Starting /dee2/code/volunteer_pipeline.sh SRR7169595 current disk space = 3055780114432 free memory = 1509258892 SRR7169595 SRAfilesize f7b9b56eb9bf43b72481b1eb929715b8 SRR7169595.sra SRR7169595.sra file validated SRR7169595 is paired end SRR7169595 is conventional basespace SRR7169595 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169595_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.764 34.0 33.0 34.0 32.0 34.0 2 33.30975 34.0 33.0 34.0 33.0 34.0 3 33.36275 34.0 33.0 34.0 33.0 34.0 4 33.35225 34.0 33.0 34.0 33.0 34.0 5 33.42825 34.0 33.0 34.0 33.0 34.0 6 36.96775 38.0 37.0 38.0 36.0 38.0 7 37.23025 38.0 38.0 38.0 36.0 38.0 8 37.33275 38.0 38.0 38.0 37.0 38.0 9 37.46475 38.0 38.0 38.0 37.0 38.0 10-14 37.41575 38.0 38.0 38.0 37.0 38.0 15-19 37.38365 38.0 38.0 38.0 37.0 38.0 20-24 37.352850000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.32425 38.0 38.0 38.0 37.0 38.0 30-34 37.26485 38.0 38.0 38.0 37.0 38.0 35-39 37.170249999999996 38.0 38.0 38.0 36.8 38.0 40-44 37.04730000000001 38.0 38.0 38.0 36.0 38.0 45-49 36.91755 38.0 38.0 38.0 35.6 38.0 50-54 36.78445 38.0 38.0 38.0 35.0 38.0 55-59 36.7682 38.0 38.0 38.0 35.0 38.0 60-64 36.705400000000004 38.0 38.0 38.0 34.8 38.0 65-69 36.61195 38.0 38.0 38.0 34.2 38.0 70-74 36.580349999999996 38.0 38.0 38.0 34.2 38.0 75-79 36.4326 38.0 38.0 38.0 34.0 38.0 80-84 36.2868 38.0 38.0 38.0 34.0 38.0 85-89 36.1058 38.0 37.4 38.0 33.0 38.0 90-94 36.05395 38.0 37.0 38.0 33.0 38.0 95-99 35.98515 38.0 37.0 38.0 33.0 38.0 100-104 35.58945 38.0 36.8 38.0 30.2 38.0 105-109 35.4157 38.0 36.6 38.0 29.8 38.0 110-114 35.26105 38.0 36.2 38.0 28.8 38.0 115-119 34.9334 38.0 35.8 38.0 27.6 38.0 120-124 34.65805 38.0 35.2 38.0 26.6 38.0 125-129 34.347049999999996 38.0 35.0 38.0 24.0 38.0 130-134 34.13605 38.0 35.0 38.0 23.2 38.0 135-139 33.86865 38.0 34.8 38.0 22.6 38.0 140-144 33.33970000000001 38.0 34.2 38.0 17.4 38.0 145-149 32.48065 38.0 33.6 38.0 11.8 38.0 150-151 28.619500000000002 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 3.0 11 2.0 12 2.0 13 2.0 14 3.0 15 2.0 16 2.0 17 3.0 18 13.0 19 9.0 20 10.0 21 8.0 22 9.0 23 23.0 24 21.0 25 18.0 26 23.0 27 22.0 28 26.0 29 51.0 30 47.0 31 74.0 32 88.0 33 115.0 34 174.0 35 349.0 36 775.0 37 2125.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.07927606423655 13.484578128982921 8.845271475911293 34.590874330869234 2 23.724999999999998 13.65 32.05 30.575000000000003 3 21.8 17.325 24.349999999999998 36.525 4 21.65 26.1 23.849999999999998 28.4 5 23.599999999999998 29.425 23.474999999999998 23.5 6 20.549999999999997 35.675000000000004 22.0 21.775 7 14.625 28.499999999999996 39.300000000000004 17.575 8 17.599999999999998 27.125 30.425 24.85 9 16.85 25.324999999999996 33.675 24.15 10-14 19.689999999999998 29.755 27.37 23.185 15-19 19.915 29.299999999999997 27.245 23.54 20-24 19.785 28.860000000000003 27.639999999999997 23.715 25-29 19.095000000000002 29.17 27.42 24.315 30-34 19.62 29.43 27.305 23.645 