Starting /dee2/code/volunteer_pipeline.sh SRR7169597 current disk space = 3055793737728 free memory = 1415801472 SRR7169597 SRAfilesize 4bbdc40704e61246836a3b765ee00cff SRR7169597.sra SRR7169597.sra file validated SRR7169597 is paired end SRR7169597 is conventional basespace SRR7169597 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169597_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.70025 34.0 33.0 34.0 32.0 34.0 2 33.33 34.0 33.0 34.0 33.0 34.0 3 33.326 34.0 33.0 34.0 33.0 34.0 4 33.407 34.0 33.0 34.0 33.0 34.0 5 33.3865 34.0 33.0 34.0 33.0 34.0 6 37.03725 38.0 37.0 38.0 36.0 38.0 7 37.3325 38.0 38.0 38.0 37.0 38.0 8 37.44725 38.0 38.0 38.0 37.0 38.0 9 37.497 38.0 38.0 38.0 37.0 38.0 10-14 37.443599999999996 38.0 38.0 38.0 37.2 38.0 15-19 37.4416 38.0 38.0 38.0 37.0 38.0 20-24 37.43675 38.0 38.0 38.0 37.2 38.0 25-29 37.44235 38.0 38.0 38.0 37.0 38.0 30-34 37.36295 38.0 38.0 38.0 37.0 38.0 35-39 37.29305 38.0 38.0 38.0 36.8 38.0 40-44 37.1654 38.0 38.0 38.0 36.6 38.0 45-49 37.082 38.0 38.0 38.0 36.2 38.0 50-54 37.002649999999996 38.0 38.0 38.0 36.0 38.0 55-59 36.99795 38.0 38.0 38.0 36.0 38.0 60-64 36.9406 38.0 38.0 38.0 35.8 38.0 65-69 36.855000000000004 38.0 38.0 38.0 35.6 38.0 70-74 36.833450000000006 38.0 38.0 38.0 35.6 38.0 75-79 36.689949999999996 38.0 38.0 38.0 35.0 38.0 80-84 36.57975 38.0 38.0 38.0 34.2 38.0 85-89 36.49045 38.0 38.0 38.0 34.0 38.0 90-94 36.38755 38.0 38.0 38.0 34.0 38.0 95-99 36.294450000000005 38.0 38.0 38.0 34.0 38.0 100-104 35.95885 38.0 37.2 38.0 32.2 38.0 105-109 35.88629999999999 38.0 37.0 38.0 32.2 38.0 110-114 35.689299999999996 38.0 37.0 38.0 31.0 38.0 115-119 35.520649999999996 38.0 37.0 38.0 30.6 38.0 120-124 35.28005 38.0 36.0 38.0 29.2 38.0 125-129 35.0307 38.0 36.0 38.0 28.0 38.0 130-134 34.752300000000005 38.0 35.4 38.0 27.8 38.0 135-139 34.481100000000005 38.0 35.0 38.0 25.8 38.0 140-144 34.0372 38.0 35.0 38.0 23.0 38.0 145-149 33.306349999999995 38.0 34.4 38.0 17.2 38.0 150-151 29.659625 36.5 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 3.0 15 2.0 16 4.0 17 3.0 18 7.0 19 8.0 20 5.0 21 10.0 22 7.0 23 10.0 24 12.0 25 13.0 26 30.0 27 33.0 28 38.0 29 40.0 30 53.0 31 64.0 32 71.0 33 101.0 34 147.0 35 245.0 36 609.0 37 2485.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.84175599795814 11.179173047473201 11.000510464522716 37.97856049004594 2 24.375 14.7 32.025 28.9 3 21.125 17.599999999999998 24.85 36.425000000000004 4 23.05 25.474999999999998 23.3 28.175 5 23.925 29.5 23.724999999999998 22.85 6 20.525 33.475 25.025 20.974999999999998 7 14.149999999999999 27.775 40.525 17.549999999999997 8 19.075 26.05 30.2 24.675 9 17.025000000000002 24.75 34.225 24.0 10-14 19.885 29.54 27.495000000000005 23.080000000000002 15-19 19.975 28.744999999999997 27.205000000000002 24.075 20-24 19.495 28.794999999999998 27.794999999999998 23.915 25-29 19.77 28.849999999999998 27.755000000000003 23.625 30-34 19.8 28.565 27.465 24.169999999999998 35-39 20.175 28.405 27.525 23.895 40-44 20.25 29.03 27.025 23.695 45-49 20.424999999999997 28.384999999999998 27.07 24.12 50-54 20.565 28.544999999999998 27.200000000000003 23.69 55-59 20.18 28.18 27.685 23.955000000000002 60-64 19.830000000000002 28.395 27.04 24.735 65-69 19.5 28.384999999999998 28.134999999999998 23.98 70-74 19.515 28.935 27.47 24.08 75-79 20.57 27.915 