Starting /dee2/code/volunteer_pipeline.sh SRR7169593 current disk space = 3055868293120 free memory = 1415495416 SRR7169593 SRAfilesize 65e4d0f5352a2115894991a88e7dc26a SRR7169593.sra SRR7169593.sra file validated SRR7169593 is paired end SRR7169593 is conventional basespace SRR7169593 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169593_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.94125 34.0 33.0 34.0 30.0 34.0 2 32.93825 34.0 33.0 34.0 29.0 34.0 3 33.0495 34.0 33.0 34.0 30.0 34.0 4 33.39025 34.0 33.0 34.0 33.0 34.0 5 33.362 34.0 33.0 34.0 33.0 34.0 6 36.92475 38.0 37.0 38.0 35.0 38.0 7 37.3185 38.0 38.0 38.0 37.0 38.0 8 37.364 38.0 38.0 38.0 37.0 38.0 9 37.439 38.0 38.0 38.0 37.0 38.0 10-14 37.481700000000004 38.0 38.0 38.0 37.8 38.0 15-19 37.4867 38.0 38.0 38.0 37.6 38.0 20-24 37.45675 38.0 38.0 38.0 37.2 38.0 25-29 37.3785 38.0 38.0 38.0 37.0 38.0 30-34 37.256600000000006 38.0 38.0 38.0 37.0 38.0 35-39 37.2184 38.0 38.0 38.0 36.8 38.0 40-44 36.9268 38.0 38.0 38.0 36.0 38.0 45-49 36.787800000000004 38.0 38.0 38.0 34.8 38.0 50-54 36.65455 38.0 38.0 38.0 34.6 38.0 55-59 36.57645 38.0 38.0 38.0 34.0 38.0 60-64 36.40965 38.0 37.8 38.0 34.0 38.0 65-69 36.370250000000006 38.0 37.8 38.0 33.6 38.0 70-74 36.25005 38.0 37.0 38.0 33.6 38.0 75-79 36.116049999999994 38.0 37.0 38.0 33.0 38.0 80-84 35.9209 38.0 37.0 38.0 32.2 38.0 85-89 35.76845000000001 38.0 37.0 38.0 31.4 38.0 90-94 35.48735 38.0 36.4 38.0 30.2 38.0 95-99 35.24555 38.0 36.2 38.0 29.0 38.0 100-104 34.87365 38.0 36.0 38.0 27.6 38.0 105-109 34.6467 38.0 35.4 38.0 26.2 38.0 110-114 34.27205 38.0 35.0 38.0 23.6 38.0 115-119 33.9953 38.0 34.4 38.0 22.2 38.0 120-124 33.4023 37.8 33.8 38.0 17.8 38.0 125-129 33.14835 38.0 34.0 38.0 15.0 38.0 130-134 32.98005 38.0 33.8 38.0 15.0 38.0 135-139 32.58825 37.8 33.2 38.0 14.6 38.0 140-144 31.691449999999996 36.4 31.8 38.0 13.8 38.0 145-149 30.176650000000002 36.0 28.6 38.0 4.2 38.0 150-151 25.849249999999998 33.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 1.0 8 1.0 9 2.0 10 1.0 11 2.0 12 3.0 13 4.0 14 4.0 15 3.0 16 3.0 17 6.0 18 11.0 19 6.0 20 9.0 21 18.0 22 14.0 23 13.0 24 29.0 25 31.0 26 21.0 27 44.0 28 47.0 29 72.0 30 56.0 31 86.0 32 112.0 33 157.0 34 257.0 35 449.0 36 1041.0 37 1496.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.378151260504204 14.095960965031173 8.999728923827595 31.52615885063703 2 25.724999999999998 13.975000000000001 29.65 30.65 3 20.200000000000003 18.75 26.075 34.975 4 23.925 23.525 23.575 28.975 5 23.150000000000002 28.7 24.8 23.35 6 21.525 33.25 24.525 20.7 7 15.675 29.775000000000002 37.625 16.925 8 18.4 29.099999999999998 30.049999999999997 22.45 9 16.6 27.0 32.4 24.0 10-14 18.95 31.61 26.795 22.645 15-19 19.384999999999998 29.67 27.55 23.395 20-24 19.595000000000002 29.78 27.175 23.45 25-29 19.505 30.19 26.669999999999998 23.635 30-34 19.585 29.21 27.950000000000003 23.255 35-39 19.945 29.73 26.99 23.335 40-44 19.505 29.565 27.400000000000002 23.53 45-49 20.244999999999997 29.265 