35-39 20.53 29.075 26.889999999999997 23.505000000000003 40-44 19.72 28.89 27.375 24.015 45-49 20.105 29.044999999999998 27.46 23.39 50-54 20.175 28.044999999999998 27.955000000000002 23.825 55-59 20.25 28.285 27.405 24.060000000000002 60-64 20.18 28.835 27.029999999999998 23.955000000000002 65-69 20.48 28.9 26.945000000000004 23.674999999999997 70-74 20.19 28.985 27.215 23.61 75-79 19.695 28.13 27.485 24.69 80-84 20.895 28.37 27.24 23.494999999999997 85-89 20.035 28.26 27.345000000000002 24.36 90-94 20.43 28.875 27.01 23.685000000000002 95-99 20.265 28.375 27.139999999999997 24.22 100-104 20.552331398839303 29.357614568741248 26.575945567340405 23.514108465079048 105-109 20.13 28.845 26.97 24.055 110-114 20.356285028022416 28.307646116893515 27.091673338670937 24.24439551641313 115-119 20.66119835950785 28.50855256576973 27.00810243072922 23.822146643993197 120-124 20.712427456473883 28.99739843906344 26.58595157094257 23.70422253352011 125-129 20.91 28.375 26.729999999999997 23.985 130-134 21.19347739095638 28.316326530612244 27.050820328131252 23.43937575030012 135-139 21.16 27.92 27.765 23.155 140-144 20.635 28.715000000000003 26.815 23.835 145-149 20.66 28.585 26.99 23.765 150-151 19.8 28.9875 26.35 24.8625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.5 22 1.0 23 0.0 24 0.5 25 1.0 26 3.0 27 6.0 28 9.0 29 14.5 30 21.5 31 25.5 32 27.0 33 41.5 34 58.5 35 68.5 36 83.5 37 103.0 38 130.0 39 158.0 40 177.0 41 190.0 42 215.5 43 257.0 44 273.5 45 265.0 46 267.0 47 269.5 48 245.5 49 203.5 50 169.0 51 150.0 52 126.0 53 105.5 54 89.0 55 61.0 56 41.0 57 31.5 58 24.5 59 23.0 60 19.5 61 11.0 62 8.5 63 6.5 64 5.5 65 4.0 66 1.0 67 0.0 68 0.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.925 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.06 105-109 0.0 110-114 0.08 115-119 0.03 120-124 0.06 125-129 0.0 130-134 0.04 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54785229841748 99.075 2 0.42702838482793265 0.8500000000000001 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0125 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0125 0.0 78-79 0.025 0.0 0.0 0.025 0.0 80-81 0.025 0.0 0.0 0.025 0.0 82-83 0.025 0.0 0.0 0.025 0.0 84-85 0.025 0.0 0.0 0.025 0.0 86-87 0.05 0.0 0.0 0.025 0.0 88-89 0.0875 0.0 0.0 0.025 0.0 90-91 0.15 0.0 0.0 0.025 0.0 92-93 0.2 0.0 0.0 0.025 0.0 94-95 0.225 0.0 0.0 0.025 0.0 96-97 0.275 0.0 0.0 0.025 0.0 98-99 0.325 0.0 0.0 0.025 0.0 100-101 0.38749999999999996 0.0 0.0 0.025 0.0 102-103 0.475 0.0 0.0 0.025 0.0 104-105 0.6125 0.0 0.0 0.025 0.0 106-107 0.675 0.0 0.0 0.025 0.0 108-109 0.8 0.0 0.0 0.025 0.0 110-111 0.9625 0.0 0.0 0.025 0.0 112-113 1.0375 0.0 0.0 0.025 0.0 114-115 1.1125 0.0 0.0 0.025 0.0 116-117 1.2875 0.0 0.0 0.025 0.0 118-119 1.4125 0.0 0.0 0.025 0.0 120-121 1.6125 0.0 0.0 0.025 0.0 122-123 1.8125 0.0 0.0 0.025 0.0 124-125 2.0125 0.0 0.0 0.025 0.0 126-127 2.325 0.0 0.0 0.025 0.0 128-129 2.6625 0.0 0.0 0.025 0.0 130-131 2.9000000000000004 