Starting /dee2/code/volunteer_pipeline.sh SRR7169596 current disk space = 3055764815872 free memory = 1353252900 SRR7169596 SRAfilesize 2a91017d10b519dd0b820b95f9791f21 SRR7169596.sra SRR7169596.sra file validated SRR7169596 is paired end SRR7169596 is conventional basespace SRR7169596 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169596_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.488 34.0 33.0 34.0 32.0 34.0 2 33.23825 34.0 33.0 34.0 31.0 34.0 3 33.2375 34.0 33.0 34.0 31.0 34.0 4 33.33925 34.0 33.0 34.0 33.0 34.0 5 33.27225 34.0 33.0 34.0 33.0 34.0 6 36.83475 38.0 37.0 38.0 35.0 38.0 7 37.26175 38.0 38.0 38.0 36.0 38.0 8 37.32225 38.0 38.0 38.0 37.0 38.0 9 37.38675 38.0 38.0 38.0 37.0 38.0 10-14 37.4039 38.0 38.0 38.0 37.0 38.0 15-19 37.338699999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.31315 38.0 38.0 38.0 37.0 38.0 25-29 37.2663 38.0 38.0 38.0 36.8 38.0 30-34 37.2039 38.0 38.0 38.0 36.8 38.0 35-39 37.12275 38.0 38.0 38.0 36.4 38.0 40-44 36.75665 38.0 38.0 38.0 34.8 38.0 45-49 36.61280000000001 38.0 38.0 38.0 34.2 38.0 50-54 36.487 38.0 38.0 38.0 34.0 38.0 55-59 36.4234 38.0 37.8 38.0 34.0 38.0 60-64 36.35135 38.0 37.2 38.0 33.8 38.0 65-69 36.260200000000005 38.0 37.2 38.0 33.2 38.0 70-74 36.1921 38.0 37.0 38.0 33.0 38.0 75-79 36.06025 38.0 37.0 38.0 32.6 38.0 80-84 35.9112 38.0 37.0 38.0 31.4 38.0 85-89 35.6926 38.0 37.0 38.0 31.0 38.0 90-94 35.349000000000004 38.0 36.0 38.0 29.0 38.0 95-99 35.38205000000001 38.0 36.0 38.0 29.0 38.0 100-104 34.9914 38.0 36.0 38.0 28.6 38.0 105-109 34.774649999999994 38.0 35.8 38.0 27.0 38.0 110-114 34.3617 38.0 34.8 38.0 25.0 38.0 115-119 34.1734 38.0 35.0 38.0 23.0 38.0 120-124 33.999199999999995 38.0 34.4 38.0 22.6 38.0 125-129 33.3974 38.0 34.0 38.0 17.4 38.0 130-134 33.293549999999996 38.0 33.8 38.0 17.4 38.0 135-139 32.46575 37.6 33.0 38.0 14.6 38.0 140-144 32.0492 37.2 33.0 38.0 14.0 38.0 145-149 30.88795 36.0 31.0 38.0 6.4 38.0 150-151 26.89375 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 2.0 10 0.0 11 1.0 12 5.0 13 2.0 14 5.0 15 5.0 16 10.0 17 8.0 18 8.0 19 15.0 20 9.0 21 16.0 22 8.0 23 14.0 24 15.0 25 25.0 26 36.0 27 38.0 28 38.0 29 60.0 30 66.0 31 82.0 32 137.0 33 127.0 34 229.0 35 468.0 36 1015.0 37 1555.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.57921810699588 12.5 7.741769547325103 33.17901234567901 2 23.775 14.924999999999999 31.775 29.525000000000002 3 20.4 19.75 26.674999999999997 33.175 4 24.025 26.625 22.925 26.424999999999997 5 22.55 32.824999999999996 24.675 19.950000000000003 6 20.025000000000002 33.775 25.074999999999996 21.125 7 15.9 27.150000000000002 38.925 18.025 8 17.025000000000002 26.625 30.8 25.55 9 17.424999999999997 24.2 33.875 24.5 10-14 20.5 29.03 27.3 23.169999999999998 15-19 19.939999999999998 28.235 27.955000000000002 23.87 20-24 20.225 28.51 27.845 23.419999999999998 25-29 19.650000000000002 29.01 27.465 23.875 30-34 20.095 28.634999999999998 27.365000000000002 23.905 35-39 20.150000000000002 28.910000000000004 27.450000000000003 23.49 40-44 20.235 28.875 27.384999999999998 23.505000000000003 45-49 20.06 28.985 27.49 23.465 50-54 19.975 28.660000000000004 27.42 23.945 55-59 20.01 28.565 27.855 23.57 60-64 20.645 28.32 27.485 23.549999999999997 65-69 20.535 28.78 27.29 23.395 70-74 20.424999999999997 