Starting /dee2/code/volunteer_pipeline.sh SRR7169598 current disk space = 3054975819776 free memory = 1578921536 SRR7169598 SRAfilesize 3c7c6e80d7848c7a4d23b78decc3d4d8 SRR7169598.sra SRR7169598.sra file validated SRR7169598 is paired end SRR7169598 is conventional basespace SRR7169598 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169598_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.014 34.0 33.0 34.0 33.0 34.0 2 33.42625 34.0 33.0 34.0 33.0 34.0 3 33.41825 34.0 34.0 34.0 33.0 34.0 4 33.40175 34.0 34.0 34.0 33.0 34.0 5 33.462 34.0 34.0 34.0 33.0 34.0 6 37.10675 38.0 38.0 38.0 36.0 38.0 7 37.261 38.0 38.0 38.0 36.0 38.0 8 36.9715 38.0 38.0 38.0 36.0 38.0 9 37.404 38.0 38.0 38.0 37.0 38.0 10-14 37.3999 38.0 38.0 38.0 37.0 38.0 15-19 37.4071 38.0 38.0 38.0 37.0 38.0 20-24 37.40605 38.0 38.0 38.0 37.0 38.0 25-29 37.38415 38.0 38.0 38.0 37.0 38.0 30-34 37.37525 38.0 38.0 38.0 37.0 38.0 35-39 37.2458 38.0 38.0 38.0 36.8 38.0 40-44 37.15215 38.0 38.0 38.0 36.4 38.0 45-49 37.199400000000004 38.0 38.0 38.0 36.4 38.0 50-54 37.15105 38.0 38.0 38.0 36.2 38.0 55-59 37.045100000000005 38.0 38.0 38.0 36.0 38.0 60-64 37.0884 38.0 38.0 38.0 36.0 38.0 65-69 37.0697 38.0 38.0 38.0 36.0 38.0 70-74 36.982150000000004 38.0 38.0 38.0 36.0 38.0 75-79 36.8718 38.0 38.0 38.0 35.8 38.0 80-84 36.81085 38.0 38.0 38.0 35.4 38.0 85-89 36.7533 38.0 38.0 38.0 35.0 38.0 90-94 36.63535 38.0 38.0 38.0 34.4 38.0 95-99 36.446299999999994 38.0 38.0 38.0 34.0 38.0 100-104 36.3763 38.0 38.0 38.0 34.0 38.0 105-109 36.2048 38.0 37.8 38.0 34.0 38.0 110-114 36.0464 38.0 37.6 38.0 33.0 38.0 115-119 35.942899999999995 38.0 37.0 38.0 33.0 38.0 120-124 35.78635 38.0 37.0 38.0 32.2 38.0 125-129 35.648450000000004 38.0 36.8 38.0 31.6 38.0 130-134 35.35289999999999 38.0 36.0 38.0 30.2 38.0 135-139 35.08055 38.0 36.0 38.0 28.4 38.0 140-144 34.6814 38.0 35.2 38.0 28.0 38.0 145-149 33.991949999999996 38.0 35.0 38.0 23.6 38.0 150-151 30.305500000000002 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 3.0 13 1.0 14 2.0 15 1.0 16 1.0 17 2.0 18 6.0 19 10.0 20 2.0 21 7.0 22 6.0 23 7.0 24 8.0 25 10.0 26 19.0 27 19.0 28 27.0 29 27.0 30 36.0 31 58.0 32 74.0 33 94.0 34 156.0 35 244.0 36 537.0 37 2641.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.878296146044626 13.94523326572008 9.203853955375253 31.97261663286004 2 25.224999999999998 13.925 30.2 30.65 3 20.1 19.025 25.474999999999998 35.4 4 23.45 26.275 23.05 27.224999999999998 5 22.775000000000002 30.25 24.975 22.0 6 20.225 33.375 24.85 21.55 7 15.1 28.000000000000004 39.125 17.775 8 16.85 30.3 30.0 22.85 9 15.8 27.725 32.6 23.875 10-14 20.085 30.455 26.905 22.555 15-19 19.57 29.599999999999998 27.450000000000003 23.380000000000003 20-24 19.855 29.39 27.810000000000002 22.945 25-29 20.46 29.659999999999997 26.8 23.080000000000002 30-34 19.57 29.294999999999998 27.345000000000002 23.79 35-39 20.03 29.4 27.26 23.31 40-44 19.905 29.794999999999998 26.71 23.59 45-49 19.695 29.054999999999996 27.175 24.075 50-54 19.830000000000002 29.354999999999997 27.115000000000002 23.7 55-59 19.615 28.904999999999998 27.395000000000003 24.085 60-64 20.23 28.88 26.669999999999998 24.22 65-69 20.19 29.04 27.1 23.669999999999998 70-74 20.150000000000002 28.685 27.474999999999998 23.69 75-79 20.625 28.17 26.905 24.3 80-84 20.419999999999998 29.205 26.695 23.68 85-89 20.45 28.52 27.150000000000002 23.880000000000003 90-94 20.65 28.854999999999997 26.810000000000002 23.685000000000002 