Starting /dee2/code/volunteer_pipeline.sh SRR7169592 current disk space = 3055452626944 free memory = 1571741876 SRR7169592 SRAfilesize d5bbb5080a5862d7880fac32dfb1b20e SRR7169592.sra SRR7169592.sra file validated SRR7169592 is paired end SRR7169592 is conventional basespace SRR7169592 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169592_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.906 34.0 33.0 34.0 33.0 34.0 2 33.3565 34.0 33.0 34.0 33.0 34.0 3 33.456 34.0 34.0 34.0 33.0 34.0 4 33.4825 34.0 34.0 34.0 33.0 34.0 5 33.45975 34.0 34.0 34.0 33.0 34.0 6 37.01075 38.0 37.0 38.0 36.0 38.0 7 37.295 38.0 38.0 38.0 36.0 38.0 8 37.38075 38.0 38.0 38.0 37.0 38.0 9 37.517 38.0 38.0 38.0 37.0 38.0 10-14 37.4885 38.0 38.0 38.0 37.2 38.0 15-19 37.46725 38.0 38.0 38.0 37.2 38.0 20-24 37.4495 38.0 38.0 38.0 37.0 38.0 25-29 37.413349999999994 38.0 38.0 38.0 37.0 38.0 30-34 37.41015 38.0 38.0 38.0 37.0 38.0 35-39 37.1699 38.0 38.0 38.0 36.4 38.0 40-44 37.26225 38.0 38.0 38.0 37.0 38.0 45-49 37.244949999999996 38.0 38.0 38.0 36.4 38.0 50-54 37.156150000000004 38.0 38.0 38.0 36.0 38.0 55-59 37.1856 38.0 38.0 38.0 36.0 38.0 60-64 37.10955 38.0 38.0 38.0 36.0 38.0 65-69 37.0025 38.0 38.0 38.0 35.8 38.0 70-74 36.93825 38.0 38.0 38.0 35.6 38.0 75-79 36.924850000000006 38.0 38.0 38.0 35.4 38.0 80-84 36.79045 38.0 38.0 38.0 35.0 38.0 85-89 36.71470000000001 38.0 38.0 38.0 34.6 38.0 90-94 36.65445 38.0 38.0 38.0 34.2 38.0 95-99 36.422850000000004 38.0 37.8 38.0 34.0 38.0 100-104 36.2664 38.0 37.0 38.0 33.6 38.0 105-109 36.116550000000004 38.0 37.0 38.0 33.0 38.0 110-114 35.830799999999996 38.0 37.0 38.0 31.4 38.0 115-119 35.62555 38.0 36.4 38.0 30.6 38.0 120-124 35.340250000000005 38.0 36.0 38.0 29.8 38.0 125-129 34.9717 38.0 35.2 38.0 27.8 38.0 130-134 34.774 38.0 35.0 38.0 27.2 38.0 135-139 34.26885 38.0 34.8 38.0 24.8 38.0 140-144 33.52765000000001 38.0 34.0 38.0 21.8 38.0 145-149 32.55265 37.8 33.2 38.0 14.0 38.0 150-151 28.677 36.0 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 1.0 17 2.0 18 1.0 19 5.0 20 4.0 21 4.0 22 6.0 23 6.0 24 11.0 25 16.0 26 31.0 27 29.0 28 29.0 29 30.0 30 48.0 31 56.0 32 82.0 33 96.0 34 160.0 35 339.0 36 854.0 37 2189.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.35708851128582 12.22419477555161 7.60841998478316 35.810296728379406 2 23.925 13.325000000000001 32.7 30.049999999999997 3 20.075000000000003 18.825 25.6 35.5 4 23.05 27.875 23.200000000000003 25.874999999999996 5 22.275 32.2 23.974999999999998 21.55 6 19.925 34.325 24.45 21.3 7 13.750000000000002 26.450000000000003 41.4 18.4 8 17.075000000000003 25.95 31.474999999999998 25.5 9 17.424999999999997 24.525 33.575 24.474999999999998 10-14 19.35 29.87 27.065 23.715 15-19 19.835 28.705000000000002 27.495000000000005 23.965 20-24 20.19 28.715000000000003 27.93 23.165 25-29 19.975 29.815 27.025 23.185 30-34 19.62 29.270000000000003 27.334999999999997 23.775 35-39 19.799949987496873 28.747186796699175 27.44186046511628 24.01100275068767 40-44 19.63 29.285 27.185 23.9 45-49 19.564999999999998 29.044999999999998 27.21 24.18 50-54 19.71 29.080000000000002 27.750000000000004 23.46 55-59 19.955000000000002 28.43 27.295 24.32 60-64 20.05 28.994999999999997 27.22 23.735 65-69 20.255000000000003 28.555000000000003 27.224999999999998 23.965 70-74 19.71 28.754999999999995 27.889999999999997 23.645 75-79 