Starting /dee2/code/volunteer_pipeline.sh SRR7169594 current disk space = 3055734456320 free memory = 1414846108 SRR7169594 SRAfilesize 7ae3fab30911810f668492c80a02f414 SRR7169594.sra SRR7169594.sra file validated SRR7169594 is paired end SRR7169594 is conventional basespace SRR7169594 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169594_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.29175 34.0 33.0 34.0 32.0 34.0 2 33.157 34.0 33.0 34.0 32.0 34.0 3 33.19125 34.0 33.0 34.0 31.0 34.0 4 33.32275 34.0 33.0 34.0 33.0 34.0 5 33.3175 34.0 33.0 34.0 33.0 34.0 6 36.75375 38.0 37.0 38.0 34.0 38.0 7 37.0205 38.0 38.0 38.0 36.0 38.0 8 37.23275 38.0 38.0 38.0 36.0 38.0 9 37.275 38.0 38.0 38.0 37.0 38.0 10-14 37.3432 38.0 38.0 38.0 37.0 38.0 15-19 37.29795 38.0 38.0 38.0 37.0 38.0 20-24 37.267399999999995 38.0 38.0 38.0 36.8 38.0 25-29 37.2222 38.0 38.0 38.0 36.4 38.0 30-34 37.15365 38.0 38.0 38.0 36.0 38.0 35-39 37.04665 38.0 38.0 38.0 36.0 38.0 40-44 36.849450000000004 38.0 38.0 38.0 35.0 38.0 45-49 36.6624 38.0 38.0 38.0 34.0 38.0 50-54 36.61559999999999 38.0 38.0 38.0 34.0 38.0 55-59 36.42755 38.0 37.8 38.0 34.0 38.0 60-64 36.360949999999995 38.0 37.2 38.0 33.8 38.0 65-69 36.287850000000006 38.0 37.0 38.0 33.4 38.0 70-74 36.1819 38.0 37.0 38.0 33.2 38.0 75-79 36.00945 38.0 37.0 38.0 32.6 38.0 80-84 35.9533 38.0 37.0 38.0 32.0 38.0 85-89 35.84265 38.0 37.0 38.0 31.6 38.0 90-94 35.60605 38.0 36.6 38.0 30.2 38.0 95-99 35.41075 38.0 36.6 38.0 29.6 38.0 100-104 35.0236 38.0 36.0 38.0 28.2 38.0 105-109 34.82705 38.0 35.4 38.0 27.4 38.0 110-114 34.3885 38.0 35.0 38.0 24.8 38.0 115-119 34.17715 38.0 34.6 38.0 23.2 38.0 120-124 33.9178 38.0 34.0 38.0 22.6 38.0 125-129 33.408550000000005 38.0 34.0 38.0 18.6 38.0 130-134 33.11749999999999 38.0 33.8 38.0 15.0 38.0 135-139 32.714600000000004 37.8 33.0 38.0 15.0 38.0 140-144 32.123850000000004 36.8 31.8 38.0 14.2 38.0 145-149 30.46995 36.0 29.8 38.0 8.6 38.0 150-151 26.579375 34.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 2.0 12 2.0 13 3.0 14 3.0 15 1.0 16 12.0 17 9.0 18 9.0 19 5.0 20 12.0 21 17.0 22 16.0 23 15.0 24 13.0 25 23.0 26 34.0 27 30.0 28 47.0 29 48.0 30 77.0 31 90.0 32 128.0 33 179.0 34 246.0 35 451.0 36 1012.0 37 1516.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.45867768595041 10.640495867768596 8.987603305785125 37.913223140495866 2 22.85 14.075 34.1 28.975 3 21.175 16.375 26.0 36.449999999999996 4 22.925 25.224999999999998 23.175 28.675 5 22.650000000000002 29.975 24.4 22.975 6 18.825 34.875 24.099999999999998 22.2 7 15.6 27.800000000000004 38.800000000000004 17.8 8 17.2 25.724999999999998 31.85 25.224999999999998 9 17.45 24.95 33.425 24.175 10-14 19.759999999999998 29.49 26.985 23.765 15-19 20.165 28.04 28.155 23.64 20-24 20.105 28.660000000000004 27.55 23.685000000000002 25-29 19.91 28.68 27.52 23.89 30-34 20.29 29.005 27.605 23.1 35-39 20.035 28.82 27.26 23.885 40-44 20.195 29.165000000000003 27.215 23.425 45-49 20.200000000000003 28.294999999999998 27.63 23.875 50-54 20.21 28.525 27.584999999999997 23.68 55-59 19.885 28.34 27.794999999999998 23.98 60-64 20.145 28.685 27.089999999999996 24.08 65-69 19.77 28.42 27.700000000000003 24.11 70-74 20.125 28.79 27.765 23.32 75-79 20.335 28.13 28.235 23.3 80-84 20.505000000000003 28.189999999999998 