95-99 20.26 28.439999999999998 27.555000000000003 23.745 100-104 21.075 28.42 26.97 23.535 105-109 20.397039703970396 28.582858285828582 26.957695769576954 24.062406240624064 110-114 21.01 28.549999999999997 26.490000000000002 23.95 115-119 20.810000000000002 28.325 26.939999999999998 23.925 120-124 20.724999999999998 28.389999999999997 26.834999999999997 24.05 125-129 21.02 28.03 26.505000000000003 24.445 130-134 20.560000000000002 27.935 26.815 24.69 135-139 20.79 28.76 26.484999999999996 23.965 140-144 20.695 28.244999999999997 26.590000000000003 24.47 145-149 21.0 28.475 26.325 24.2 150-151 21.025 28.1625 26.450000000000003 24.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 2.0 21 3.0 22 2.0 23 1.5 24 2.5 25 5.0 26 6.5 27 8.5 28 12.5 29 17.5 30 24.0 31 35.5 32 46.5 33 61.0 34 68.5 35 73.5 36 92.5 37 105.0 38 118.5 39 144.5 40 185.0 41 217.0 42 217.5 43 234.0 44 262.5 45 253.5 46 245.5 47 233.0 48 223.0 49 197.5 50 159.0 51 141.5 52 120.5 53 105.5 54 89.5 55 68.5 56 46.5 57 35.5 58 29.0 59 27.0 60 23.0 61 12.5 62 8.0 63 8.0 64 6.0 65 6.0 66 5.0 67 2.5 68 3.0 69 2.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4000000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.01 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44668008048289 98.85000000000001 2 0.528169014084507 1.05 3 0.0 0.0 4 0.025150905432595575 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.23750000000000002 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.45 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.725 0.0 0.0 0.0 0.0 104-105 0.85 0.0 0.0 0.0 0.0 106-107 0.9750000000000001 0.0 0.0 0.0 0.0 108-109 1.125 0.0 0.0 0.0 0.0 110-111 1.325 0.0 0.0 0.0 0.0 112-113 1.4249999999999998 0.0 0.0 0.0 0.0 114-115 1.7125 0.0 0.0 0.0 0.0 116-117 1.975 0.0 0.0 0.0 0.0 118-119 2.175 0.0 0.0 0.0 0.0 120-121 2.4749999999999996 0.0 0.0 0.0 0.0 122-123 2.7875 0.0 0.0 0.0 0.0 124-125 2.9625 0.0 0.0 0.0 0.0 126-127 3.1875 0.0 0.0 0.0 0.0 128-129 3.4125 0.0 0.0 0.0 0.0 130-131 3.725 0.0 0.0 0.0 0.0 132-133 4.199999999999999 0.0 0.0 0.0 0.0 134-135 4.6625 0.0 0.0 0.0 0.0 136-137 5.0875 0.0 0.0 0.0 0.0 138-139 5.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTAAC 10 0.006830828 145.0 6 >>END_MODULE SRR7169598 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169598_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.83125 33.0 33.0 34.0 32.0 34.0 2 32.94275 34.0 33.0 34.0 32.0 34.0 3 32.935 34.0 33.0 34.0 32.0 34.0 4 32.97075 34.0 33.0 34.0 32.0 34.0 5 32.95625 34.0 33.0 34.0 32.0 34.0 6 36.904 38.0 38.0 38.0 36.0 38.0 7 37.059 38.0 38.0 38.0 37.0 38.0 8 37.097 38.0 38.0 38.0 37.0 38.0 9 37.0345 38.0 38.0 38.0 37.0 38.0 10-14 37.1076 38.0 38.0 38.0 37.0 38.0 15-19 37.0756 38.0 38.0 38.0 37.0 38.0 20-24 37.01370000000001 38.0 38.0 38.0 37.0 38.0 25-29 36.93130000000001 38.0 38.0 38.0 36.6 38.0 30-34 36.84625 38.0 38.0 38.0 36.4 38.0 35-39 36.8514 38.0 38.0 38.0 36.0 38.0 40-44 36.88035 38.0 38.0 38.0 36.4 38.0 45-49 36.911249999999995 38.0 38.0 38.0 36.4 38.0 50-54 36.8643 38.0 38.0 38.0 36.0 38.0 55-59 36.808749999999996 38.0 38.0 38.0 36.0 38.0 60-64 36.75619999999999 38.0 38.0 38.0 36.0 38.0 65-69 36.70775 38.0 38.0 38.0 36.0 38.0 70-74 36.58985 38.0 38.0 38.0 35.4 38.0 75-79 36.41185 38.0 38.0 38.0 34.8 38.0 80-84 36.355149999999995 38.0 38.0 38.0 34.4 38.0 85-89 36.19895 38.0 38.0 38.0 33.8 38.0 90-94 36.0765 38.0 38.0 38.0 34.0 38.0 95-99 36.054899999999996 38.0 38.0 38.0 