20.064999999999998 28.194999999999997 27.77 23.97 80-84 20.095 28.465 27.084999999999997 24.355 85-89 19.919999999999998 28.26 27.48 24.34 90-94 20.11 29.049999999999997 26.85 23.990000000000002 95-99 20.34 28.615000000000002 27.36 23.685000000000002 100-104 20.34 28.115000000000002 27.46 24.085 105-109 20.265 28.7 27.065 23.97 110-114 20.19 28.59 27.465 23.755000000000003 115-119 20.46102305115256 28.691434571728585 27.38136906845342 23.466173308665432 120-124 20.75 28.294999999999998 27.295 23.66 125-129 20.91 28.59 26.905 23.595 130-134 20.7 28.754999999999995 26.86 23.685000000000002 135-139 20.875 28.494999999999997 26.779999999999998 23.849999999999998 140-144 21.17 28.24 27.025 23.565 145-149 20.674999999999997 28.78 26.77 23.775 150-151 21.0125 28.675 26.137500000000003 24.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.5 25 3.0 26 3.5 27 7.0 28 12.0 29 12.0 30 18.0 31 25.0 32 35.0 33 47.5 34 50.5 35 62.0 36 86.0 37 106.0 38 136.5 39 160.5 40 193.0 41 219.5 42 228.0 43 257.5 44 255.5 45 249.0 46 269.5 47 257.5 48 232.5 49 220.5 50 181.5 51 147.5 52 128.0 53 101.5 54 76.5 55 57.0 56 43.5 57 29.5 58 22.0 59 20.5 60 14.0 61 5.0 62 4.0 63 4.5 64 2.5 65 2.0 66 2.5 67 2.5 68 2.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.425 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.025 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54796584630839 99.1 2 0.45203415369161226 0.8999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.6 0.0 0.0 0.0 0.0 100-101 0.7125 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.175 0.0 0.0 0.0 0.0 106-107 1.325 0.0 0.0 0.0 0.0 108-109 1.7 0.0 0.0 0.0 0.0 110-111 1.9625 0.0 0.0 0.0 0.0 112-113 2.2375 0.0 0.0 0.0 0.0 114-115 2.4749999999999996 0.0 0.0 0.0 0.0 116-117 2.675 0.0 0.0 0.0 0.0 118-119 3.0 0.0 0.0 0.0 0.0 120-121 3.2875 0.0 0.0 0.0 0.0 122-123 3.5374999999999996 0.0 0.0 0.0 0.0 124-125 3.9875 0.0 0.0 0.0 0.0 126-127 4.5125 0.0 0.0 0.0 0.0 128-129 4.85 0.0 0.0 0.0 0.0 130-131 5.225 0.0 0.0 0.0 0.0 132-133 5.5875 0.0 0.0 0.0 0.0 134-135 6.0125 0.0 0.0 0.0 0.0 136-137 6.45 0.0 0.0 0.0 0.0 138-139 6.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCGGCAA 10 0.0068343505 144.975 145 >>END_MODULE SRR7169592 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169592_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8685 33.0 33.0 34.0 32.0 34.0 2 32.986 33.0 33.0 34.0 32.0 34.0 3 33.01975 34.0 33.0 34.0 32.0 34.0 4 32.992 34.0 33.0 34.0 32.0 34.0 5 32.92975 34.0 33.0 34.0 32.0 34.0 6 37.0335 38.0 38.0 38.0 37.0 38.0 7 37.0485 38.0 38.0 38.0 37.0 38.0 8 37.04675 38.0 38.0 38.0 37.0 38.0 9 37.058 38.0 38.0 38.0 37.0 38.0 10-14 36.98945 38.0 38.0 38.0 36.8 38.0 15-19 36.971050000000005 38.0 38.0 38.0 36.6 38.0 20-24 36.90205 38.0 38.0 38.0 36.4 38.0 25-29 36.918 38.0 38.0 38.0 36.2 38.0 30-34 36.786449999999995 38.0 38.0 38.0 36.0 38.0 35-39 36.77155 38.0 38.0 38.0 35.8 38.0 40-44 36.8335 38.0 38.0 38.0 36.0 38.0 45-49 36.82385000000001 38.0 38.0 38.0 36.0 38.0 50-54 36.844550000000005 38.0 38.0 38.0 36.0 38.0 55-59 36.5747 38.0 38.0 38.0 35.0 38.0 60-64 36.692600000000006 38.0 38.0 38.0 35.8 38.0 65-69 36.6534 38.0 38.0 38.0 35.6 38.0 70-74 36.55925 38.0 38.0 38.0 34.8 38.0 75-79 36.591 38.0 38.0 38.0 34.8 38.0 80-84 36.371399999999994 38.0 38.0 38.0 34.4 38.0 85-89 36.275400000000005 38.0 38.0 38.0 34.0 38.0 