27.38 23.925 85-89 20.29 28.65 27.529999999999998 23.53 90-94 19.950000000000003 28.139999999999997 28.16 23.75 95-99 20.085 28.365000000000002 27.97 23.580000000000002 100-104 20.461369095276222 28.572858286629305 27.13170536429143 23.834067253803042 105-109 19.919999999999998 28.860000000000003 27.500000000000004 23.72 110-114 20.314455961143658 28.245956637123832 27.835361273847077 23.604226127885433 115-119 20.338304474026625 28.675808227404666 27.104393954559104 23.88149334400961 120-124 20.401321056845475 28.0724579663731 27.431945556445157 24.09427542033627 125-129 20.82708270827083 27.987798779877988 27.532753275327533 23.652365236523654 130-134 20.474999999999998 28.38 27.265 23.880000000000003 135-139 20.880000000000003 27.93 27.365000000000002 23.825 140-144 20.66 28.549999999999997 27.16 23.630000000000003 145-149 20.935000000000002 28.694999999999997 26.72 23.65 150-151 20.7625 27.787499999999998 27.500000000000004 23.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.0 24 1.5 25 3.0 26 2.0 27 3.0 28 6.5 29 12.0 30 15.0 31 15.5 32 28.5 33 36.0 34 49.5 35 67.0 36 77.0 37 100.5 38 122.5 39 146.0 40 178.0 41 220.5 42 269.0 43 280.5 44 273.0 45 283.0 46 286.0 47 259.0 48 233.0 49 208.5 50 182.5 51 150.5 52 119.5 53 96.5 54 73.5 55 62.5 56 46.0 57 29.5 58 18.0 59 14.0 60 8.5 61 3.0 62 2.0 63 3.5 64 3.0 65 1.5 66 2.0 67 1.5 68 0.5 69 1.5 70 2.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.08 105-109 0.0 110-114 0.145 115-119 0.09 120-124 0.08 125-129 0.01 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.425 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.6 0.0 0.0 0.0 0.0 104-105 0.7124999999999999 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 0.875 0.0 0.0 0.0 0.0 110-111 0.9125000000000001 0.0 0.0 0.0 0.0 112-113 1.0625 0.0 0.0 0.0 0.0 114-115 1.225 0.0 0.0 0.0 0.0 116-117 1.4625 0.0 0.0 0.0 0.0 118-119 1.7125 0.0 0.0 0.0 0.0 120-121 1.95 0.0 0.0 0.0 0.0 122-123 2.175 0.0 0.0 0.0 0.0 124-125 2.3875 0.0 0.0 0.0 0.0 126-127 2.5375 0.0 0.0 0.0 0.0 128-129 2.725 0.0 0.0 0.0 0.0 130-131 3.075 0.0 0.0 0.0 0.0 132-133 3.35 0.0 0.0 0.0 0.0 134-135 3.55 0.0 0.0 0.0 0.0 136-137 3.9125 0.0 0.0 0.0 0.0 138-139 4.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169594 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169594_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5665 33.0 33.0 34.0 32.0 34.0 2 32.90925 33.0 33.0 34.0 32.0 34.0 3 32.905 34.0 33.0 34.0 32.0 34.0 4 32.8965 34.0 33.0 34.0 32.0 34.0 5 32.88525 34.0 33.0 34.0 32.0 34.0 6 37.13675 38.0 38.0 38.0 37.0 38.0 7 37.1635 38.0 38.0 38.0 37.0 38.0 8 37.05325 38.0 38.0 38.0 37.0 38.0 9 37.07375 38.0 38.0 38.0 37.0 38.0 10-14 37.044349999999994 38.0 38.0 38.0 36.8 38.0 15-19 36.961149999999996 38.0 38.0 38.0 36.2 38.0 20-24 36.9591 38.0 38.0 38.0 36.4 38.0 25-29 36.9769 38.0 38.0 38.0 36.2 38.0 30-34 36.92435 38.0 38.0 38.0 36.2 38.0 35-39 36.8452 38.0 38.0 38.0 36.0 38.0 40-44 36.779650000000004 38.0 38.0 38.0 36.0 38.0 45-49 36.8058 38.0 38.0 38.0 36.0 38.0 50-54 36.554449999999996 38.0 38.0 38.0 35.8 38.0 55-59 36.094649999999994 38.0 38.0 38.0 34.2 38.0 60-64 35.740700000000004 38.0 38.0 38.0 33.6 38.0 65-69 35.60995 38.0 38.0 38.0 33.2 38.0 70-74 35.4405 38.0 38.0 38.0 32.2 38.0 75-79 35.389500000000005 38.0 