27.295 23.195 50-54 19.580000000000002 29.080000000000002 27.474999999999998 23.865 55-59 19.99 29.445 27.134999999999998 23.43 60-64 19.655 29.26 27.425 23.66 65-69 20.485 29.270000000000003 26.540000000000003 23.705000000000002 70-74 20.04 29.505 26.99 23.465 75-79 20.39 28.945 27.0 23.665 80-84 20.03 29.310000000000002 27.05 23.61 85-89 20.165 28.525 27.450000000000003 23.86 90-94 20.175 28.705000000000002 27.185 23.935000000000002 95-99 20.8 28.28 27.35 23.57 100-104 20.465 29.310000000000002 26.695 23.53 105-109 20.265 29.044999999999998 26.834999999999997 23.855 110-114 20.62 28.845 26.93 23.605 115-119 20.345 29.189999999999998 26.69 23.775 120-124 20.72 28.96 26.295 24.025 125-129 20.79 28.42 26.605 24.185000000000002 130-134 20.815 27.975 27.16 24.05 135-139 21.17 28.375 26.55 23.905 140-144 20.73 28.43 26.784999999999997 24.055 145-149 20.875 28.235 26.515 24.375 150-151 21.2625 28.1 27.0125 23.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.5 7 1.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 1.5 21 2.5 22 1.5 23 1.5 24 2.5 25 5.0 26 7.5 27 11.5 28 13.0 29 15.5 30 24.5 31 39.0 32 50.5 33 61.5 34 71.0 35 77.0 36 100.5 37 130.5 38 138.5 39 147.5 40 170.0 41 201.5 42 231.0 43 237.0 44 238.0 45 248.0 46 261.0 47 243.0 48 207.5 49 192.0 50 166.0 51 143.0 52 127.5 53 98.5 54 77.0 55 54.5 56 36.5 57 35.0 58 30.5 59 16.5 60 15.5 61 16.0 62 10.5 63 8.0 64 6.0 65 6.5 66 4.0 67 2.0 68 3.5 69 3.5 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62321024868123 99.15 2 0.3265511178095956 0.65 3 0.0 0.0 4 0.050238633509168545 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.3875 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.6125 0.0 0.0 0.0 0.0 108-109 0.8 0.0 0.0 0.0 0.0 110-111 0.9125 0.0 0.0 0.0 0.0 112-113 1.0625 0.0 0.0 0.0 0.0 114-115 1.225 0.0 0.0 0.0 0.0 116-117 1.35 0.0 0.0 0.0 0.0 118-119 1.3875000000000002 0.0 0.0 0.0 0.0 120-121 1.6 0.0 0.0 0.0 0.0 122-123 1.825 0.0 0.0 0.0 0.0 124-125 2.075 0.0 0.0 0.0 0.0 126-127 2.2875 0.0 0.0 0.0 0.0 128-129 2.55 0.0 0.0 0.0 0.0 130-131 2.775 0.0 0.0 0.0 0.0 132-133 2.8625 0.0 0.0 0.0 0.0 134-135 3.2 0.0 0.0 0.0 0.0 136-137 3.5375 0.0 0.0 0.0 0.0 138-139 4.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGGTGT 10 0.006843168 144.91249 6 >>END_MODULE SRR7169593 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169593_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.68125 33.0 33.0 34.0 32.0 34.0 2 32.63425 34.0 33.0 34.0 32.0 34.0 3 32.7855 34.0 33.0 34.0 32.0 34.0 4 32.73575 34.0 33.0 34.0 32.0 34.0 5 32.75075 34.0 33.0 34.0 32.0 34.0 6 36.88975 38.0 38.0 38.0 37.0 38.0 7 36.80275 38.0 38.0 38.0 37.0 38.0 8 36.938 38.0 38.0 38.0 37.0 38.0 9 36.89275 38.0 38.0 38.0 37.0 38.0 10-14 36.8804 38.0 38.0 38.0 37.0 38.0 15-19 36.76495 38.0 38.0 38.0 36.8 38.0 20-24 36.7808 38.0 38.0 38.0 37.0 38.0 25-29 36.7173 38.0 38.0 38.0 36.6 38.0 30-34 36.6115 38.0 38.0 38.0 36.0 38.0 35-39 36.6389 38.0 38.0 38.0 36.2 38.0 40-44 36.67165 38.0 38.0 38.0 36.4 38.0 