90-94 36.2051 38.0 38.0 38.0 34.0 38.0 95-99 36.2333 38.0 38.0 38.0 34.0 38.0 100-104 36.06465000000001 38.0 38.0 38.0 33.6 38.0 105-109 35.92345 38.0 38.0 38.0 33.0 38.0 110-114 35.82645 38.0 37.6 38.0 32.4 38.0 115-119 35.6582 38.0 37.0 38.0 31.4 38.0 120-124 35.4354 38.0 36.8 38.0 31.0 38.0 125-129 35.064550000000004 38.0 36.0 38.0 28.8 38.0 130-134 34.89545 38.0 36.0 38.0 28.0 38.0 135-139 34.4148 38.0 35.6 38.0 25.6 38.0 140-144 33.814800000000005 38.0 35.0 38.0 22.2 38.0 145-149 33.3575 38.0 34.6 38.0 18.2 38.0 150-151 29.649500000000003 36.5 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 16.0 4 2.0 5 0.0 6 2.0 7 0.0 8 1.0 9 2.0 10 0.0 11 1.0 12 1.0 13 3.0 14 2.0 15 3.0 16 3.0 17 6.0 18 9.0 19 9.0 20 4.0 21 7.0 22 11.0 23 10.0 24 14.0 25 13.0 26 22.0 27 23.0 28 34.0 29 32.0 30 42.0 31 70.0 32 89.0 33 77.0 34 135.0 35 222.0 36 552.0 37 2574.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.375 24.025 10.925 24.675 2 28.675 25.35 29.225 16.75 3 20.325 28.799999999999997 31.75 19.125 4 23.75 33.875 23.225 19.15 5 24.075 37.15 21.875 16.900000000000002 6 22.880080280983442 37.38083291520321 21.1490215755143 18.590065228299046 7 19.1921726041144 23.03060712493728 38.96136477671852 18.815855494229805 8 22.353236327145005 26.593075765178124 26.793778223783242 24.25990968389363 9 19.919719016557952 26.96939287506272 30.431510286001 22.679377822378324 10-14 23.952636596257086 28.74416737745221 26.024785510009536 21.27841051628117 15-19 23.601424915960063 27.740705433746427 27.369424514575286 21.288445135718227 20-24 23.09969394410717 28.719080828859568 27.193818674426772 20.98740655260649 25-29 23.395715217500378 28.433094174903417 27.565099593597914 20.60609101399829 30-34 23.391871550426494 27.937782237832415 27.937782237832415 20.73256397390868 35-39 23.317778112298658 28.51623262582167 27.43238496663154 20.73360429524813 40-44 23.200401304238778 27.47930775018811 28.48758465011287 20.832706295460245 45-49 23.44651186117659 27.20798435227444 28.075630673554343 21.269873112994635 50-54 23.73671546019651 27.867455383998397 28.017846400641666 20.377982755163426 55-59 23.687772597383063 27.48282949817015 28.45039354288865 20.379004361558128 60-64 23.431780574637717 27.708970566113422 28.441057012485583 20.418191846763275 65-69 24.660281803138943 27.568570425713286 27.157398585970014 20.613749185177756 70-74 23.926565008025683 27.743780096308186 27.879213483146064 20.450441412520064 75-79 23.342361320092287 27.53034406660648 28.86949543585114 20.257799177450096 80-84 24.012646158478447 28.017263009986447 27.600742710894764 20.36934812064034 85-89 23.776539677759374 28.288912312402754 27.636400140541085 20.29814786929679 90-94 24.016459253311922 27.408671216378966 28.096146126053796 20.47872340425532 95-99 23.970507097356673 27.551788132617745 27.51667753423283 20.96102723579275 100-104 23.698726306288236 28.261959683080935 27.38942934510079 20.64988466553004 105-109 23.463659147869677 27.94486215538847 28.095238095238095 20.49624060150376 110-114 23.987164059366226 27.7426795026073 27.707581227436823 20.56257521058965 115-119 24.59756281029036 27.94744496263979 27.415876836668176 20.039115390401683 120-124 23.943238228952517 27.34794163365592 28.00982800982801 20.698992127563557 125-129 24.514770048648376 27.438687998395107 27.438687998395107 20.60785395456141 130-134 