33.8 38.0 100-104 36.021699999999996 38.0 38.0 38.0 33.6 38.0 105-109 35.89190000000001 38.0 38.0 38.0 33.2 38.0 110-114 35.718849999999996 38.0 37.6 38.0 32.2 38.0 115-119 35.53345 38.0 37.0 38.0 31.4 38.0 120-124 35.245850000000004 38.0 37.0 38.0 30.2 38.0 125-129 34.9171 38.0 36.0 38.0 28.0 38.0 130-134 34.69345 38.0 36.0 38.0 27.6 38.0 135-139 34.3566 38.0 35.4 38.0 25.2 38.0 140-144 33.81805 38.0 33.8 38.0 22.2 38.0 145-149 33.1819 38.0 33.2 38.0 16.6 38.0 150-151 28.7095 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 8.0 4 1.0 5 3.0 6 2.0 7 1.0 8 1.0 9 4.0 10 1.0 11 5.0 12 1.0 13 5.0 14 1.0 15 3.0 16 2.0 17 11.0 18 9.0 19 4.0 20 6.0 21 8.0 22 4.0 23 12.0 24 16.0 25 15.0 26 22.0 27 23.0 28 30.0 29 45.0 30 38.0 31 50.0 32 83.0 33 95.0 34 150.0 35 204.0 36 526.0 37 2598.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.56084126189284 23.785678517776667 12.769153730595894 22.8843264897346 2 28.267401101652478 28.642964446670007 25.88883324987481 17.200801201802705 3 21.85778668002003 30.070105157736606 29.04356534802203 19.028542814221332 4 24.18627941912869 34.52679018527792 22.633950926389584 18.652979469203807 5 24.586880320480724 37.105658487731596 21.28192288432649 17.02553830746119 6 22.483725588382576 36.47971957936905 22.483725588382576 18.552829243865798 7 21.031547320981474 23.13470205307962 36.00400600901352 19.82974461692539 8 21.907861792689033 26.69003505257887 26.69003505257887 24.71206810215323 9 22.909364046069104 25.7135703555333 28.16725087631447 23.209814722083124 10-14 24.176264396594892 28.42263395092639 25.6935403104657 21.707561342013022 15-19 24.636955433149723 28.342513770655987 26.494742113169757 20.525788683024537 20-24 23.86079118678017 28.162243365047573 26.695042563845767 21.28192288432649 25-29 23.46371512996444 27.835929283317473 27.805879701507486 20.894475885210596 30-34 23.825738607911866 27.846770155232846 27.41612418627942 20.911367050575862 35-39 24.156234351527292 27.86680020030045 27.1306960440661 20.84626940410616 40-44 24.605599238743928 27.89602844693745 26.523764210948066 20.974608103370564 45-49 24.161241862794192 28.28743114672008 26.519779669504256 21.031547320981474 50-54 23.913261217948715 27.664262820512818 27.408854166666668 21.013621794871796 55-59 23.75682307576744 27.667885222094245 27.36741950022535 21.207872201912963 60-64 24.59689534301452 28.092138207310967 27.1807711567351 20.13019529293941 65-69 23.99719565326256 27.848164655215584 27.021883920076117 21.13275577144574 70-74 24.40905448717949 28.01983173076923 26.707732371794872 20.86338141025641 75-79 23.47020530796194 27.466199298948425 28.197295943915872 20.866299449173763 80-84 23.870806209313972 27.511266900350527 27.831747621432147 20.786179268903354 85-89 24.60059097510893 27.86097060149246 27.03961536535283 20.498823058045776 90-94 24.15122684026039 27.1407110665999 28.077115673510267 20.630946419629446 95-99 23.881793137991487 27.07738542449286 28.339594290007515 20.70122714750814 100-104 24.520554804466478 27.71017976065295 27.970557308096737 19.798708126783836 105-109 25.108897010964803 27.79752666099234 27.10158714264257 19.991989185400293 110-114 23.898237179487182 28.079927884615387 27.614182692307693 20.407652243589745 115-119 24.47671507260891 27.481221832749124 27.401101652478715 20.640961442163245 120-124 24.643196955280686 27.3523962141319 27.943312133807403 20.06109469678001 125-129 24.974954918853935 28.185734321779204 26.793227810058106 20.046082949308754 130-134 25.008765339343853 27.643375907838717 26.997245179063363 20.35061357375407 135-139 25.0 26.988579442997395 27.55960729312763 20.451813263874975 140-144 24.787180771156734 28.192288432648972 27.255883825738607 19.764646970455686 145-149 25.39809714571858 27.46119178768152 26.925388082123185 20.215322984476717 150-151 24.94055812789388 27.355775247153048 27.656113127268178 20.047553497684895 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 6.0 1 3.