0.0 0.0 0.025 0.0 132-133 3.1125 0.0 0.0 0.025 0.0 134-135 3.3125 0.0 0.0 0.025 0.0 136-137 3.7 0.0 0.0 0.025 0.0 138-139 3.95 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTTCAA 10 0.0068573058 144.8125 5 >>END_MODULE SRR7169595 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169595_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.47375 33.0 33.0 34.0 32.0 34.0 2 32.6745 33.0 33.0 34.0 32.0 34.0 3 32.7755 33.0 33.0 34.0 32.0 34.0 4 32.71575 34.0 33.0 34.0 32.0 34.0 5 32.70475 34.0 33.0 34.0 32.0 34.0 6 36.85725 38.0 38.0 38.0 36.0 38.0 7 36.90675 38.0 38.0 38.0 36.0 38.0 8 36.86075 38.0 38.0 38.0 36.0 38.0 9 36.826 38.0 38.0 38.0 36.0 38.0 10-14 36.7393 38.0 38.0 38.0 35.8 38.0 15-19 36.8028 38.0 38.0 38.0 36.0 38.0 20-24 36.83095 38.0 38.0 38.0 36.0 38.0 25-29 36.83265 38.0 38.0 38.0 36.0 38.0 30-34 36.88745 38.0 38.0 38.0 36.0 38.0 35-39 36.7328 38.0 38.0 38.0 35.8 38.0 40-44 36.74145 38.0 38.0 38.0 36.0 38.0 45-49 36.712650000000004 38.0 38.0 38.0 35.6 38.0 50-54 36.50675 38.0 38.0 38.0 35.2 38.0 55-59 36.105399999999996 38.0 38.0 38.0 34.0 38.0 60-64 35.84165 38.0 38.0 38.0 33.6 38.0 65-69 35.79425 38.0 38.0 38.0 33.8 38.0 70-74 35.630449999999996 38.0 38.0 38.0 33.0 38.0 75-79 35.521100000000004 38.0 38.0 38.0 32.4 38.0 80-84 35.522149999999996 38.0 38.0 38.0 31.6 38.0 85-89 35.64985 38.0 38.0 38.0 32.4 38.0 90-94 35.62405 38.0 38.0 38.0 32.4 38.0 95-99 35.52905 38.0 38.0 38.0 31.4 38.0 100-104 35.33585000000001 38.0 37.4 38.0 30.0 38.0 105-109 35.278499999999994 38.0 37.2 38.0 29.8 38.0 110-114 35.16265 38.0 37.2 38.0 29.8 38.0 115-119 34.793749999999996 38.0 37.0 38.0 27.2 38.0 120-124 34.567449999999994 38.0 36.0 38.0 26.2 38.0 125-129 34.4427 38.0 36.0 38.0 25.2 38.0 130-134 33.9171 38.0 35.2 38.0 22.2 38.0 135-139 33.446349999999995 38.0 35.0 38.0 15.0 38.0 140-144 33.0229 38.0 35.0 38.0 14.0 38.0 145-149 32.13245 38.0 33.8 38.0 6.4 38.0 150-151 28.414749999999998 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 2.0 4 2.0 5 2.0 6 3.0 7 1.0 8 3.0 9 3.0 10 3.0 11 6.0 12 12.0 13 24.0 14 16.0 15 6.0 16 2.0 17 7.0 18 10.0 19 12.0 20 11.0 21 19.0 22 8.0 23 30.0 24 21.0 25 24.0 26 29.0 27 39.0 28 32.0 29 52.0 30 50.0 31 62.0 32 78.0 33 105.0 34 117.0 35 203.0 36 493.0 37 2503.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.264269549911994 23.862207694241892 13.376917274327383 25.49660548151873 2 27.825 27.250000000000004 28.475 16.45 3 20.65 27.975 30.275000000000002 21.099999999999998 4 24.05 32.525 24.4 19.025 5 23.275000000000002 35.975 21.775 18.975 6 20.849999999999998 37.925 23.625 17.599999999999998 7 20.25 22.575 38.35 18.825 8 23.95 25.35 27.125 23.575 9 21.6 26.05 29.9 22.45 10-14 23.88149334400961 28.670803723351018 26.15854268841958 21.289160244219797 15-19 22.825542988689822 28.145330797717943 28.02021819637674 21.008908017215493 20-24 23.255 28.660000000000004 27.224999999999998 20.86 25-29 23.169999999999998 28.43 27.655 20.745 30-34 23.66 27.560000000000002 