38.0 38.0 31.0 38.0 80-84 35.5163 38.0 38.0 38.0 32.6 38.0 85-89 35.56510000000001 38.0 38.0 38.0 32.6 38.0 90-94 35.5476 38.0 38.0 38.0 31.8 38.0 95-99 35.4336 38.0 38.0 38.0 31.0 38.0 100-104 35.2045 38.0 37.2 38.0 29.6 38.0 105-109 35.040549999999996 38.0 37.0 38.0 28.6 38.0 110-114 35.0534 38.0 37.0 38.0 29.0 38.0 115-119 34.8841 38.0 37.0 38.0 28.2 38.0 120-124 34.5688 38.0 36.0 38.0 25.8 38.0 125-129 34.39135 38.0 36.0 38.0 25.4 38.0 130-134 33.98609999999999 38.0 35.6 38.0 21.0 38.0 135-139 33.474849999999996 38.0 35.0 38.0 14.8 38.0 140-144 33.0664 38.0 35.0 38.0 14.0 38.0 145-149 32.0961 38.0 33.6 38.0 6.4 38.0 150-151 28.157375000000002 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 7.0 4 2.0 5 2.0 6 1.0 7 4.0 8 2.0 9 1.0 10 4.0 11 4.0 12 11.0 13 30.0 14 31.0 15 3.0 16 3.0 17 8.0 18 8.0 19 8.0 20 16.0 21 11.0 22 17.0 23 22.0 24 14.0 25 30.0 26 26.0 27 30.0 28 54.0 29 39.0 30 53.0 31 59.0 32 78.0 33 83.0 34 133.0 35 228.0 36 473.0 37 2504.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.75409836065574 21.94199243379571 13.720050441361916 29.583858764186633 2 27.55 26.55 29.15 16.75 3 19.7 28.7 31.624999999999996 19.975 4 22.975 31.924999999999997 24.85 20.25 5 24.05 34.175 23.95 17.825 6 20.8 37.974999999999994 23.95 17.275 7 20.674999999999997 22.325 37.0 20.0 8 20.75 26.35 27.950000000000003 24.95 9 21.325 24.625 29.575000000000003 24.474999999999998 10-14 23.040368165674554 28.988044620079034 26.807063178430298 21.164524035816118 15-19 23.595 28.505000000000003 27.6 20.3 20-24 23.44 28.470000000000002 27.51 20.580000000000002 25-29 22.75 28.084999999999997 28.04 21.125 30-34 22.8 28.62 27.584999999999997 20.995 35-39 23.645 28.139999999999997 27.689999999999998 20.525 40-44 22.93 28.17 27.93 20.97 45-49 23.794999999999998 28.360000000000003 27.63 20.215 50-54 23.42578144662002 27.5481955000755 28.393818895656114 20.632204157648363 55-59 23.101571639285893 28.325110625095366 27.54692029906922 21.026397436549516 60-64 23.467295468525734 27.84498667213451 27.988517531269224 20.699200328070535 65-69 23.78795676788471 27.967061245496655 27.47812660833762 20.76685537828101 70-74 23.50971198928332 27.99732083054253 27.956102838889173 20.53686434128497 75-79 23.456026394473657 27.657490462934327 28.472007423445717 20.414475719146306 80-84 23.92251319633065 27.89422436324502 27.940347460667248 20.242914979757085 85-89 23.346263781135157 27.720498162515312 28.215598203348307 20.717639853001224 90-94 23.533601261637077 27.689881467161825 27.827237116548815 20.949280154652286 95-99 23.62656909081669 28.15978045433755 27.880266300757228 20.33338415408853 100-104 23.816530519052208 27.890811304480184 28.032878380435335 20.25977979603227 105-109 23.807109172962832 28.228791643425787 27.42761523249328 20.536483951118097 110-114 23.74734284846644 27.598947261868613 28.165806255693898 20.48790363397105 115-119 24.714155620762927 27.633309723768086 27.466356369523425 20.186178285945562 120-124 24.297178620097913 28.011911371321858 27.8352596779892 19.855650330591025 125-129 24.473537321763843 28.172730501852133 27.24412645252956 20.109605723854468 130-134 24.714751426242866 27.8321108394458 26.905052974735128 20.548084759576202 135-139 23.92807745504841 27.29880641360586 28.07233236002254 20.700783771323188 