27.634999999999998 23.880000000000003 80-84 20.244999999999997 28.225 27.265 24.265 85-89 19.939999999999998 28.49 27.555000000000003 24.015 90-94 20.305 28.384999999999998 27.3 24.01 95-99 20.265 28.335 27.544999999999998 23.855 100-104 20.862517510506304 27.871723033820295 27.581548929357613 23.684210526315788 105-109 20.76 28.205000000000002 27.235 23.799999999999997 110-114 20.398358522670403 28.495646081473325 27.45971374236813 23.64628165348814 115-119 20.58617585275583 27.998399519855955 27.408222466740025 24.007202160648195 120-124 21.072643586151692 28.056834100460275 27.296377826696016 23.574144486692013 125-129 20.835 28.465 27.21 23.49 130-134 20.921506828755813 27.930361698934412 27.375056280954524 23.773075191355243 135-139 21.065 28.09 27.169999999999998 23.674999999999997 140-144 21.17 27.825 27.235 23.77 145-149 20.495 28.205000000000002 27.315 23.985 150-151 20.6375 28.3125 26.8 24.25 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.5 17 0.5 18 0.5 19 0.5 20 0.0 21 1.5 22 2.5 23 2.0 24 5.0 25 4.0 26 0.5 27 4.0 28 10.0 29 8.5 30 10.0 31 17.5 32 24.0 33 34.5 34 41.0 35 56.5 36 76.5 37 90.0 38 113.0 39 147.0 40 180.5 41 210.0 42 259.0 43 283.0 44 283.0 45 278.5 46 263.0 47 252.5 48 244.0 49 248.0 50 195.5 51 140.5 52 128.0 53 107.0 54 77.5 55 53.0 56 38.5 57 25.5 58 19.5 59 12.5 60 11.5 61 11.0 62 7.5 63 4.5 64 2.5 65 3.0 66 2.5 67 2.0 68 2.0 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.0500000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.06 105-109 0.0 110-114 0.09 115-119 0.03 120-124 0.06 125-129 0.0 130-134 0.055 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.30000000000000004 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.4625 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.7 0.0 0.0 0.0 0.0 108-109 0.7875 0.0 0.0 0.0 0.0 110-111 0.9 0.0 0.0 0.0 0.0 112-113 1.0125 0.0 0.0 0.0 0.0 114-115 1.2125 0.0 0.0 0.0 0.0 116-117 1.3624999999999998 0.0 0.0 0.0 0.0 118-119 1.5625 0.0 0.0 0.0 0.0 120-121 1.775 0.0 0.0 0.0 0.0 122-123 1.9875 0.0 0.0 0.0 0.0 124-125 2.1625 0.0 0.0 0.0 0.0 126-127 2.425 0.0 0.0 0.0 0.0 128-129 2.6875 0.0 0.0 0.0 0.0 130-131 2.9625 0.0 0.0 0.0 0.0 132-133 3.175 0.0 0.0 0.0 0.0 134-135 3.45 0.0 0.0 0.0 0.0 136-137 3.6125 0.0 0.0 0.0 0.0 138-139 3.7249999999999996 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTATCTT 10 0.006577216 146.82278 1 ATCCCAT 10 0.006832588 144.9875 5 >>END_MODULE SRR7169597 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169597_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.32375 33.0 33.0 34.0 31.0 34.0 2 32.60825 33.0 33.0 34.0 32.0 34.0 3 32.62125 33.0 33.0 34.0 32.0 34.0 4 32.623 33.0 33.0 34.0 32.0 34.0 5 32.60625 33.0 33.0 34.0 32.0 34.0 6 36.636 38.0 38.0 38.0 35.0 38.0 7 36.736 38.0 38.0 38.0 35.0 38.0 8 36.826 38.0 38.0 38.0 36.0 38.0 9 36.66425 38.0 38.0 38.0 35.0 38.0 10-14 36.64645 38.0 38.0 38.0 35.4 38.0 15-19 36.602199999999996 38.0 38.0 38.0 35.0 38.0 20-24 36.64815 38.0 38.0 38.0 35.0 38.0 25-29 36.68345 38.0 38.0 38.0 35.0 38.0 30-34 36.6596 38.0 38.0 38.0 35.2 38.0 35-39 36.557249999999996 38.0 38.0 38.0 34.6 38.0 40-44 36.58115 38.0 38.0 38.0 35.2 38.0 45-49 36.537850000000006 38.0 38.0 38.0 34.6 38.0 50-54 36.3388 38.0 38.0 38.0 34.8 38.0 55-59 35.9582 38.0 38.0 38.0 33.8 38.0 60-64 35.722249999999995 38.0 38.0 38.0 