45-49 36.45245 38.0 38.0 38.0 35.4 38.0 50-54 36.55305 38.0 38.0 38.0 36.0 38.0 55-59 36.49 38.0 38.0 38.0 35.8 38.0 60-64 36.3411 38.0 38.0 38.0 35.0 38.0 65-69 36.172 38.0 38.0 38.0 34.2 38.0 70-74 36.191 38.0 38.0 38.0 34.6 38.0 75-79 36.113749999999996 38.0 38.0 38.0 34.0 38.0 80-84 36.07555000000001 38.0 38.0 38.0 34.0 38.0 85-89 35.9904 38.0 38.0 38.0 33.8 38.0 90-94 35.7029 38.0 38.0 38.0 32.4 38.0 95-99 35.6901 38.0 38.0 38.0 33.0 38.0 100-104 35.5943 38.0 38.0 38.0 32.4 38.0 105-109 35.48675000000001 38.0 38.0 38.0 31.6 38.0 110-114 35.13895 38.0 37.8 38.0 29.2 38.0 115-119 35.0202 38.0 37.0 38.0 28.4 38.0 120-124 34.75985 38.0 37.0 38.0 27.8 38.0 125-129 34.397499999999994 38.0 36.0 38.0 24.0 38.0 130-134 34.06455 38.0 36.0 38.0 22.0 38.0 135-139 33.67775 38.0 35.0 38.0 18.6 38.0 140-144 33.354600000000005 38.0 34.2 38.0 15.4 38.0 145-149 32.7642 38.0 33.0 38.0 10.8 38.0 150-151 28.793374999999997 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 31.0 3 9.0 4 3.0 5 4.0 6 1.0 7 2.0 8 2.0 9 2.0 10 3.0 11 5.0 12 1.0 13 8.0 14 9.0 15 6.0 16 12.0 17 9.0 18 10.0 19 12.0 20 12.0 21 10.0 22 20.0 23 17.0 24 14.0 25 23.0 26 32.0 27 20.0 28 31.0 29 26.0 30 45.0 31 62.0 32 49.0 33 80.0 34 116.0 35 192.0 36 412.0 37 2710.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.04014049172102 24.711490215755145 12.769693928750629 22.478675363773206 2 28.71460786770233 27.68729641693811 27.23628163367577 16.36181408168379 3 22.726133801052367 29.06539714357304 29.140566274116765 19.067902781257832 4 23.803558005512404 34.15184164369832 22.726133801052367 19.318466549736907 5 25.0814332247557 35.20420947131045 22.049611626158857 17.66474567777499 6 22.539444027047335 36.939644377660905 23.516153268219384 17.004758327072377 7 22.31404958677686 22.63961933383421 36.814425244177315 18.23190583521162 8 22.99023290758828 26.34610568494866 27.0473328324568 23.61632857500626 9 22.645290581162325 26.57815631262525 27.45490981963928 23.321643286573146 10-14 24.065724877266806 29.005109708446046 25.46338042280333 21.46578499148382 15-19 24.559029865704552 28.517739025856887 26.59350571256765 20.329725395870916 20-24 23.91881733901278 28.408920070157855 26.695063893760963 20.977198697068403 25-29 23.95890754196943 28.844901027311447 26.534703081934353 20.661488348784765 30-34 24.195811203527406 28.154123659685336 26.45054614690851 21.199518989878747 35-39 23.742232912407296 28.342353176989377 26.7288033674083 21.186610543195027 40-44 24.016635766898833 28.235706769554543 26.451871523776116 21.295785939770507 45-49 24.174392382861438 28.023051866700076 26.765221748935105 21.037334001503382 50-54 24.208258167969532 28.121868109841653 27.38524754459812 20.2846261775907 55-59 24.570283137058382 27.331495865697818 27.206213981458284 20.89200701578552 60-64 24.299674267100976 27.74743172137309 27.526935605111504 20.42595840641443 65-69 24.733122838670877 27.4896005613191 27.37934145241317 20.39793514759685 70-74 24.555160142348754 27.141496666833742 