28.410000000000004 27.79 23.375 75-79 20.445 28.854999999999997 27.21 23.49 80-84 20.8 28.144999999999996 27.525 23.53 85-89 20.605 28.485 27.139999999999997 23.77 90-94 20.294999999999998 28.599999999999998 27.18 23.925 95-99 20.630000000000003 28.485 27.66 23.225 100-104 20.419005613472333 28.748997594226143 27.24037690457097 23.591619887730552 105-109 20.565 28.48 27.02 23.935000000000002 110-114 19.93875809447317 29.200341348325885 27.122132423071132 23.738768134129813 115-119 20.49984974456576 28.718821997395573 26.850646098367225 23.93068215967144 120-124 20.399779570161815 28.78112319022093 27.188016632433243 23.63108060718401 125-129 20.528740236330865 28.079311035449628 27.36330863208492 24.028640096134588 130-134 20.955 27.955000000000002 27.46 23.630000000000003 135-139 21.060000000000002 28.449999999999996 26.805 23.685000000000002 140-144 20.560000000000002 28.52 27.034999999999997 23.885 145-149 21.115000000000002 29.205 26.31 23.369999999999997 150-151 20.025000000000002 29.562500000000004 25.2625 25.15 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.5 20 1.0 21 1.0 22 3.0 23 3.5 24 2.5 25 3.0 26 3.5 27 6.0 28 8.5 29 13.0 30 25.0 31 26.5 32 28.0 33 42.0 34 55.0 35 68.0 36 77.0 37 92.0 38 113.0 39 154.5 40 183.0 41 201.0 42 237.0 43 260.5 44 273.0 45 294.0 46 271.0 47 238.5 48 232.0 49 199.5 50 177.0 51 167.5 52 139.5 53 110.0 54 80.0 55 51.5 56 40.5 57 28.0 58 23.5 59 17.5 60 7.0 61 4.0 62 8.5 63 10.0 64 5.0 65 2.5 66 2.0 67 1.5 68 0.5 69 1.5 70 2.0 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.8000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.24 105-109 0.0 110-114 0.395 115-119 0.16999999999999998 120-124 0.19499999999999998 125-129 0.13999999999999999 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.32499999999999996 0.0 0.0 0.0 0.0 102-103 0.3875 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.45 0.0 0.0 0.0 0.0 108-109 0.475 0.0 0.0 0.0 0.0 110-111 0.5 0.0 0.0 0.0 0.0 112-113 0.65 0.0 0.0 0.0 0.0 114-115 0.7625 0.0 0.0 0.0 0.0 116-117 0.875 0.0 0.0 0.0 0.0 118-119 1.0499999999999998 0.0 0.0 0.0 0.0 120-121 1.2125 0.0 0.0 0.0 0.0 122-123 1.2625 0.0 0.0 0.0 0.0 124-125 1.4125 0.0 0.0 0.0 0.0 126-127 1.5875 0.0 0.0 0.0 0.0 128-129 1.8125 0.0 0.0 0.0 0.0 130-131 2.0375 0.0 0.0 0.0 0.0 132-133 2.2249999999999996 0.0 0.0 0.0 0.0 134-135 2.45 0.0 0.0 0.0 0.0 136-137 2.6625 0.0 0.0 0.0 0.0 138-139 2.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACTGAG 10 0.0068874825 144.6 5 >>END_MODULE SRR7169596 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169596_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4375 33.0 33.0 34.0 32.0 34.0 2 32.83825 33.0 33.0 34.0 32.0 34.0 3 32.80575 34.0 33.0 34.0 32.0 34.0 4 32.77175 34.0 33.0 34.0 32.0 34.0 5 32.79925 34.0 33.0 34.0 32.0 34.0 6 36.98575 38.0 38.0 38.0 36.0 38.0 7 36.98275 38.0 38.0 38.0 36.0 38.0 8 36.995 38.0 38.0 38.0 36.0 38.0 9 36.7885 38.0 38.0 38.0 36.0 38.0 10-14 36.9006 38.0 38.0 38.0 36.0 38.0 15-19 36.96445 38.0 38.0 38.0 36.0 38.0 20-24 36.8768 38.0 38.0 38.0 36.0 38.0 25-29 36.88225 38.0 38.0 38.0 36.0 38.0 30-34 36.8397 38.0 38.0 38.0 36.0 38.0 35-39 36.7419 38.0 38.0 38.0 36.0 38.0 40-44 36.75095 38.0 38.0 38.0 36.0 38.0 45-49 36.69355 38.0 38.0 38.0 35.6 38.0 50-54 36.43215 38.0 38.0 