33.0 38.0 65-69 35.62735000000001 38.0 38.0 38.0 32.8 38.0 70-74 35.52575 38.0 38.0 38.0 32.2 38.0 75-79 35.339749999999995 38.0 38.0 38.0 30.2 38.0 80-84 35.434749999999994 38.0 38.0 38.0 30.2 38.0 85-89 35.5823 38.0 38.0 38.0 31.4 38.0 90-94 35.4214 38.0 38.0 38.0 30.0 38.0 95-99 35.34215 38.0 37.6 38.0 29.4 38.0 100-104 35.2047 38.0 37.0 38.0 29.0 38.0 105-109 35.132450000000006 38.0 37.2 38.0 28.8 38.0 110-114 35.013600000000004 38.0 37.0 38.0 28.6 38.0 115-119 34.748900000000006 38.0 36.8 38.0 26.8 38.0 120-124 34.581599999999995 38.0 36.0 38.0 25.8 38.0 125-129 34.40875 38.0 36.0 38.0 24.8 38.0 130-134 33.910399999999996 38.0 35.2 38.0 21.4 38.0 135-139 33.46925 38.0 35.0 38.0 14.8 38.0 140-144 33.060500000000005 38.0 35.0 38.0 14.0 38.0 145-149 32.078050000000005 38.0 33.8 38.0 6.4 38.0 150-151 28.358375000000002 36.0 18.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 7.0 4 3.0 5 2.0 6 3.0 7 2.0 8 4.0 9 2.0 10 2.0 11 5.0 12 11.0 13 25.0 14 19.0 15 7.0 16 5.0 17 7.0 18 3.0 19 11.0 20 14.0 21 20.0 22 15.0 23 26.0 24 29.0 25 35.0 26 35.0 27 37.0 28 57.0 29 50.0 30 45.0 31 62.0 32 76.0 33 108.0 34 123.0 35 220.0 36 419.0 37 2507.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.824120603015075 21.582914572864322 16.256281407035175 27.33668341708543 2 29.799999999999997 27.700000000000003 25.924999999999997 16.575 3 21.075 30.725 29.175 19.025 4 22.25 35.775 22.15 19.825 5 24.9 35.875 21.175 18.05 6 20.349999999999998 37.275000000000006 23.0 19.375 7 20.775 21.275 39.025 18.925 8 23.05 25.174999999999997 26.400000000000002 25.374999999999996 9 21.5 26.525 30.0 21.975 10-14 23.577683262446836 28.631473605203904 26.164623467600702 21.62621966474856 15-19 23.21008655626157 27.803071996797918 27.82808825736729 21.158753189573222 20-24 23.095 28.33 27.295 21.279999999999998 25-29 22.745 28.235 27.36 21.66 30-34 22.46 28.465 28.015 21.060000000000002 35-39 23.674999999999997 27.900000000000002 27.485 20.94 40-44 23.36 27.689999999999998 27.750000000000004 21.2 45-49 23.1 28.110000000000003 27.944999999999997 20.845 50-54 23.234658491229833 27.933859375785293 27.737849927124692 21.09363220586018 55-59 24.171361859804072 27.71432922186691 27.633115070301002 20.481193848028017 60-64 22.548368982592272 28.28117821226198 27.934044616876818 21.236408188268925 65-69 24.587729181604015 27.40448632592441 27.097203728362185 20.910580764109394 70-74 22.959052939066265 27.66873366473633 27.832726900015377 21.539486496182032 75-79 23.789722265003338 26.726217978335644 28.250936906412033 21.233122850248986 80-84 23.74405887463587 28.016558491337456 27.822353963305563 20.417028670721113 85-89 24.28368217841902 27.428368217841903 27.72810404389352 20.55984555984556 90-94 23.781013750063423 27.951697194175253 27.408798011060938 20.858491044700394 95-99 24.134089528053472 28.0332185537776 27.643305651205186 20.189386266963744 100-104 24.65073901599514 27.829520145778496 26.999392589593036 20.520348248633326 105-109 24.34989375695639 27.906506121622986 27.218455934432868 20.525144186987756 110-114 23.75897280355879 27.934485896269333 27.686785967040745 20.619755333131128 115-119 24.34984598293188 28.228046255617834 27.28374488713831 20.138362874311973 120-124 24.198839263184457 27.686096391622506 27.620489528135252 20.494574817057785 125-129 24.02047746971463 