27.472307152523683 20.83103603829382 75-79 24.020050125313283 27.523809523809522 27.729323308270676 20.726817042606516 80-84 23.898551451055088 27.77304395769636 27.54749135381685 20.780913237431708 85-89 24.160401002506266 27.56390977443609 27.69924812030075 20.576441102756892 90-94 24.279340251666916 27.267258234320952 28.064370582042415 20.38903093196972 95-99 24.017248295226633 27.662454873646208 27.998395507420774 20.321901323706378 100-104 24.154008121522033 27.277284804732542 28.149596430540935 20.41911064320449 105-109 24.605203790043614 26.996540833207998 28.039304156013433 20.358951220734948 110-114 24.587698631510353 27.64549601483784 27.41992079803499 20.346884555616825 115-119 24.241664577588367 28.24768112308849 27.275006267234897 20.235648032088243 120-124 24.157641395908545 26.915363016446047 27.97332531087044 20.953670276774968 125-129 24.865867723010577 27.543498972070402 27.22258436544151 20.36804893947751 130-134 23.971915747241727 27.9839518555667 27.788365095285855 20.255767301905717 135-139 24.592548016649115 27.696705280577703 27.40584724938569 20.304899453387492 140-144 24.503510531594785 27.783350050150453 27.64794383149448 20.065195586760282 145-149 24.74795606159402 28.53990068716457 26.88970256307368 19.822440688167728 150-151 24.474211316975463 28.204807210816224 27.341011517275916 19.979969954932397 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 7.0 1 3.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 1.0 20 1.5 21 1.5 22 1.5 23 1.5 24 1.5 25 1.5 26 2.0 27 2.0 28 5.5 29 7.0 30 7.0 31 12.0 32 17.5 33 22.5 34 32.5 35 41.5 36 57.5 37 80.5 38 112.0 39 145.0 40 182.5 41 214.0 42 255.5 43 284.5 44 290.0 45 287.5 46 270.0 47 263.0 48 250.0 49 213.5 50 176.0 51 155.0 52 137.5 53 116.0 54 87.0 55 69.5 56 46.0 57 25.0 58 22.5 59 22.0 60 18.0 61 12.5 62 8.5 63 5.5 64 4.5 65 6.0 66 4.0 67 1.5 68 2.5 69 1.5 70 1.0 71 1.5 72 0.5 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.22499999999999998 3 0.22499999999999998 4 0.22499999999999998 5 0.22499999999999998 6 0.17500000000000002 7 0.17500000000000002 8 0.17500000000000002 9 0.2 10-14 0.19 15-19 0.22 20-24 0.22499999999999998 25-29 0.22499999999999998 30-34 0.21 35-39 0.22 40-44 0.215 45-49 0.22499999999999998 50-54 0.22 55-59 0.22499999999999998 60-64 0.22499999999999998 65-69 0.23500000000000001 70-74 0.245 75-79 0.25 80-84 0.245 85-89 0.25 90-94 0.265 95-99 0.27999999999999997 100-104 0.265 105-109 0.265 110-114 0.255 115-119 0.27499999999999997 120-124 0.27999999999999997 125-129 0.28500000000000003 130-134 0.3 135-139 0.295 140-144 0.3 145-149 0.315 150-151 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21717171717171 98.225 2 0.6818181818181818 1.35 3 0.050505050505050504 0.15 4 0.025252525252525252 0.1 5 0.0 0.0 6 0.0 0.0 7 0.025252525252525252 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.3875 0.0 0.0 0.0 0.0 104-105 0.44999999999999996 0.0 0.0 0.0 0.0 106-107 0.5625 0.0 0.0 0.0 0.0 108-109 0.725 0.0 0.0 0.0 0.0 110-111 0.85 0.0 0.0 0.0 0.0 112-113 1.0 0.0 0.0 0.0 0.0 114-115 1.2000000000000002 0.0 0.0 0.0 0.0 116-117 1.325 0.0 0.0 0.0 0.0 118-119 1.3875000000000002 0.0 0.0 0.0 0.0 120-121 1.6 0.0 0.0 0.0 0.0 122-123 1.8 0.0 0.0 0.0 0.0 124-125 2.0375 0.0 0.0 0.0 0.0 126-127 2.2375 0.0 0.0 0.0 0.0 128-129 2.475 0.0 0.0 0.0 0.0 130-131 2.7375 0.0 0.0 0.0 0.0 132-133 2.8375 0.0 0.0 0.0 0.0 134-135 3.175 0.0 0.0 0.0 0.0 136-137 3.5250000000000004 0.0 0.0 0.0 0.0 138-139 4.