27.67 21.11 35-39 23.09 28.7 27.11 21.099999999999998 40-44 23.995 27.750000000000004 26.889999999999997 21.365000000000002 45-49 23.32 28.1 27.915 20.665 50-54 23.28361207372809 28.17538044297122 27.42202802470996 21.11897945859073 55-59 24.257024038949186 27.60929100314434 27.391216147682325 20.74246881022416 60-64 23.093004283091982 27.56985519069957 28.105241688761986 21.23189883744646 65-69 23.662015028369883 28.165414302509838 27.480447784082195 20.692122885038085 70-74 23.66576267717341 27.703013866857702 27.800235378396355 20.83098807757253 75-79 23.383212052885106 27.390591370298246 27.995285436097163 21.23091114071948 80-84 23.409032916560346 27.777494258739477 27.655014034192394 21.158458790507783 85-89 24.078024992380374 27.842121304480344 27.532256425886416 20.547597277252873 90-94 23.826404010735807 27.730794551071046 28.014381931432624 20.42841950676052 95-99 24.087923193532088 27.7766548762001 27.609903991915107 20.525517938352703 100-104 23.9830208701804 27.87407145383799 27.7022588306635 20.44064884531811 105-109 23.949707129872753 27.03494243587154 28.37810543324581 20.637245001009894 110-114 24.13549396738856 27.4319753647332 27.744964410116612 20.687566257761624 115-119 23.831139355424423 28.173702526857312 27.452463811973573 20.54269430574469 120-124 24.54866364094806 27.35753908219869 27.70549672213817 20.388300554715077 125-129 24.73575077125373 27.7499620694887 27.390886562484194 20.12340059677338 130-134 25.047013977128334 27.176620076238883 27.390088945362134 20.38627700127065 135-139 24.50500102061645 27.918963053684426 27.286180853235354 20.28985507246377 140-144 24.923344235486507 27.131030253475064 27.60118560915781 20.34443990188062 145-149 24.84217009700765 28.096289072524765 26.900374685623362 20.161166144844223 150-151 24.835759371377044 27.940229292799174 27.56666237279402 19.657348963029754 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 1.5 15 2.5 16 2.0 17 1.5 18 1.5 19 3.0 20 4.0 21 3.5 22 3.0 23 6.5 24 9.5 25 7.0 26 5.5 27 6.0 28 7.5 29 8.5 30 12.5 31 16.5 32 20.5 33 32.0 34 36.0 35 55.5 36 80.5 37 107.0 38 142.0 39 148.5 40 173.5 41 231.0 42 254.0 43 257.0 44 274.0 45 298.5 46 281.0 47 260.5 48 245.5 49 203.5 50 175.0 51 139.0 52 106.5 53 93.0 54 73.5 55 57.0 56 45.5 57 30.5 58 21.0 59 13.0 60 10.5 61 8.5 62 5.0 63 4.5 64 4.0 65 1.5 66 2.0 67 3.0 68 2.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.09 15-19 0.09 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.445 55-59 1.41 60-64 1.94 65-69 2.185 70-74 2.2849999999999997 75-79 2.4299999999999997 80-84 2.025 85-89 1.5699999999999998 90-94 1.265 95-99 1.05 100-104 1.055 105-109 0.98 110-114 0.955 115-119 0.865 120-124 0.8500000000000001 125-129 1.135 130-134 1.625 135-139 2.02 140-144 2.16 145-149 2.585 150-151 2.9625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44681921046015 98.875 2 0.5280362081971335 1.05 3 0.025144581342720643 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.42500000000000004 