28.32378731816108 27.49252369608191 20.163211516042374 130-134 24.539908490086425 27.77834265378749 27.11743772241993 20.564311133706152 135-139 24.492716585739842 27.830309225658063 27.16074623051367 20.51622795808842 140-144 24.61861369919115 27.531483567113753 27.336950957305213 20.512951776389883 145-149 24.890739883798652 27.512982672630983 27.21990847858502 20.376368964985346 150-151 24.60604494962542 27.42185481787652 26.892275897700852 21.07982433479721 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.5 17 1.5 18 2.0 19 4.0 20 5.0 21 3.5 22 3.0 23 5.5 24 10.0 25 8.5 26 5.0 27 6.0 28 6.5 29 9.5 30 11.0 31 18.0 32 25.5 33 26.5 34 38.0 35 55.5 36 68.0 37 88.0 38 122.0 39 155.5 40 188.5 41 223.5 42 253.0 43 275.5 44 286.5 45 303.5 46 286.5 47 258.0 48 242.0 49 210.5 50 181.5 51 146.0 52 111.0 53 88.0 54 76.5 55 57.0 56 37.5 57 26.5 58 16.0 59 12.5 60 11.0 61 8.0 62 7.0 63 4.0 64 2.5 65 1.5 66 1.0 67 0.5 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.075 15-19 0.065 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.515 55-59 1.4949999999999999 60-64 2.0549999999999997 65-69 2.37 70-74 2.435 75-79 2.605 80-84 2.165 85-89 1.58 90-94 1.455 95-99 1.26 100-104 1.22 105-109 1.17 110-114 1.09 115-119 0.985 120-124 0.9249999999999999 125-129 1.355 130-134 1.6500000000000001 135-139 2.175 140-144 2.33 145-149 2.7550000000000003 150-151 3.225 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.30000000000000004 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.4625 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.55 0.0 0.0 0.0 0.0 106-107 0.7 0.0 0.0 0.0 0.0 108-109 0.7875 0.0 0.0 0.0 0.0 110-111 0.9 0.0 0.0 0.0 0.0 112-113 1.0375 0.0 0.0 0.0 0.0 114-115 1.2125 0.0 0.0 0.0 0.0 116-117 1.3624999999999998 0.0 0.0 0.0 0.0 118-119 1.5875 0.0 0.0 0.0 0.0 120-121 1.7999999999999998 0.0 0.0 0.0 0.0 122-123 2.0125 0.0 0.0 0.0 0.0 124-125 2.1875 0.0 0.0 0.0 0.0 126-127 2.475 0.0 0.0 0.0 0.0 128-129 2.7375 0.0 0.0 0.0 0.0 130-131 3.025 0.0 0.0 0.0 0.0 132-133 3.25 0.0 0.0 0.0 0.0 134-135 3.5250000000000004 0.0 0.0 0.0 0.0 136-137 3.6875 0.0 0.0 0.0 0.0 138-139 3.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 780394 spots for SRR7169597.sra Written 780394 spots for SRR7169597.sra Read 780394 spots for SRR7169597.sra Written 780394 spots for SRR7169597.sra Read 780394 spots for SRR7169597.sra Written 780394 spots for SRR7169597.sra Read 780394 spots for SRR7169597.sra Written 780394 spots for SRR7169597.sra Read 780394 spots for SRR7169597.sra Written 780394 spots for SRR7169597.sra Read 780394 spots for SRR7169597.sra Written 780394 spots for SRR7169597.sra Read 780394 spots for SRR7169597.sra Written 780394 spots for SRR7169597.sra Read 780394 spots for SRR7169597.sra Written 780394 spots for SRR7169597.sra Read 780394 spots for SRR7169597.sra Written 780394 spots for SRR7169597.sra Read 780394 spots for SRR7169597.sra Written 780394 spots for SRR7169597.sra Read 780394 spots for SRR7169597.sra Written 780394 spots for SRR7169597.sra Read 780394 spots for SRR7169597.sra Written 780394 spots for SRR7169597.sra Read 780394 spots for SRR7169597.sra Written 780394 spots for SRR7169597.sra Read 780394 spots for SRR7169597.sra Written 780394 spots for SRR7169597.sra Read 780394 spots for SRR7169597.sra Written 780394 spots for SRR7169597.sra Read 780394 spots for SRR7169597.sra Written 780394 spots for SRR7169597.sra Read 780394 spots for SRR7169597.sra Written 780394 spots for SRR7169597.sra Read 780407 spots for SRR7169597.sra Written 780407 spots for SRR7169597.sra Read 780394 spots for SRR7169597.sra Written 780394 spots for SRR7169597.sra Read 780394 spots for SRR7169597.sra Written 780394 spots for SRR7169597.sra SRR ids: ['SRR7169597.