140-144 24.368369804745555 28.627069133398248 26.536155383590426 20.46840567826577 145-149 25.172591447707365 28.444100978876868 26.97063369397218 19.412673879443588 150-151 25.01619380748802 27.555382821609015 27.710843373493976 19.71757999740899 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 1.0 17 1.5 18 2.0 19 3.5 20 6.5 21 8.0 22 7.0 23 8.0 24 7.5 25 6.5 26 11.5 27 11.5 28 10.0 29 10.5 30 14.0 31 19.0 32 22.5 33 35.5 34 52.0 35 68.5 36 79.0 37 102.0 38 139.5 39 167.5 40 203.0 41 225.0 42 236.0 43 281.5 44 291.0 45 273.5 46 271.5 47 262.5 48 242.5 49 200.5 50 152.0 51 126.5 52 116.5 53 89.0 54 61.5 55 46.0 56 32.0 57 22.5 58 20.5 59 15.0 60 7.5 61 5.0 62 6.0 63 4.0 64 3.5 65 3.0 66 1.5 67 1.0 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8750000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.045 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.6649999999999999 55-59 1.695 60-64 2.46 65-69 2.85 70-74 2.955 75-79 3.01 80-84 2.435 85-89 2.04 90-94 1.7149999999999999 95-99 1.6150000000000002 100-104 1.455 105-109 1.395 110-114 1.21 115-119 1.17 120-124 0.935 125-129 1.465 130-134 1.8399999999999999 135-139 2.395 140-144 2.435 145-149 2.9499999999999997 150-151 3.5125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.025 0.0 84-85 0.16249999999999998 0.0 0.0 0.025 0.0 86-87 0.2 0.0 0.0 0.025 0.0 88-89 0.2375 0.0 0.0 0.025 0.0 90-91 0.3125 0.0 0.0 0.025 0.0 92-93 0.325 0.0 0.0 0.025 0.0 94-95 0.325 0.0 0.0 0.025 0.0 96-97 0.3875 0.0 0.0 0.025 0.0 98-99 0.45 0.0 0.0 0.025 0.0 100-101 0.575 0.0 0.0 0.025 0.0 102-103 0.6125 0.0 0.0 0.025 0.0 104-105 0.7124999999999999 0.0 0.0 0.025 0.0 106-107 0.825 0.0 0.0 0.025 0.0 108-109 0.9 0.0 0.0 0.025 0.0 110-111 0.95 0.0 0.0 0.025 0.0 112-113 1.1124999999999998 0.0 0.0 0.025 0.0 114-115 1.3 0.0 0.0 0.025 0.0 116-117 1.525 0.0 0.0 0.025 0.0 118-119 1.7625 0.0 0.0 0.025 0.0 120-121 2.0 0.0 0.0 0.025 0.0 122-123 2.2 0.0 0.0 0.025 0.0 124-125 2.3625 0.0 0.0 0.025 0.0 126-127 2.5125 0.0 0.0 0.025 0.0 128-129 2.7 0.0 0.0 0.025 0.0 130-131 3.0625 0.0 0.0 0.025 0.0 132-133 3.375 0.0 0.0 0.025 0.0 134-135 3.5999999999999996 0.0 0.0 0.025 0.0 136-137 3.9625 0.0 0.0 0.025 0.0 138-139 4.325 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAGATC 10 0.00656228 146.91026 145 >>END_MODULE Read 942721 spots for SRR7169594.sra Written 942721 spots for SRR7169594.sra Read 942721 spots for SRR7169594.sra Written 942721 spots for SRR7169594.sra Read 942721 spots for SRR7169594.sra Written 942721 spots for SRR7169594.sra Read 942721 spots for SRR7169594.sra Written 942721 spots for SRR7169594.sra Read 942721 spots for SRR7169594.sra Written 942721 spots for SRR7169594.sra Read 942721 spots for SRR7169594.sra Written 942721 spots for SRR7169594.sra Read 942721 spots for SRR7169594.sra Written 942721 spots for SRR7169594.sra Read 942721 spots for SRR7169594.sra Written 942721 spots for SRR7169594.sra Read 942721 spots for SRR7169594.sra Written 942721 spots for SRR7169594.sra Read 942721 spots for SRR7169594.sra Written 942721 spots for SRR7169594.sra Read 942721 spots for SRR7169594.sra Written 942721 spots for SRR7169594.sra Read 942721 spots for SRR7169594.sra Written 942721 spots for SRR7169594.sra Read 942721 spots for SRR7169594.sra Written 942721 spots for