38.0 35.0 38.0 55-59 36.06935 38.0 38.0 38.0 34.0 38.0 60-64 35.8443 38.0 38.0 38.0 33.8 38.0 65-69 35.66965 38.0 38.0 38.0 33.4 38.0 70-74 35.53555 38.0 38.0 38.0 32.6 38.0 75-79 35.4616 38.0 38.0 38.0 32.2 38.0 80-84 35.5572 38.0 38.0 38.0 31.4 38.0 85-89 35.60165000000001 38.0 38.0 38.0 33.0 38.0 90-94 35.56785 38.0 38.0 38.0 32.6 38.0 95-99 35.43485 38.0 38.0 38.0 31.0 38.0 100-104 35.16890000000001 38.0 37.0 38.0 28.8 38.0 105-109 35.1063 38.0 37.0 38.0 28.8 38.0 110-114 35.06015000000001 38.0 37.0 38.0 29.4 38.0 115-119 34.87545 38.0 36.8 38.0 28.0 38.0 120-124 34.6337 38.0 36.2 38.0 26.8 38.0 125-129 34.31455 38.0 36.0 38.0 24.0 38.0 130-134 33.988299999999995 38.0 35.8 38.0 22.2 38.0 135-139 33.414699999999996 38.0 35.0 38.0 15.8 38.0 140-144 32.950799999999994 38.0 34.6 38.0 14.0 38.0 145-149 32.275999999999996 38.0 34.2 38.0 8.8 38.0 150-151 28.635624999999997 36.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 6.0 4 3.0 5 1.0 6 2.0 7 3.0 8 3.0 9 5.0 10 6.0 11 5.0 12 8.0 13 29.0 14 20.0 15 6.0 16 6.0 17 10.0 18 5.0 19 12.0 20 8.0 21 10.0 22 15.0 23 11.0 24 23.0 25 27.0 26 32.0 27 32.0 28 46.0 29 46.0 30 49.0 31 61.0 32 81.0 33 96.0 34 122.0 35 220.0 36 503.0 37 2482.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.621212121212125 22.904040404040405 12.626262626262626 24.848484848484848 2 27.725 27.175 28.725 16.375 3 18.625 30.525000000000002 29.975 20.875 4 23.200000000000003 34.175 24.775 17.849999999999998 5 24.95 36.6 20.724999999999998 17.724999999999998 6 21.7 36.325 23.575 18.4 7 19.875 22.35 39.0 18.775 8 21.525 26.375 27.575 24.525 9 22.475 24.224999999999998 30.049999999999997 23.25 10-14 23.775 28.7 26.445 21.08 15-19 22.89 27.98 28.18 20.95 20-24 23.189999999999998 28.235 27.450000000000003 21.125 25-29 23.205000000000002 28.315 27.165 21.315 30-34 23.015 28.189999999999998 27.55 21.245 35-39 23.485 27.815 27.74 20.96 40-44 23.525 27.88 27.595 21.0 45-49 23.52 28.225 27.315 20.94 50-54 23.012678607365665 27.943248138458443 27.8929362044677 21.15113704970819 55-59 22.797110297110297 28.00671550671551 28.184778184778185 21.01139601139601 60-64 23.76450145653396 27.899013645423416 27.8734604180508 20.463024479991823 65-69 23.917504617278883 27.65237020316027 27.667761132772416 20.762364046788427 70-74 23.38109176808915 28.018281723411903 27.535562060288605 21.065064448210343 75-79 23.465666889219865 27.91330696933902 28.242000924451748 20.37902521698937 80-84 24.410576382140846 27.254129801053544 28.036618421725567 20.29867539508004 85-89 23.64988791522315 27.746077032810273 28.433869981658855 20.170165070307725 90-94 23.092961757526446 27.415581773799836 27.812245728234338 21.67921074043938 95-99 23.918678526048286 27.522236340533674 28.132147395171536 20.426937738246504 100-104 24.00527142784733 27.948704952100968 28.01966648081504 20.026357139236655 105-109 23.824959481361425 27.233589951377635 28.44914910858995 20.49230145867099 110-114 23.493122977346278 27.831715210355988 27.604166666666668 21.07099514563107 115-119 23.630672926447573 27.916603564036553 27.699530516431924 20.753192993083953 120-124 23.865300146412885 28.015348109254308 27.586206896551722 20.533144847781088 125-129 24.34663695299838 28.185777957860616 27.12216369529984 20.345421393841168 130-134 24.451346809919038 