24.67024424494709 28.05055419028035 27.16786197903606 20.111339585736495 135-139 24.37421620265864 27.93077501881114 27.63982944569852 20.055179332831703 140-144 24.910996339567767 28.581457152885726 26.74121245549817 19.766334052048336 145-149 25.062656641604008 28.350877192982455 26.591478696741856 19.99498746867168 150-151 24.25531914893617 27.521902377972467 27.709637046307883 20.51314142678348 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 3.5 3 4.5 4 1.5 5 0.5 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.0 25 1.0 26 0.5 27 3.0 28 5.0 29 5.5 30 9.5 31 14.5 32 21.0 33 27.5 34 39.5 35 59.5 36 70.0 37 103.0 38 140.0 39 161.5 40 211.0 41 229.0 42 248.0 43 278.5 44 285.0 45 286.0 46 279.5 47 259.0 48 240.0 49 219.5 50 181.0 51 147.5 52 118.5 53 87.5 54 62.0 55 46.5 56 33.0 57 26.0 58 22.0 59 17.0 60 9.5 61 7.5 62 6.5 63 7.5 64 6.0 65 2.0 66 1.0 67 0.5 68 1.0 69 1.0 70 0.5 71 0.5 72 0.5 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.35000000000000003 7 0.35000000000000003 8 0.35000000000000003 9 0.35000000000000003 10-14 0.345 15-19 0.345 20-24 0.345 25-29 0.345 30-34 0.35000000000000003 35-39 0.35500000000000004 40-44 0.325 45-49 0.305 50-54 0.26 55-59 0.265 60-64 0.28500000000000003 65-69 0.28500000000000003 70-74 0.32 75-79 0.31 80-84 0.365 85-89 0.385 90-94 0.36 95-99 0.315 100-104 0.29 105-109 0.25 110-114 0.27999999999999997 115-119 0.295 120-124 0.28500000000000003 125-129 0.305 130-134 0.305 135-139 0.325 140-144 0.28500000000000003 145-149 0.25 150-151 0.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59819186338524 99.15 2 0.3766951280763436 0.75 3 0.0 0.0 4 0.025113008538422906 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.5375000000000001 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.8999999999999999 0.0 0.0 0.0 0.0 104-105 1.125 0.0 0.0 0.0 0.0 106-107 1.275 0.0 0.0 0.0 0.0 108-109 1.6375 0.0 0.0 0.0 0.0 110-111 1.8625 0.0 0.0 0.0 0.0 112-113 2.125 0.0 0.0 0.0 0.0 114-115 2.3499999999999996 0.0 0.0 0.0 0.0 116-117 2.55 0.0 0.0 0.0 0.0 118-119 2.925 0.0 0.0 0.0 0.0 120-121 3.2125 0.0 0.0 0.0 0.0 122-123 3.4625000000000004 0.0 0.0 0.0 0.0 124-125 3.9000000000000004 0.0 0.0 0.0 0.0 126-127 4.3875 0.0 0.0 0.0 0.0 128-129 4.725 0.0 0.0 0.0 0.0 130-131 5.1125 0.0 0.0 0.0 0.0 132-133 5.475 0.0 0.0 0.0 0.0 134-135 5.8875 0.0 0.0 0.0 0.0 136-137 6.325 0.0 0.0 0.0 0.0 138-139 6.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGATAG 10 0.006830828 145.0 3 AAAAAAA 60 0.004491891 24.166666 145 >>END_MODULE Read 878658 spots for SRR7169592.sra Written 878658 spots for SRR7169592.sra Read 878658 spots for SRR7169592.sra Written 878658 spots for SRR7169592.sra Read 878658 spots for SRR7169592.sra Written 878658 spots for SRR7169592.sra Read 878658 spots for SRR7169592.sra Written 878658 spots for SRR7169592.sra Read 878658 spots for SRR7169592.sra Written 878658 spots for SRR7169592.sra Read 878658 spots for SRR7169592.sra Written 878658 spots for SRR7169592.sra Read 878658 spots for SRR7169592.sra Written 878658 spots for SRR7169592.sra Read 878658 spots for SRR7169592.sra Written 878658 spots for SRR7169592.sra Read 878658 spots for SRR7169592.sra Written 878658 spots for SRR7169592.sra Read 878658 spots for SRR7169592.sra Written 878658 spots for SRR7169592.sra Read 878658 spots for SRR7169592.sra Written 878658 spots for SRR7169592.sra