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 0.5 22 0.0 23 0.0 24 0.0 25 0.5 26 2.5 27 3.5 28 5.0 29 8.5 30 8.0 31 10.0 32 14.5 33 22.5 34 32.5 35 39.0 36 54.5 37 85.5 38 103.0 39 127.0 40 181.0 41 224.5 42 251.0 43 262.0 44 296.0 45 317.0 46 300.0 47 285.5 48 244.0 49 204.0 50 185.0 51 152.0 52 123.5 53 112.0 54 90.5 55 68.0 56 47.5 57 35.0 58 30.0 59 18.0 60 8.0 61 6.0 62 8.0 63 6.0 64 4.0 65 4.0 66 2.0 67 1.0 68 2.5 69 2.5 70 2.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.15 3 0.15 4 0.15 5 0.15 6 0.15 7 0.15 8 0.15 9 0.15 10-14 0.15 15-19 0.15 20-24 0.15 25-29 0.165 30-34 0.15 35-39 0.15 40-44 0.165 45-49 0.15 50-54 0.16 55-59 0.155 60-64 0.15 65-69 0.155 70-74 0.16 75-79 0.15 80-84 0.15 85-89 0.165 90-94 0.15 95-99 0.17500000000000002 100-104 0.145 105-109 0.135 110-114 0.16 115-119 0.15 120-124 0.155 125-129 0.18 130-134 0.17500000000000002 135-139 0.18 140-144 0.15 145-149 0.15 150-151 0.11249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39516129032258 98.6 2 0.5292338709677419 1.05 3 0.025201612903225805 0.075 4 0.0 0.0 5 0.025201612903225805 0.125 6 0.025201612903225805 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 5 0.125 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.5375 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.875 0.0 0.0 0.0 0.0 104-105 1.0 0.0 0.0 0.0 0.0 106-107 1.1125 0.0 0.0 0.0 0.0 108-109 1.25 0.0 0.0 0.0 0.0 110-111 1.4375 0.0 0.0 0.0 0.0 112-113 1.525 0.0 0.0 0.0 0.0 114-115 1.7625000000000002 0.0 0.0 0.0 0.0 116-117 2.0125 0.0 0.0 0.0 0.0 118-119 2.2125 0.0 0.0 0.0 0.0 120-121 2.5125 0.0 0.0 0.0 0.0 122-123 2.8375 0.0 0.0 0.0 0.0 124-125 2.975 0.0 0.0 0.0 0.0 126-127 3.15 0.0 0.0 0.0 0.0 128-129 3.4375 0.0 0.0 0.0 0.0 130-131 3.75 0.0 0.0 0.0 0.0 132-133 4.175000000000001 0.0 0.0 0.0 0.0 134-135 4.625 0.0 0.0 0.0 0.0 136-137 5.0 0.0 0.0 0.0 0.0 138-139 5.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTGGTT 10 0.0069904905 143.86076 145 GGGGGGG 20 0.006166478 28.772152 100-104 >>END_MODULE Read 1027931 spots for SRR7169598.sra Written 1027931 spots for SRR7169598.sra Read 1027931 spots for SRR7169598.sra Written 1027931 spots for SRR7169598.sra Read 1027931 spots for SRR7169598.sra Written 1027931 spots for SRR7169598.sra Read 1027931 spots for SRR7169598.sra Written 1027931 spots for SRR7169598.sra Read 1027931 spots for SRR7169598.sra Written 1027931 spots for SRR7169598.sra Read 1027931 spots for SRR7169598.sra Written 1027931 spots for SRR7169598.sra Read 1027931 spots for SRR7169598.sra Written 1027931 spots for SRR7169598.sra Read 1027931 spots for SRR7169598.sra Written 1027931 spots for SRR7169598.sra Read 1027931 spots for SRR7169598.sra Written 1027931 spots for SRR7169598.sra Read 1027931 spots for SRR7169598.sra Written 1027931 spots for SRR7169598.sra Read 1027931 spots for SRR7169598.sra Written 1027931 spots for SRR7169598.sra Read 1027931 spots for SRR7169598.sra Written 1027931 spots for