27.888385355669843 27.537043637659757 20.123224196751362 135-139 24.302748068164373 26.897292871398598 27.91054705491019 20.889412005526843 140-144 24.25841487781136 28.239151595880934 27.158153593934113 20.344279932373585 145-149 24.42469693856585 27.907335114033287 27.306348880213683 20.361619067187178 150-151 24.74558804585856 28.429730774185234 27.16733221692645 19.657348963029754 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 2.0 14 1.5 15 1.0 16 2.0 17 2.0 18 1.5 19 1.5 20 2.0 21 7.0 22 12.5 23 9.5 24 6.5 25 7.0 26 6.0 27 8.5 28 12.5 29 12.0 30 9.0 31 12.0 32 20.5 33 28.5 34 45.5 35 60.0 36 76.5 37 108.0 38 133.5 39 166.5 40 200.5 41 230.0 42 254.5 43 254.5 44 264.5 45 280.5 46 272.0 47 254.0 48 228.0 49 205.5 50 167.0 51 132.5 52 135.0 53 112.5 54 69.5 55 46.5 56 36.5 57 30.5 58 21.0 59 12.0 60 7.0 61 6.5 62 8.0 63 5.0 64 2.5 65 1.5 66 2.0 67 1.5 68 1.0 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.62 55-59 1.72 60-64 2.165 65-69 2.54 70-74 2.635 75-79 2.645 80-84 2.235 85-89 1.8599999999999999 90-94 1.68 95-99 1.625 100-104 1.355 105-109 1.28 110-114 1.1199999999999999 115-119 0.955 120-124 0.9650000000000001 125-129 1.28 130-134 1.805 135-139 2.2950000000000004 140-144 2.405 145-149 2.6599999999999997 150-151 2.9625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.42500000000000004 0.0 0.0 0.0 0.0 104-105 0.4875 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.525 0.0 0.0 0.0 0.0 112-113 0.675 0.0 0.0 0.0 0.0 114-115 0.775 0.0 0.0 0.0 0.0 116-117 0.875 0.0 0.0 0.0 0.0 118-119 1.0499999999999998 0.0 0.0 0.0 0.0 120-121 1.2125 0.0 0.0 0.0 0.0 122-123 1.2625 0.0 0.0 0.0 0.0 124-125 1.4 0.0 0.0 0.0 0.0 126-127 1.5375 0.0 0.0 0.0 0.0 128-129 1.7625000000000002 0.0 0.0 0.0 0.0 130-131 1.9749999999999999 0.0 0.0 0.0 0.0 132-133 2.1625 0.0 0.0 0.0 0.0 134-135 2.3375 0.0 0.0 0.0 0.0 136-137 2.5625 0.0 0.0 0.0 0.0 138-139 2.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCCAAT 10 0.00682755 145.0 1 GGAGAGG 10 0.00709263 143.1875 6 >>END_MODULE Read 880765 spots for SRR7169596.sra Written 880765 spots for SRR7169596.sra Read 880765 spots for SRR7169596.sra Written 880765 spots for SRR7169596.sra Read 880765 spots for SRR7169596.sra Written 880765 spots for SRR7169596.sra Read 880765 spots for SRR7169596.sra Written 880765 spots for SRR7169596.sra Read 880765 spots for SRR7169596.sra Written 880765 spots for SRR7169596.sra Read 880765 spots for SRR7169596.sra Written 880765 spots for SRR7169596.sra Read 880765 spots for SRR7169596.sra Written 880765 spots for SRR7169596.sra Read 880765 spots for SRR7169596.sra Written 880765 spots for SRR7169596.sra Read 880765 spots for SRR7169596.sra Written 880765 spots for SRR7169596.sra Read 880765 spots for SRR7169596.sra Written 880765 spots for SRR7169596.sra Read 880765 spots for SRR7169596.sra Written 880765 spots for SRR7169596.sra Read 880766 spots for SRR7169596.sra Written 880766 spots for SRR7169596.sra Read 880765 spots for SRR7169596.sra Written 880765 spots for SRR7169596.sra Read 880765 spots for SRR7169596.sra Written 880765 spots for SRR7169596.sra Read 880765 spots for SRR7169596.sra Written 880765 spots for SRR7169596.sra Read 880765 spots for SRR7169596.sra Written 880765 spots for SRR7169596.sra Read 880765 spots for SRR7169596.sra Written 880765 spots for SRR7169596.sra Read 880765 spots for SRR7169596.sra Written 880765 spots for SRR7169596.sra Read 880765 spots for SRR7169596.sra Written 880765 spots for SRR7169596.sra Read 880765 spots for SRR7169596.sra Written 880765 spots for SRR7169596.sra SRR ids: ['SRR7169596.