Read 878658 spots for SRR7169592.sra Written 878658 spots for SRR7169592.sra Read 878658 spots for SRR7169592.sra Written 878658 spots for SRR7169592.sra Read 878676 spots for SRR7169592.sra Written 878676 spots for SRR7169592.sra Read 878658 spots for SRR7169592.sra Written 878658 spots for SRR7169592.sra Read 878658 spots for SRR7169592.sra Written 878658 spots for SRR7169592.sra Read 878658 spots for SRR7169592.sra Written 878658 spots for SRR7169592.sra Read 878658 spots for SRR7169592.sra Written 878658 spots for SRR7169592.sra Read 878658 spots for SRR7169592.sra Written 878658 spots for SRR7169592.sra Read 878658 spots for SRR7169592.sra Written 878658 spots for SRR7169592.sra SRR ids: ['SRR7169592.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ew6usa6f SRR7169592.sra spots: 17573178 blocks: [[1, 878658], [878659, 1757316], [1757317, 2635974], [2635975, 3514632], [3514633, 4393290], [4393291, 5271948], [5271949, 6150606], [6150607, 7029264], [7029265, 7907922], [7907923, 8786580], [8786581, 9665238], [9665239, 10543896], [10543897, 11422554], [11422555, 12301212], [12301213, 13179870], [13179871, 14058528], [14058529, 14937186], [14937187, 15815844], [15815845, 16694502], [16694503, 17573178]] SRR7169592 file size 5933273 SRR7169592 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169592 SRR7169592_1.fastq SRR7169592_2.fastq Input file: SRR7169592_1.fastq Paired file: SRR7169592_2.fastq trimmed: SRR7169592-trimmed-pair1.fastq, SRR7169592-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:13:32 2025 >> started Tue Feb 11 09:13:51 2025 >> done (19.061s) 17573178 read pairs processed; of these: 41338 ( 0.24%) short read pairs filtered out after trimming by size control 40533 ( 0.23%) empty read pairs filtered out after trimming by size control 17491307 (99.53%) read pairs available; of these: 9229299 (52.77%) trimmed read pairs available after processing 8262008 (47.23%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 4 0.00% 20 3 0.00% 21 10 0.00% 22 5 0.00% 23 8 0.00% 24 4 0.00% 25 8 0.00% 26 8 0.00% 27 14 0.00% 28 11 0.00% 29 13 0.00% 30 12 0.00% 31 9 0.00% 32 10 0.00% 33 9 0.00% 34 8 0.00% 35 15 0.00% 36 14 0.00% 37 11 0.00% 38 16 0.00% 39 23 0.00% 40 20 0.00% 41 26 0.00% 42 29 0.00% 43 18 0.00% 44 26 0.00% 45 40 0.00% 46 45 0.00% 47 57 0.00% 48 82 0.00% 49 58 0.00% 50 81 0.00% 51 99 0.00% 52 104 0.00% 53 112 0.00% 54 102 0.00% 55 130 0.00% 56 138 0.00% 57 156 0.00% 58 203 0.00% 59 223 0.00% 60 245 0.00% 61 315 0.00% 62 350 0.00% 63 397 0.00% 64 489 0.00% 65 500 0.00% 66 546 0.00% 67 650 0.00% 68 761 0.00% 69 1281 0.01% 70 1442 0.01% 71 1223 0.01% 72 1334 0.01% 73 1382 0.01% 74 1619 0.01% 75 1712 0.01% 76 1893 0.01% 77 2127 0.01% 78 2355 0.01% 79 2595 0.01% 80 2941 0.02% 81 3234 0.02% 82 3904 0.02% 83 4383 0.03% 84 5641 0.03% 85 6415 0.04% 86 6607 0.04% 87 7150 0.04% 88 7551 0.04% 89 8212 0.05% 90 8726 0.05% 91 9481 0.05% 92 10120 0.06% 93 10993 0.06% 94 11699 0.07% 95 12403 0.07% 96 13000 0.07% 97 13576 0.08% 98 14272 0.08% 99 14895 0.09% 100 15441 0.09% 101 16698 0.10% 102 17707 0.10% 103 18817 0.11% 104 19755 0.11% 105 20891 0.12% 106 21680 0.12% 107 22586 0.13% 108 23314 0.13% 109 24038 0.14% 110 24400 0.14% 111 26058 0.15% 112 27483 0.16% 113 28929 0.17% 114 30602 0.17% 115 31694 0.18% 116 33009 0.19% 117 34279 0.20% 118 35516 0.20% 119 35905 