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGGGGA 10 0.006830828 145.0 145 AAAAAAA 30 0.0014437955 24.166668 115-119 >>END_MODULE Read 800230 spots for SRR7169593.sra Written 800230 spots for SRR7169593.sra Read 800230 spots for SRR7169593.sra Written 800230 spots for SRR7169593.sra Read 800230 spots for SRR7169593.sra Written 800230 spots for SRR7169593.sra Read 800230 spots for SRR7169593.sra Written 800230 spots for SRR7169593.sra Read 800230 spots for SRR7169593.sra Written 800230 spots for SRR7169593.sra Read 800230 spots for SRR7169593.sra Written 800230 spots for SRR7169593.sra Read 800230 spots for SRR7169593.sra Written 800230 spots for SRR7169593.sra Read 800230 spots for SRR7169593.sra Written 800230 spots for SRR7169593.sra Read 800230 spots for SRR7169593.sra Written 800230 spots for SRR7169593.sra Read 800230 spots for SRR7169593.sra Written 800230 spots for SRR7169593.sra Read 800230 spots for SRR7169593.sra Written 800230 spots for SRR7169593.sra Read 800230 spots for SRR7169593.sra Written 800230 spots for SRR7169593.sra Read 800230 spots for SRR7169593.sra Written 800230 spots for SRR7169593.sra Read 800230 spots for SRR7169593.sra Written 800230 spots for SRR7169593.sra Read 800230 spots for SRR7169593.sra Written 800230 spots for SRR7169593.sra Read 800230 spots for SRR7169593.sra Written 800230 spots for SRR7169593.sra Read 800230 spots for SRR7169593.sra Written 800230 spots for SRR7169593.sra Read 800230 spots for SRR7169593.sra Written 800230 spots for SRR7169593.sra Read 800230 spots for SRR7169593.sra Written 800230 spots for SRR7169593.sra Read 800230 spots for SRR7169593.sra Written 800230 spots for SRR7169593.sra SRR ids: ['SRR7169593.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4bh268af SRR7169593.sra spots: 16004600 blocks: [[1, 800230], [800231, 1600460], [1600461, 2400690], [2400691, 3200920], [3200921, 4001150], [4001151, 4801380], [4801381, 5601610], [5601611, 6401840], [6401841, 7202070], [7202071, 8002300], [8002301, 8802530], [8802531, 9602760], [9602761, 10402990], [10402991, 11203220], [11203221, 12003450], [12003451, 12803680], [12803681, 13603910], [13603911, 14404140], [14404141, 15204370], [15204371, 16004600]] SRR7169593 file size 5401733 SRR7169593 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169593 SRR7169593_1.fastq SRR7169593_2.fastq Input file: SRR7169593_1.fastq Paired file: SRR7169593_2.fastq trimmed: SRR7169593-trimmed-pair1.fastq, SRR7169593-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 07:57:59 2025 >> started Tue