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cq9ai8dj SRR7169596.sra spots: 17615301 blocks: [[1, 880765], [880766, 1761530], [1761531, 2642295], [2642296, 3523060], [3523061, 4403825], [4403826, 5284590], [5284591, 6165355], [6165356, 7046120], [7046121, 7926885], [7926886, 8807650], [8807651, 9688415], [9688416, 10569180], [10569181, 11449945], [11449946, 12330710], [12330711, 13211475], [13211476, 14092240], [14092241, 14973005], [14973006, 15853770], [15853771, 16734535], [16734536, 17615301]] SRR7169596 file size 5947547 SRR7169596 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169596 SRR7169596_1.fastq SRR7169596_2.fastq Input file: SRR7169596_1.fastq Paired file: SRR7169596_2.fastq trimmed: SRR7169596-trimmed-pair1.fastq, SRR7169596-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 08:21:17 2025 >> started Tue Feb 11 08:21:37 2025 >> done (19.843s) 17615301 read pairs processed; of these: 23171 ( 0.13%) short read pairs filtered out after trimming by size control 16581 ( 0.09%) empty read pairs filtered out after trimming by size control 17575549 (99.77%) read pairs available; of these: 8641475 (49.17%) trimmed read pairs available after processing 8934074 (50.83%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 5 0.00% 20 8 0.00% 21 4 0.00% 22 6 0.00% 23 5 0.00% 24 14 0.00% 25 4 0.00% 26 5 0.00% 27 11 0.00% 28 11 0.00% 29 6 0.00% 30 15 0.00% 31 11 0.00% 32 20 0.00% 33 16 0.00% 34 15 0.00% 35 22 0.00% 36 19 0.00% 37 25 0.00% 38 27 0.00% 39 42 0.00% 40 33 0.00% 41 28 0.00% 42 30 0.00% 43 52 0.00% 44 44 0.00% 45 56 0.00% 46 52 0.00% 47 58 0.00% 48 85 0.00% 49 79 0.00% 50 89 0.00% 51 102 0.00% 52 126 0.00% 53 138 0.00% 54 160 0.00% 55 160 0.00% 56 161 0.00% 57 216 0.00% 58 224 0.00% 59 221 0.00% 60 239 0.00% 61 285 0.00% 62 305 0.00% 63 382 0.00% 64 445 0.00% 65 453 0.00% 66 529 0.00% 67 643 0.00% 68 744 0.00% 69 921 0.01% 70 1081 0.01% 71 1082 0.01% 72 1256 0.01% 73 1448 0.01% 74 1774 0.01% 75 2401 0.01% 76 1834 0.01% 77 995 0.01% 78 1369 0.01% 79 2505 0.01% 80 4480 0.03% 81 1621 0.01% 82 1817 0.01% 83 2141 0.01% 84 3339 0.02% 85 4026 0.02% 86 4633 0.03% 87 4586 0.03% 88 4431 0.03% 89 4603 0.03% 90 5045 0.03% 91 5570 0.03% 92 6152 0.04% 93 6566 0.04% 94 7131 0.04% 95 7759 0.04% 96 8343 0.05% 97 9691 0.06% 98 11716 0.07% 99 17780 0.10% 100 21710 0.12% 101 12838 0.07% 102 10250 0.06% 103 10596 0.06% 104 10999 0.06% 105 11762 0.07% 106 12518 0.07% 107 12968 0.07% 108 13764 0.08% 109 14449 0.08% 110 15173 0.09% 111 16032 0.09% 112 16994 0.10% 113 18129 0.10% 114 19389 0.11% 115 20375 0.12% 116 21401 0.12% 117 22672 0.13% 118 23283 0.13% 119 24924 0.14% 120 25778 0.15% 121 27068 0.15% 122 28995 0.16% 123 30683 0.17% 124 32860 0.19% 125 34929 0.20% 126 36586 0.21% 127 38764 0.22% 128 40797 0.23% 129 43344 0.25% 130 45916 0.26% 131 48673 0.28% 132 52425 0.30% 133 56553 0.32% 134 60349 0.34% 135 66245 0.38% 136 70560 0.40% 137 76708 0.44% 138 83820 0.48% 139 92186 0.52% 140 101267 0.58% 141 111863 0.64% 142 