0.21% 120 37180 0.21% 121 39245 0.22% 122 41089 0.23% 123 42566 0.24% 124 45542 0.26% 125 47686 0.27% 126 50187 0.29% 127 51876 0.30% 128 53717 0.31% 129 55931 0.32% 130 58196 0.33% 131 61401 0.35% 132 65019 0.37% 133 68692 0.39% 134 72837 0.42% 135 78000 0.45% 136 82593 0.47% 137 87852 0.50% 138 94412 0.54% 139 101367 0.58% 140 108689 0.62% 141 118827 0.68% 142 132101 0.76% 143 148425 0.85% 144 172163 0.98% 145 205499 1.17% 146 254898 1.46% 147 347924 1.99% 148 533592 3.05% 149 1043045 5.96% 150 4219557 24.12% 151 8262008 47.23% 17491307 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=45 prefix-density=0.15 prefix-fanout=1.9 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.10 sequence-density-rank=10 fanout-score=273.31 fanout-score-rank=1 prefix-density=0.95 prefix-fanout=29.4 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.65 fanout-score-rank=34 prefix-density=0.29 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=27 fanout-score=333.09 fanout-score-rank=1 prefix-density=1.03 prefix-fanout=29.4 sequence=AAGAAGAAGAAG SRR7169592 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:14:33 Started mapping on | Feb 11 09:14:33 Finished on | Feb 11 09:16:10 Mapping speed, Million of reads per hour | 649.16 Number of input reads | 17491307 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 16727721 Uniquely mapped reads % | 95.63% Average mapped length | 292.93 Number of splices: Total | 16408603 Number of splices: Annotated (sjdb) | 16136238 Number of splices: GT/AG | 16164072 Number of splices: GC/AG | 197335 Number of splices: AT/AC | 12889 Number of splices: Non-canonical | 34307 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 2.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 309017 % of reads mapped to multiple loci | 1.77% Number of reads mapped to too many loci | 73235 % of reads mapped to too many loci | 0.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.10% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 474696 474696 474696 N_multimapping 309017 309017 309017 N_noFeature 393361 16540081 493653 N_ambiguous 154065 937 66036 UnstrandedReadsAssigned:16180295 PositiveStrandReadsAssigned:186703 NegativeStrandReadsAssigned:16168032 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169592 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169592-trimmed-pair1.fastq SRR7169592-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,491,307 reads, 16,089,067 reads pseudoaligned [quant] estimated average fragment length: 243.969 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,211 rounds 52401 SRR7169592.ke.tsv 34699 SRR7169592.se.tsv 87100 total ==> SRR7169592.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1775.03 314 11.0868 Potri.005G024800.1.v4.1 1035 792.031 45 3.56083 Potri.004G059700.1.v4.1 961 718.119 4 0.349096 Potri.007G009000.2.v4.1 1416 1173.03 0 0 Potri.003G141000.2.v4.1 2943 2700.03 337.061 7.82386 Potri.016G087400.1.v4.1 270 81.6496 1472 1129.89 Potri.015G069301.1.v4.1 564 327.466 0 0 Potri.010G195200.1.v4.1 1773 1530.03 24 0.983087 Potri.012G127500.1.v4.1 977 734.082 6319 539.492 ==> SRR7169592.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1044 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 183 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169592 completed mapping pipeline successfully