Feb 11 07:58:26 2025 >> done (27.325s) 16004600 read pairs processed; of these: 38956 ( 0.24%) short read pairs filtered out after trimming by size control 109078 ( 0.68%) empty read pairs filtered out after trimming by size control 15856566 (99.08%) read pairs available; of these: 8034035 (50.67%) trimmed read pairs available after processing 7822531 (49.33%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 8 0.00% 20 7 0.00% 21 7 0.00% 22 15 0.00% 23 9 0.00% 24 10 0.00% 25 21 0.00% 26 22 0.00% 27 27 0.00% 28 22 0.00% 29 28 0.00% 30 25 0.00% 31 29 0.00% 32 37 0.00% 33 20 0.00% 34 35 0.00% 35 226 0.00% 36 101 0.00% 37 39 0.00% 38 39 0.00% 39 35 0.00% 40 56 0.00% 41 34 0.00% 42 50 0.00% 43 63 0.00% 44 79 0.00% 45 76 0.00% 46 89 0.00% 47 92 0.00% 48 97 0.00% 49 115 0.00% 50 136 0.00% 51 124 0.00% 52 148 0.00% 53 169 0.00% 54 149 0.00% 55 149 0.00% 56 160 0.00% 57 189 0.00% 58 195 0.00% 59 249 0.00% 60 214 0.00% 61 238 0.00% 62 278 0.00% 63 311 0.00% 64 342 0.00% 65 402 0.00% 66 524 0.00% 67 625 0.00% 68 742 0.00% 69 1440 0.01% 70 3062 0.02% 71 1947 0.01% 72 1284 0.01% 73 1083 0.01% 74 1080 0.01% 75 1200 0.01% 76 1193 0.01% 77 1224 0.01% 78 1336 0.01% 79 1600 0.01% 80 1730 0.01% 81 1944 0.01% 82 2194 0.01% 83 2552 0.02% 84 4158 0.03% 85 4989 0.03% 86 5094 0.03% 87 5631 0.04% 88 5840 0.04% 89 6124 0.04% 90 6418 0.04% 91 6609 0.04% 92 6981 0.04% 93 7394 0.05% 94 7549 0.05% 95 8363 0.05% 96 8529 0.05% 97 8989 0.06% 98 9460 0.06% 99 10065 0.06% 100 10661 0.07% 101 11236 0.07% 102 12123 0.08% 103 12677 0.08% 104 13195 0.08% 105 14400 0.09% 106 15199 0.10% 107 15745 0.10% 108 16781 0.11% 109 17583 0.11% 110 18303 0.12% 111 19284 0.12% 112 20457 0.13% 113 21690 0.14% 114 22711 0.14% 115 23668 0.15% 116 24823 0.16% 117 25966 0.16% 118 27109 0.17% 119 27673 0.17% 120 29026 0.18% 121 30219 0.19% 122 32121 0.20% 123 34029 0.21% 124 36064 0.23% 125 37649 0.24% 126 39647 0.25% 127 41881 0.26% 128 43997 0.28% 129 46338 0.29% 130 48385 0.31% 131 50610 0.32% 132 53970 0.34% 133 57385 0.36% 134 60428 0.38% 135 65152 0.41% 136 68685 0.43% 137 74344 0.47% 138 78967 0.50% 139 84858 0.54% 140 91956 0.58% 141 99936 0.63% 142 111864 0.71% 143 127820 0.81% 144 145720 0.92% 145 173755 1.10% 146 216629 1.37% 147 296897 1.87% 148 453230 2.86% 149 910765 5.74% 150 3876501 24.45% 151 7822531 49.33% 15856566 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.64 fanout-score-rank=37 prefix-density=0.19 prefix-fanout=2.4 sequence=GCTGTCTTCAAGAACCTATT criterion=fanout-score sequence-density=0.03 sequence-density-rank=37 fanout-score=297.52 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=21.1 sequence=AAAAACAAAAAGAAGATCAAAGCCTTTCTTGTCCAATCACTATCGTGAAATGACACCATTATTCTGGACCCGGAACCCGACTCAAACCAACCCATGTTTCCTTGATTTCTCCAGCTCCATTTACTCGATAGTCAAAGGAACAGAATCAGCCAATTTGCGATATTTGAGTGCATAGAACATTTCCAGATAGCGACGGCTCTCACGATGATCAAGGTTGGAAACATGCTTCCAGAAGCCATAAACTCCTGTGAGAGTCAGGAGCCTTTGAGAGTAAATTTTCCAGGTATACTTCTCTTGGATTCGCTGCAGGCCTCCCTGGGAGATTTT criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=5.25 