0.0 0.0 0.0 0.0 104-105 0.5625 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.725 0.0 0.0 0.0 0.0 110-111 0.8875 0.0 0.0 0.0 0.0 112-113 0.9625 0.0 0.0 0.0 0.0 114-115 1.0375 0.0 0.0 0.0 0.0 116-117 1.2125 0.0 0.0 0.0 0.0 118-119 1.3375 0.0 0.0 0.0 0.0 120-121 1.5375 0.0 0.0 0.0 0.0 122-123 1.7000000000000002 0.0 0.0 0.0 0.0 124-125 1.9125 0.0 0.0 0.0 0.0 126-127 2.2625 0.0 0.0 0.0 0.0 128-129 2.5999999999999996 0.0 0.0 0.0 0.0 130-131 2.825 0.0 0.0 0.0 0.0 132-133 3.0375 0.0 0.0 0.0 0.0 134-135 3.2375 0.0 0.0 0.0 0.0 136-137 3.65 0.0 0.0 0.0 0.0 138-139 3.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGAAAT 10 0.007101894 143.125 1 >>END_MODULE Read 839498 spots for SRR7169595.sra Written 839498 spots for SRR7169595.sra Read 839498 spots for SRR7169595.sra Written 839498 spots for SRR7169595.sra Read 839498 spots for SRR7169595.sra Written 839498 spots for SRR7169595.sra Read 839498 spots for SRR7169595.sra Written 839498 spots for SRR7169595.sra Read 839498 spots for SRR7169595.sra Written 839498 spots for SRR7169595.sra Read 839498 spots for SRR7169595.sra Written 839498 spots for SRR7169595.sra Read 839500 spots for SRR7169595.sra Written 839500 spots for SRR7169595.sra Read 839498 spots for SRR7169595.sra Written 839498 spots for SRR7169595.sra Read 839498 spots for SRR7169595.sra Written 839498 spots for SRR7169595.sra Read 839498 spots for SRR7169595.sra Written 839498 spots for SRR7169595.sra Read 839498 spots for SRR7169595.sra Written 839498 spots for SRR7169595.sra Read 839498 spots for SRR7169595.sra Written 839498 spots for SRR7169595.sra Read 839498 spots for SRR7169595.sra Written 839498 spots for SRR7169595.sra Read 839498 spots for SRR7169595.sra Written 839498 spots for SRR7169595.sra Read 839498 spots for SRR7169595.sra Written 839498 spots for SRR7169595.sra Read 839498 spots for SRR7169595.sra Written 839498 spots for SRR7169595.sra Read 839498 spots for SRR7169595.sra Written 839498 spots for SRR7169595.sra Read 839498 spots for SRR7169595.sra Written 839498 spots for SRR7169595.sra Read 839498 spots for SRR7169595.sra Written 839498 spots for SRR7169595.sra Read 839498 spots for SRR7169595.sra Written 839498 spots for SRR7169595.sra SRR ids: ['SRR7169595.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kvbxravo SRR7169595.sra spots: 16789962 blocks: [[1, 839498], [839499, 1678996], [1678997, 2518494], [2518495, 3357992], [3357993, 4197490], [4197491, 5036988], [5036989, 5876486], [5876487, 6715984], [6715985, 7555482], [7555483, 8394980], [8394981, 9234478], [9234479, 10073976], [10073977, 10913474], [10913475, 11752972], [11752973, 12592470], [12592471, 13431968], [13431969, 14271466], [14271467, 15110964], [15110965, 15950462], [15950463, 16789962]] SRR7169595 file size 5667866 SRR7169595 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169595 SRR7169595_1.fastq SRR7169595_2.fastq Input file: SRR7169595_1.fastq Paired