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7onooy2w SRR7169597.sra spots: 15607893 blocks: [[1, 780394], [780395, 1560788], [1560789, 2341182], [2341183, 3121576], [3121577, 3901970], [3901971, 4682364], [4682365, 5462758], [5462759, 6243152], [6243153, 7023546], [7023547, 7803940], [7803941, 8584334], [8584335, 9364728], [9364729, 10145122], [10145123, 10925516], [10925517, 11705910], [11705911, 12486304], [12486305, 13266698], [13266699, 14047092], [14047093, 14827486], [14827487, 15607893]] SRR7169597 file size 5267302 SRR7169597 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169597 SRR7169597_1.fastq SRR7169597_2.fastq Input file: SRR7169597_1.fastq Paired file: SRR7169597_2.fastq trimmed: SRR7169597-trimmed-pair1.fastq, SRR7169597-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 08:17:46 2025 >> started Tue Feb 11 08:18:14 2025 >> done (27.268s) 15607893 read pairs processed; of these: 15894 ( 0.10%) short read pairs filtered out after trimming by size control 15025 ( 0.10%) empty read pairs filtered out after trimming by size control 15576974 (99.80%) read pairs available; of these: 7998767 (51.35%) trimmed read pairs available after processing 7578207 (48.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 2 0.00% 21 3 0.00% 22 1 0.00% 23 8 0.00% 24 2 0.00% 25 4 0.00% 26 5 0.00% 27 5 0.00% 28 2 0.00% 29 7 0.00% 30 14 0.00% 31 7 0.00% 32 5 0.00% 33 9 0.00% 34 9 0.00% 35 18 0.00% 36 14 0.00% 37 13 0.00% 38 20 0.00% 39 18 0.00% 40 23 0.00% 41 30 0.00% 42 25 0.00% 43 31 0.00% 44 25 0.00% 45 39 0.00% 46 35 0.00% 47 52 0.00% 48 52 0.00% 49 60 0.00% 50 57 0.00% 51 63 0.00% 52 79 0.00% 53 99 0.00% 54 97 0.00% 55 103 0.00% 56 122 0.00% 57 111 0.00% 58 141 0.00% 59 167 0.00% 60 203 0.00% 61 197 0.00% 62 241 0.00% 63 267 0.00% 64 319 0.00% 65 385 0.00% 66 403 0.00% 67 528 0.00% 68 548 0.00% 69 952 0.01% 70 1300 0.01% 71 949 0.01% 72 931 0.01% 73 1090 0.01% 74 1323 0.01% 75 1747 0.01% 76 1494 0.01% 77 1339 0.01% 78 1766 0.01% 79 2781 0.02% 80 4315 0.03% 81 2023 0.01% 82 2249 0.01% 83 2711 0.02% 84 3729 0.02% 85 4195 0.03% 86 4855 0.03% 87 5139 0.03% 88 5063 0.03% 89 5351 0.03% 90 5651 0.04% 91 6085 0.04% 92 6471 0.04% 93 7011 0.05% 94 7778 0.05% 95 8552 0.05% 96 9181 0.06% 97 9857 0.06% 98 10855 0.07% 99 13114 0.08% 100 16651 0.11% 101 15685 0.10% 102 11898 0.08% 103 12377 0.08% 104 12919 0.08% 105 13876 0.09% 106 14463 0.09% 107 15165 0.10% 108 15871 0.10% 109 16455 0.11% 110 17053 0.11% 111 17777 0.11% 112 18849 0.12% 113 19809 0.13% 114 21355 0.14% 115 22300 0.14% 116 22924 0.15% 117 24326 0.16% 118 25403 0.16% 119 26022 0.17% 120 27497 0.18% 121 28429 0.18% 122 29878 0.19% 123 31767 0.20% 124 33279 0.21% 125 35153 0.23% 126 37161 0.24% 127 38778 0.25% 128 40798 0.26% 129 42734 0.27% 130 44798 0.29% 131 46508 0.30% 132 49526 0.32% 133 53321 0.34% 134 56888 0.37% 135 60688 0.39% 136 65644 0.42% 137 70280 0.45% 138 76487 0.49% 139 83428 0.54% 