fanout-score-rank=25 prefix-density=0.29 prefix-fanout=3.4 sequence=TGGTGCCCAACTGGGTTCAAGTGTGGCATCAACTACCAGCCACCAACTGTTGTTCCAGGAGGCGACCTTGCTAAGGTTCAGAGGGCTGTTTGCATGATTTCCAATTCCACAAGTGTTGCAGAAGTCTTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGGCGAGGGTATGGAGGAAGGAGAGTTCTCAGAGGCTCGTGAGGATCTTGCTGCCCTGGAGAAGGATTATGAGGAGGTTGGGGCTGAATCTCCCGATGGAGAGGATGGTGATGAAGGAGAT criterion=fanout-score sequence-density=0.02 sequence-density-rank=41 fanout-score=169.93 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=14.4 sequence=GAGGAGAAGGAACACGAGGATACTAGTGTTCCTGTCGAGGTAGTCCATACAGAGACACCCCATGAACCAGAGGATAAGAAGGGTTTCCTTGACAAAATCAAGGAGAAATTGCCAGGACATAAGAAAGCTGACGAGGTCCCTCCTCCAGCTCCTGAACATGTTTCCCCTGAAGCTGCAGTTTCCCATGAAGGAGAT SRR7169593 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 07:59:26 Started mapping on | Feb 11 07:59:27 Finished on | Feb 11 08:02:31 Mapping speed, Million of reads per hour | 310.24 Number of input reads | 15856566 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 14482338 Uniquely mapped reads % | 91.33% Average mapped length | 294.17 Number of splices: Total | 11931440 Number of splices: Annotated (sjdb) | 11707190 Number of splices: GT/AG | 11753840 Number of splices: GC/AG | 138292 Number of splices: AT/AC | 10324 Number of splices: Non-canonical | 28984 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 280119 % of reads mapped to multiple loci | 1.77% Number of reads mapped to too many loci | 71425 % of reads mapped to too many loci | 0.45% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.33% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1123290 1123290 1123290 N_multimapping 280119 280119 280119 N_noFeature 352038 14281760 436064 N_ambiguous 182913 1516 65309 UnstrandedReadsAssigned:13947387 PositiveStrandReadsAssigned:199062 NegativeStrandReadsAssigned:13980965 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169593 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169593-trimmed-pair1.fastq SRR7169593-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,856,566 reads, 14,017,648 reads pseudoaligned [quant] estimated average fragment length: 237.092 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,039 rounds 52401 SRR7169593.ke.tsv 34699 SRR7169593.se.tsv 87100 total ==> SRR7169593.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1781.91 243 8.43566 Potri.005G024800.1.v4.1 1035 798.908 75 5.80714 Potri.004G059700.1.v4.1 961 724.92 3 0.255994 Potri.007G009000.2.v4.1 1416 1179.91 2 0.104853 Potri.003G141000.2.v4.1 2943 2706.91 288 6.58138 Potri.016G087400.1.v4.1 270 75.0168 2146 1769.58 Potri.015G069301.1.v4.1 564 330.573 0 0 Potri.010G195200.1.v4.1 1773 1536.91 89 3.58212 Potri.012G127500.1.v4.1 977 740.914 4782 399.245 ==> SRR7169593.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2208 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 343 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7169593 completed mapping pipeline successfully