SRR7169594.sra Read 942721 spots for SRR7169594.sra Written 942721 spots for SRR7169594.sra Read 942721 spots for SRR7169594.sra Written 942721 spots for SRR7169594.sra Read 942721 spots for SRR7169594.sra Written 942721 spots for SRR7169594.sra Read 942721 spots for SRR7169594.sra Written 942721 spots for SRR7169594.sra Read 942721 spots for SRR7169594.sra Written 942721 spots for SRR7169594.sra Read 942721 spots for SRR7169594.sra Written 942721 spots for SRR7169594.sra Read 942722 spots for SRR7169594.sra Written 942722 spots for SRR7169594.sra SRR ids: ['SRR7169594.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_peimz4ay SRR7169594.sra spots: 18854421 blocks: [[1, 942721], [942722, 1885442], [1885443, 2828163], [2828164, 3770884], [3770885, 4713605], [4713606, 5656326], [5656327, 6599047], [6599048, 7541768], [7541769, 8484489], [8484490, 9427210], [9427211, 10369931], [10369932, 11312652], [11312653, 12255373], [12255374, 13198094], [13198095, 14140815], [14140816, 15083536], [15083537, 16026257], [16026258, 16968978], [16968979, 17911699], [17911700, 18854421]] SRR7169594 file size 6367444 SRR7169594 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169594 SRR7169594_1.fastq SRR7169594_2.fastq Input file: SRR7169594_1.fastq Paired file: SRR7169594_2.fastq trimmed: SRR7169594-trimmed-pair1.fastq, SRR7169594-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 08:30:02 2025 >> started Tue Feb 11 08:30:25 2025 >> done (23.161s) 18854421 read pairs processed; of these: 13771 ( 0.07%) short read pairs filtered out after trimming by size control 11032 ( 0.06%) empty read pairs filtered out after trimming by size control 18829618 (99.87%) read pairs available; of these: 9953399 (52.86%) trimmed read pairs available after processing 8876219 (47.14%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 7 0.00% 20 4 0.00% 21 2 0.00% 22 8 0.00% 23 6 0.00% 24 7 0.00% 25 4 0.00% 26 4 0.00% 27 10 0.00% 28 5 0.00% 29 7 0.00% 30 15 0.00% 31 13 0.00% 32 11 0.00% 33 13 0.00% 34 15 0.00% 35 26 0.00% 36 22 0.00% 37 26 0.00% 38 22 0.00% 39 20 0.00% 40 41 0.00% 41 39 0.00% 42 43 0.00% 43 46 0.00% 44 49 0.00% 45 55 0.00% 46 43 0.00% 47 67 0.00% 48 76 0.00% 49 83 0.00% 50 78 0.00% 51 98 0.00% 52 110 0.00% 53 114 0.00% 54 124 0.00% 55 142 0.00% 56 175 0.00% 57 198 0.00% 58 213 0.00% 59 224 0.00% 60 277 0.00% 61 294 0.00% 62 340 0.00% 63 374 0.00% 64 407 0.00% 65 487 0.00% 66 532 0.00% 67 625 0.00% 68 720 0.00% 69 925 0.00% 70 992 0.01% 71 1027 0.01% 72 1263 0.01% 73 1371 0.01% 74 1564 0.01% 75 2175 0.01% 76 1859 0.01% 77 1479 0.01% 78 1920 0.01% 79 3407 0.02% 80 5473 0.03% 81 2151 0.01% 82 2423 0.01% 83 2828 0.02% 84 3606 0.02% 85 4204 0.02% 86 4777 0.03% 87 5015 0.03% 88 5184 0.03% 89 5733 0.03% 90 6163 0.03% 91 6800 0.04% 92 7465 0.04% 93 7901 0.04% 94 8718 0.05% 95 9550 0.05% 96 10466 0.06% 97 11684 0.06% 98 13526 0.07% 99 18254 0.10% 100 22093 0.12% 101 15727 0.08% 102 13945 0.07% 103 14186 0.08% 104 15058 0.08% 105 16321 0.09% 106 17172 0.09% 107 17932 0.10% 108 18841 0.10% 109 19982 0.11% 110 20882 0.11% 111 22173 0.12% 112 23400 0.12% 113 24814 0.13% 114 25967 0.14% 115 27338 0.15% 116 29129 0.15% 117 30169 0.16% 118 31584 0.17% 119 32905 0.17% 120 34081 0.18% 121 35967 0.19% 122 37388 0.20% 123 39918 0.21% 124 42271 