SRR7169598.sra Read 1027931 spots for SRR7169598.sra Written 1027931 spots for SRR7169598.sra Read 1027931 spots for SRR7169598.sra Written 1027931 spots for SRR7169598.sra Read 1027943 spots for SRR7169598.sra Written 1027943 spots for SRR7169598.sra Read 1027931 spots for SRR7169598.sra Written 1027931 spots for SRR7169598.sra Read 1027931 spots for SRR7169598.sra Written 1027931 spots for SRR7169598.sra Read 1027931 spots for SRR7169598.sra Written 1027931 spots for SRR7169598.sra Read 1027931 spots for SRR7169598.sra Written 1027931 spots for SRR7169598.sra Read 1027931 spots for SRR7169598.sra Written 1027931 spots for SRR7169598.sra SRR ids: ['SRR7169598.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ttme3wtt SRR7169598.sra spots: 20558632 blocks: [[1, 1027931], [1027932, 2055862], [2055863, 3083793], [3083794, 4111724], [4111725, 5139655], [5139656, 6167586], [6167587, 7195517], [7195518, 8223448], [8223449, 9251379], [9251380, 10279310], [10279311, 11307241], [11307242, 12335172], [12335173, 13363103], [13363104, 14391034], [14391035, 15418965], [15418966, 16446896], [16446897, 17474827], [17474828, 18502758], [18502759, 19530689], [19530690, 20558632]] SRR7169598 file size 6944945 SRR7169598 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169598 SRR7169598_1.fastq SRR7169598_2.fastq Input file: SRR7169598_1.fastq Paired file: SRR7169598_2.fastq trimmed: SRR7169598-trimmed-pair1.fastq, SRR7169598-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 09:26:37 2025 >> started Tue Feb 11 09:27:00 2025 >> done (23.197s) 20558632 read pairs processed; of these: 48417 ( 0.24%) short read pairs filtered out after trimming by size control 129629 ( 0.63%) empty read pairs filtered out after trimming by size control 20380586 (99.13%) read pairs available; of these: 9875300 (48.45%) trimmed read pairs available after processing 10505286 (51.55%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 9 0.00% 20 12 0.00% 21 18 0.00% 22 16 0.00% 23 24 0.00% 24 16 0.00% 25 23 0.00% 26 21 0.00% 27 15 0.00% 28 24 0.00% 29 22 0.00% 30 29 0.00% 31 27 0.00% 32 20 0.00% 33 24 0.00% 34 32 0.00% 35 26 0.00% 36 33 0.00% 37 42 0.00% 38 32 0.00% 39 44 0.00% 40 53 0.00% 41 53 0.00% 42 50 0.00% 43 48 0.00% 44 63 0.00% 45 68 0.00% 46 103 0.00% 47 104 0.00% 48 106 0.00% 49 126 0.00% 50 128 0.00% 51 141 0.00% 52 161 0.00% 53 146 0.00% 54 194 0.00% 55 163 0.00% 56 188 0.00% 57 213 0.00% 58 242 0.00% 59 246 0.00% 60 291 0.00% 61 318 0.00% 62 338 0.00% 63 391 0.00% 64 419 0.00% 65 841 0.00% 66 863 0.00% 67 809 0.00% 68 1370 0.01% 69 5411 0.03% 70 9376 0.05% 71 5940 0.03% 72 3197 0.02% 73 2015 0.01% 74 1795 0.01% 75 1662 0.01% 76 1700 0.01% 77 1806 0.01% 78 1896 0.01% 79 2097 0.01% 80 2354 0.01% 81 2770 0.01% 82 3211 0.02% 83 3610 0.02% 84 5688 0.03% 85 7245 0.04% 86 7310 0.04% 87 7852 0.04% 88 8401 0.04% 89 8734 0.04% 90 9040 0.04% 91 9344 0.05% 92 9942 0.05% 93 10521 0.05% 94 11418 0.06% 95 12527 0.06% 96 13356 0.07% 97 13838 0.07% 98 14420 0.07% 99 14925 0.07% 100 16059 0.08% 101 16954 0.08% 102 18006 0.09% 103 19243 0.09% 104 20211 0.10% 105 21865 0.11% 106 22880 0.11% 107 23459 0.12% 108 24197 0.12% 109 26032 0.13% 110 27117 0.13% 111 28260 0.14% 112 29456 0.14% 113 32096 0.16% 114 33112 0.16% 115 34680 0.17% 116 36860 0.18% 117 38317 0.19% 118 39302 0.19% 119 40408 0.20% 120 41681 0.20% 121 43168 0.21% 122 45458 0.22% 123 47491 0.23% 124 50734 0.25% 125 52656 0.26% 126 56058 0.28% 127 58448 