 0.04% 92 8319 0.05% 93 9115 0.05% 94 9770 0.05% 95 10553 0.06% 96 11418 0.06% 97 11985 0.07% 98 12364 0.07% 99 13158 0.07% 100 14137 0.08% 101 14952 0.08% 102 16087 0.09% 103 17097 0.09% 104 18253 0.10% 105 19284 0.11% 106 20289 0.11% 107 20991 0.11% 108 21995 0.12% 109 22981 0.13% 110 23534 0.13% 111 24990 0.14% 112 26328 0.14% 113 28194 0.15% 114 29321 0.16% 115 30740 0.17% 116 31911 0.17% 117 33460 0.18% 118 34739 0.19% 119 35202 0.19% 120 37060 0.20% 121 38323 0.21% 122 40256 0.22% 123 42430 0.23% 124 44278 0.24% 125 46534 0.25% 126 48253 0.26% 127 50230 0.27% 128 52087 0.28% 129 54294 0.30% 130 56144 0.31% 131 58774 0.32% 132 61354 0.33% 133 65279 0.36% 134 68602 0.37% 135 73117 0.40% 136 77042 0.42% 137 81003 0.44% 138 85292 0.47% 139 90996 0.50% 140 95603 0.52% 141 103601 0.57% 142 113135 0.62% 143 125010 0.68% 144 142234 0.78% 145 166960 0.91% 146 199716 1.09% 147 262840 1.43% 148 387789 2.12% 149 755579 4.12% 150 3871777 21.13% 151 10283226 56.11% 18327693 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=10.63 fanout-score-rank=13 prefix-density=0.35 prefix-fanout=6.2 sequence=CAACCTCAACAGTGGCCATTGGAACTAGAAGGAAAATAAAGCACAGCTGGGATACAAAAGAAAACTG criterion=fanout-score sequence-density=0.05 sequence-density-rank=37 fanout-score=122.28 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=18.0 sequence=TTCTCTTCTTCAGTCTTGGGGTGGTACCCAGGTAACTTCTCCTTGATCTTCTCGAGTAGTCCCTTCTTCTCCTTGGCATCTCCTTCATGGGAAACTGCAGCTTCAGGGGAAACATGTTCAGGAGCTGGAGGAGGGACCTCGTCAGCTTTCTTATGTCCTGGCAATTTCTCCTTGATTTTGTCAAGGAAACCCTTCTTATCCTCTGGTTCATGGGGTGTCTCTGTATGGACTACCTCGACAGGAACACTAGTATCCTCGTGTTCCTTCTCCT criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=34 prefix-density=0.36 prefix-fanout=2.1 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.10 sequence-density-rank=28 fanout-score=233.92 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=26.3 sequence=GAAGAAGAAGAAA SRR7169591 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 08:14:47 Started mapping on | Feb 11 08:14:47 Finished on | Feb 11 08:16:33 Mapping speed, Million of reads per hour | 622.45 Number of input reads | 18327693 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 17485332 Uniquely mapped reads % | 95.40% Average mapped length | 294.15 Number of splices: Total | 17802824 Number of splices: Annotated (sjdb) | 17510030 Number of splices: GT/AG | 17541817 Number of splices: GC/AG | 211528 Number of splices: AT/AC | 14352 Number of splices: Non-canonical | 35127 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 327278 % of reads mapped to multiple loci | 1.79% Number of reads mapped to too many loci | 90443 % of reads mapped to too many loci | 0.49% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.24% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 531355 531355 531355 N_multimapping 327278 327278 327278 N_noFeature 369598 17314085 459015 N_ambiguous 151865 1024 69248 UnstrandedReadsAssigned:16963869 PositiveStrandReadsAssigned:170223 NegativeStrandReadsAssigned:16957069 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169591 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169591-trimmed-pair1.fastq SRR7169591-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,327,693 reads, 16,868,730 reads pseudoaligned [quant] estimated average fragment length: 240.986 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,098 rounds 52401 SRR7169591.ke.tsv 34699 SRR7169591.se.tsv 87100 total ==> SRR7169591.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.01 378 12.5232 Potri.005G024800.1.v4.1 1035 795.014 47 3.48243 Potri.004G059700.1.v4.1 961 721.092 6 0.490139 Potri.007G009000.2.v4.1 1416 1176.01 0 0 Potri.003G141000.2.v4.1 2943 2703.01 334.064 7.28016 Potri.016G087400.1.v4.1 270 81.7016 2060 1485.24 Potri.015G069301.1.v4.1 564 330.346 0 0 Potri.010G195200.1.v4.1 1773 1533.01 34 1.30645 Potri.012G127500.1.v4.1 977 737.059 5088 406.634 ==> SRR7169591.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 736 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 249 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7169591 completed mapping pipeline successfully