140 91099 0.58% 141 99196 0.64% 142 110647 0.71% 143 124064 0.80% 144 145042 0.93% 145 174423 1.12% 146 220099 1.41% 147 298116 1.91% 148 455972 2.93% 149 936820 6.01% 150 3884536 24.94% 151 7578207 48.65% 15576974 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=42 prefix-density=0.20 prefix-fanout=2.0 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.11 sequence-density-rank=19 fanout-score=98.53 fanout-score-rank=1 prefix-density=0.75 prefix-fanout=15.0 sequence=CCACCACCATGGGCTCCCCAGCCACCATAGGTGTCAATAATGATCTTGCGTCCAGTGAGACCTGCATCACCATGAGGACCACCAATAAC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.37 fanout-score-rank=38 prefix-density=0.26 prefix-fanout=2.2 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=180.47 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=10.2 sequence=AAAGCAATTTCTTCATCCTCTTCTGTGATAATCACTCCTACCTTTTTGCTTCTTACAGTTTTCTTTTGTATCCCAGCTGTGCTTTATTTTCCTTCTAGTTCCAATGGCCACTGTTGAGGTTG SRR7169597 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 08:19:09 Started mapping on | Feb 11 08:19:09 Finished on | Feb 11 08:21:05 Mapping speed, Million of reads per hour | 483.42 Number of input reads | 15576974 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 14672491 Uniquely mapped reads % | 94.19% Average mapped length | 294.23 Number of splices: Total | 14160312 Number of splices: Annotated (sjdb) | 13938424 Number of splices: GT/AG | 13962427 Number of splices: GC/AG | 158054 Number of splices: AT/AC | 11784 Number of splices: Non-canonical | 28047 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.02% Deletion average length | 2.58 Insertion rate per base | 0.02% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 255244 % of reads mapped to multiple loci | 1.64% Number of reads mapped to too many loci | 84834 % of reads mapped to too many loci | 0.54% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.50% % of reads unmapped: other | 0.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 666855 666855 666855 N_multimapping 255244 255244 255244 N_noFeature 251399 14499897 322954 N_ambiguous 158427 810 56814 UnstrandedReadsAssigned:14262665 PositiveStrandReadsAssigned:171784 NegativeStrandReadsAssigned:14292723 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169597 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169597-trimmed-pair1.fastq SRR7169597-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,576,974 reads, 14,246,935 reads pseudoaligned [quant] estimated average fragment length: 262.297 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,025 rounds 52401 SRR7169597.ke.tsv 34699 SRR7169597.se.tsv 87100 total ==> SRR7169597.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1756.7 228 8.95292 Potri.005G024800.1.v4.1 1035 773.703 29 2.58554 Potri.004G059700.1.v4.1 961 699.752 2 0.197158 Potri.007G009000.2.v4.1 1416 1154.7 0 0 Potri.003G141000.2.v4.1 2943 2681.7 265.101 6.81914 Potri.016G087400.1.v4.1 270 73.1594 1213 1143.72 Potri.015G069301.1.v4.1 564 309.313 0 0 Potri.010G195200.1.v4.1 1773 1511.7 6 0.273787 Potri.012G127500.1.v4.1 977 715.739 4064 391.677 ==> SRR7169597.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1107 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 213 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR7169597 completed mapping pipeline successfully