0.22% 125 44557 0.24% 126 47380 0.25% 127 49321 0.26% 128 51487 0.27% 129 54366 0.29% 130 57370 0.30% 131 60960 0.32% 132 64525 0.34% 133 69238 0.37% 134 73677 0.39% 135 79199 0.42% 136 86184 0.46% 137 92687 0.49% 138 101963 0.54% 139 112382 0.60% 140 123272 0.65% 141 135150 0.72% 142 151705 0.81% 143 171840 0.91% 144 202727 1.08% 145 249072 1.32% 146 309617 1.64% 147 423830 2.25% 148 638437 3.39% 149 1181984 6.28% 150 4524998 24.03% 151 8876219 47.14% 18829618 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=42 prefix-density=0.19 prefix-fanout=2.1 sequence=TTATTAAACCACTAGCTAGA criterion=fanout-score sequence-density=0.10 sequence-density-rank=22 fanout-score=272.11 fanout-score-rank=1 prefix-density=0.90 prefix-fanout=29.0 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.54 fanout-score-rank=35 prefix-density=0.36 prefix-fanout=2.3 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.11 sequence-density-rank=16 fanout-score=266.00 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=29.1 sequence=AAGAAGAAGAAA SRR7169594 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 08:31:10 Started mapping on | Feb 11 08:31:10 Finished on | Feb 11 08:33:16 Mapping speed, Million of reads per hour | 537.99 Number of input reads | 18829618 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 17925200 Uniquely mapped reads % | 95.20% Average mapped length | 293.95 Number of splices: Total | 17296502 Number of splices: Annotated (sjdb) | 16995892 Number of splices: GT/AG | 17036789 Number of splices: GC/AG | 204291 Number of splices: AT/AC | 13643 Number of splices: Non-canonical | 41779 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 340700 % of reads mapped to multiple loci | 1.81% Number of reads mapped to too many loci | 116062 % of reads mapped to too many loci | 0.62% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.27% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 578564 578564 578564 N_multimapping 340700 340700 340700 N_noFeature 386737 17725842 489045 N_ambiguous 173093 1403 74948 UnstrandedReadsAssigned:17365370 PositiveStrandReadsAssigned:197955 NegativeStrandReadsAssigned:17361207 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7169594 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169594-trimmed-pair1.fastq SRR7169594-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,829,618 reads, 17,338,787 reads pseudoaligned [quant] estimated average fragment length: 254.307 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,257 rounds 52401 SRR7169594.ke.tsv 34699 SRR7169594.se.tsv 87100 total ==> SRR7169594.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1764.69 314 9.97547 Potri.005G024800.1.v4.1 1035 781.693 35 2.51018 Potri.004G059700.1.v4.1 961 707.777 10 0.792093 Potri.007G009000.2.v4.1 1416 1162.69 0 0 Potri.003G141000.2.v4.1 2943 2689.69 346.069 7.21328 Potri.016G087400.1.v4.1 270 74.7072 1914 1436.32 Potri.015G069301.1.v4.1 564 317.504 0 0 Potri.010G195200.1.v4.1 1773 1519.69 46 1.69697 Potri.012G127500.1.v4.1 977 723.754 6238 483.2 ==> SRR7169594.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1599 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 344 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169594 completed mapping pipeline successfully