125292 0.71% 143 140629 0.80% 144 166902 0.95% 145 202841 1.15% 146 259759 1.48% 147 356160 2.03% 148 540938 3.08% 149 1024501 5.83% 150 4143326 23.57% 151 8934074 50.83% 17575549 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.78 fanout-score-rank=34 prefix-density=0.25 prefix-fanout=2.4 sequence=CTGGCCATTCAATGTGACATCCTCTTGAGTGGCTTTCAAAAGCCTGATAAAAACGCTGAACTGACCACCTTTTTCTAGGACTTTGGTGACATTGGTTGGACCGGGTGGTGCTGGGGCTGCAGCTGGTGACTGAGCTAGGGTTGGAGGGCAATGAAGAA criterion=fanout-score sequence-density=0.05 sequence-density-rank=37 fanout-score=172.78 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=15.6 sequence=CAGCAGCAAGAAAACAAGTCAAATTATTCATCAAGGACCAATAAAACAGGCATCGAACTAAAGGGATATTATAAATCACTCAAGCTTGGGGCTTCTCCCATTTGAGGGGCTTGACAAC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=41 prefix-density=0.22 prefix-fanout=2.1 sequence=ATTGAATGGCCAG criterion=fanout-score sequence-density=0.04 sequence-density-rank=42 fanout-score=157.57 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=15.0 sequence=AGAAAGAAATGAGAATTCTCATGGTGGGTCTTGATGCTGCTGGTAAGACCACCATCTTGTACAAGCTCAAGCT SRR7169596 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 08:22:22 Started mapping on | Feb 11 08:22:22 Finished on | Feb 11 08:24:08 Mapping speed, Million of reads per hour | 596.91 Number of input reads | 17575549 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 16664367 Uniquely mapped reads % | 94.82% Average mapped length | 294.87 Number of splices: Total | 15785814 Number of splices: Annotated (sjdb) | 15515038 Number of splices: GT/AG | 15554825 Number of splices: GC/AG | 179419 Number of splices: AT/AC | 13062 Number of splices: Non-canonical | 38508 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 285911 % of reads mapped to multiple loci | 1.63% Number of reads mapped to too many loci | 21260 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.41% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 647988 647988 647988 N_multimapping 285911 285911 285911 N_noFeature 385918 16474343 466587 N_ambiguous 176075 1192 65793 UnstrandedReadsAssigned:16102374 PositiveStrandReadsAssigned:188832 NegativeStrandReadsAssigned:16131987 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169596 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169596-trimmed-pair1.fastq SRR7169596-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,575,549 reads, 16,052,292 reads pseudoaligned [quant] estimated average fragment length: 259.342 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,107 rounds 52401 SRR7169596.ke.tsv 34699 SRR7169596.se.tsv 87100 total ==> SRR7169596.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1759.66 250 8.30682 Potri.005G024800.1.v4.1 1035 776.658 40 3.01129 Potri.004G059700.1.v4.1 961 702.706 4 0.33282 Potri.007G009000.2.v4.1 1416 1157.66 0 0 Potri.003G141000.2.v4.1 2943 2684.66 286 6.22873 Potri.016G087400.1.v4.1 270 68.9928 1386 1174.58 Potri.015G069301.1.v4.1 564 311.455 0 0 Potri.010G195200.1.v4.1 1773 1514.66 6 0.231611 Potri.012G127500.1.v4.1 977 718.676 5700 463.729 ==> SRR7169596.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1765 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 246 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169596 completed mapping pipeline successfully