file: SRR7169595_2.fastq trimmed: SRR7169595-trimmed-pair1.fastq, SRR7169595-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 08:44:07 2025 >> started Tue Feb 11 08:44:25 2025 >> done (17.700s) 16789962 read pairs processed; of these: 17793 ( 0.11%) short read pairs filtered out after trimming by size control 15286 ( 0.09%) empty read pairs filtered out after trimming by size control 16756883 (99.80%) read pairs available; of these: 9323595 (55.64%) trimmed read pairs available after processing 7433288 (44.36%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 8 0.00% 20 3 0.00% 21 5 0.00% 22 3 0.00% 23 4 0.00% 24 6 0.00% 25 5 0.00% 26 5 0.00% 27 10 0.00% 28 7 0.00% 29 10 0.00% 30 14 0.00% 31 15 0.00% 32 12 0.00% 33 18 0.00% 34 18 0.00% 35 13 0.00% 36 20 0.00% 37 18 0.00% 38 16 0.00% 39 22 0.00% 40 35 0.00% 41 26 0.00% 42 32 0.00% 43 38 0.00% 44 33 0.00% 45 37 0.00% 46 45 0.00% 47 52 0.00% 48 53 0.00% 49 90 0.00% 50 78 0.00% 51 99 0.00% 52 98 0.00% 53 85 0.00% 54 116 0.00% 55 121 0.00% 56 146 0.00% 57 159 0.00% 58 166 0.00% 59 207 0.00% 60 223 0.00% 61 258 0.00% 62 257 0.00% 63 305 0.00% 64 358 0.00% 65 438 0.00% 66 507 0.00% 67 544 0.00% 68 669 0.00% 69 828 0.00% 70 1051 0.01% 71 1070 0.01% 72 1127 0.01% 73 1215 0.01% 74 1431 0.01% 75 1843 0.01% 76 1649 0.01% 77 1430 0.01% 78 1869 0.01% 79 2982 0.02% 80 4447 0.03% 81 2207 0.01% 82 2546 0.02% 83 2924 0.02% 84 3978 0.02% 85 4564 0.03% 86 5453 0.03% 87 5775 0.03% 88 5802 0.03% 89 6163 0.04% 90 6401 0.04% 91 6755 0.04% 92 7454 0.04% 93 8242 0.05% 94 8670 0.05% 95 9654 0.06% 96 10436 0.06% 97 11501 0.07% 98 12492 0.07% 99 15323 0.09% 100 18454 0.11% 101 16323 0.10% 102 14195 0.08% 103 14612 0.09% 104 15651 0.09% 105 16594 0.10% 106 17770 0.11% 107 18468 0.11% 108 19339 0.12% 109 20096 0.12% 110 20787 0.12% 111 22117 0.13% 112 23587 0.14% 113 24720 0.15% 114 26121 0.16% 115 27319 0.16% 116 28719 0.17% 117 30058 0.18% 118 31677 0.19% 119 32866 0.20% 120 34285 0.20% 121 35624 0.21% 122 37688 0.22% 123 39551 0.24% 124 41871 0.25% 125 43965 0.26% 126 46469 0.28% 127 49165 0.29% 128 50473 0.30% 129 52734 0.31% 130 55818 0.33% 131 58698 0.35% 132 61900 0.37% 133 66750 0.40% 134 71485 0.43% 135 76523 0.46% 136 81761 0.49% 137 88596 0.53% 138 96182 0.57% 139 106296 0.63% 140 115401 0.69% 141 124887 0.75% 142 139221 0.83% 143 157938 0.94% 144 186108 1.11% 145 223748 1.34% 146 282972 1.69% 147 383504 2.29% 148 584549 3.49% 149 1143010 6.82% 150 4184156 24.97% 151 7433288 44.36% 16756883 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=37 prefix-density=0.25 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=135.41 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=9.8 sequence=ATATTCATCATAACTCAATTACATTATTCTCACCCAGAACATCTCTTCCAGCAATAGATACAAACCATGGCAATTAACTAGAGCAGAACATCATTTCACAAGGTTTATAAGGAAAGAGACCTCCTTGACTTGGACAAACACTCGTCTATAAGAAACACCCAAATTTCCAACTATTCGGCTGTTTATTTCATTAATAACTGGAGAGCAGGAGATGCCAGTGCCTCAGACAAACTGATCAAGGTACTCTTCCACGGTGGTATATTTGACATCTGGATATAGCTCAGAGGCCTCAAGCCCCCATGATGGGTCAATCTCAAAGTTGGTCATGTCACCATTAACGAGGGCTGAGTGGTTGATTGACAGAACAATATTAATCGGAATCGGAGACTCTTGGATGTCCTTCAGAAGTTTCTCTTCAGGAACAAAGGTTTTTTCGAGGGTTTTGCCAATCTTTTTCTCCCATAGATCAATAAGCTCATTGAATGAGTAGGTGTTTTTAGGAGGCTTGATT criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=42 prefix-density=0.25 prefix-fanout=2.0 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.08 sequence-density-rank=32 fanout-score=34.80 fanout-score-rank=1 prefix-density=0.35 prefix-fanout=8.3 sequence=AAGGAAGATGCTGCCAACAACTTTGCCCGTGGCCACTATACCAT SRR7169595 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 08:45:08 Started mapping on | Feb 11 08:45:08 Finished on | Feb 11 08:46:57 Mapping speed, Million of reads per hour | 553.44 Number of input reads | 16756883 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 15833654 Uniquely mapped reads % | 94.49% Average mapped length | 293.33 Number of splices: Total | 14665925 Number of splices: Annotated (sjdb) | 14417955 Number of splices: GT/AG | 14457374 Number of splices: GC/AG | 163660 Number of splices: AT/AC | 12539 Number of splices: Non-canonical | 32352 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.03% Deletion average length | 2.82 Insertion rate per base | 0.02% Insertion average length | 2.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 270582 % of reads mapped to multiple loci | 1.61% Number of reads mapped to too many loci | 19608 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.74% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 671416 671416 671416 N_multimapping 270582 270582 270582 N_noFeature 354916 15612648 444461 N_ambiguous 196948 880 64863 UnstrandedReadsAssigned:15281790 PositiveStrandReadsAssigned:220126 NegativeStrandReadsAssigned:15324330 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169595 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169595-trimmed-pair1.fastq SRR7169595-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,756,883 reads, 15,231,270 reads pseudoaligned [quant] estimated average fragment length: 250.307 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,053 rounds 52401 SRR7169595.ke.tsv 34699 SRR7169595.se.tsv 87100 total ==> SRR7169595.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1768.69 305 10.5925 Potri.005G024800.1.v4.1 1035 785.693 21 1.6418 Potri.004G059700.1.v4.1 961 711.735 8 0.690438 Potri.007G009000.2.v4.1 1416 1166.69 0 0 Potri.003G141000.2.v4.1 2943 2693.69 250 5.70092 Potri.016G087400.1.v4.1 270 75.9569 1219.04 985.838 Potri.015G069301.1.v4.1 564 319.804 0 0 Potri.010G195200.1.v4.1 1773 1523.69 27 1.08848 Potri.012G127500.1.v4.1 977 727.709 3535 298.39 ==> SRR7169595.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1278 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 243 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 16 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169595 completed mapping pipeline successfully