0.29% 128 59617 0.29% 129 62344 0.31% 130 64778 0.32% 131 67728 0.33% 132 72262 0.35% 133 76132 0.37% 134 80375 0.39% 135 86577 0.42% 136 91762 0.45% 137 97448 0.48% 138 104344 0.51% 139 111007 0.54% 140 119534 0.59% 141 129032 0.63% 142 141822 0.70% 143 157155 0.77% 144 180956 0.89% 145 211022 1.04% 146 254642 1.25% 147 336970 1.65% 148 505789 2.48% 149 1021986 5.01% 150 4675659 22.94% 151 10505286 51.55% 20380586 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.33 fanout-score-rank=39 prefix-density=0.24 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACAAACTGAATAGTACGCTTGGTCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=289.22 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=19.0 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCACAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGGAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTCACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=5.31 fanout-score-rank=26 prefix-density=0.45 prefix-fanout=3.3 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.11 sequence-density-rank=19 fanout-score=241.75 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=28.3 sequence=AAGAAGAAGAAA SRR7169598 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 09:27:43 Started mapping on | Feb 11 09:27:43 Finished on | Feb 11 09:29:47 Mapping speed, Million of reads per hour | 591.69 Number of input reads | 20380586 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 19117509 Uniquely mapped reads % | 93.80% Average mapped length | 293.90 Number of splices: Total | 16273675 Number of splices: Annotated (sjdb) | 15979494 Number of splices: GT/AG | 16029829 Number of splices: GC/AG | 191097 Number of splices: AT/AC | 15015 Number of splices: Non-canonical | 37734 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 382161 % of reads mapped to multiple loci | 1.88% Number of reads mapped to too many loci | 41611 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.06% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 918831 918831 918831 N_multimapping 382161 382161 382161 N_noFeature 444158 18872679 540580 N_ambiguous 225623 1156 76499 UnstrandedReadsAssigned:18447728 PositiveStrandReadsAssigned:243674 NegativeStrandReadsAssigned:18500430 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7169598 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169598-trimmed-pair1.fastq SRR7169598-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,380,586 reads, 18,474,457 reads pseudoaligned [quant] estimated average fragment length: 236.206 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,093 rounds 52401 SRR7169598.ke.tsv 34699 SRR7169598.se.tsv 87100 total ==> SRR7169598.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1782.79 313 8.07821 Potri.005G024800.1.v4.1 1035 799.794 59 3.39427 Potri.004G059700.1.v4.1 961 725.806 6 0.380367 Potri.007G009000.2.v4.1 1416 1180.79 0 0 Potri.003G141000.2.v4.1 2943 2707.79 302.125 5.13384 Potri.016G087400.1.v4.1 270 78.0073 1939.54 1144.02 Potri.015G069301.1.v4.1 564 331.652 0 0 Potri.010G195200.1.v4.1 1773 1537.79 98 2.93224 Potri.012G127500.1.v4.1 977 741.8 12646 784.401 ==> SRR7169598.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1867 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 395 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 23 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7169598 completed mapping pipeline successfully