Starting /dee2/code/volunteer_pipeline.sh SRR7169599 current disk space = 3055774736384 free memory = 1447348896 SRR7169599 SRAfilesize b1bc0837274057044386966585d8482e SRR7169599.sra SRR7169599.sra file validated SRR7169599 is paired end SRR7169599 is conventional basespace SRR7169599 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169599_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.91625 34.0 33.0 34.0 33.0 34.0 2 33.404 34.0 34.0 34.0 33.0 34.0 3 33.512 34.0 34.0 34.0 33.0 34.0 4 33.551 34.0 34.0 34.0 33.0 34.0 5 33.55775 34.0 34.0 34.0 33.0 34.0 6 37.225 38.0 38.0 38.0 36.0 38.0 7 37.43525 38.0 38.0 38.0 37.0 38.0 8 37.554 38.0 38.0 38.0 37.0 38.0 9 37.5505 38.0 38.0 38.0 38.0 38.0 10-14 37.56675 38.0 38.0 38.0 38.0 38.0 15-19 37.5294 38.0 38.0 38.0 37.8 38.0 20-24 37.5425 38.0 38.0 38.0 38.0 38.0 25-29 37.5141 38.0 38.0 38.0 37.8 38.0 30-34 37.517250000000004 38.0 38.0 38.0 37.4 38.0 35-39 37.455499999999994 38.0 38.0 38.0 37.0 38.0 40-44 37.362350000000006 38.0 38.0 38.0 37.0 38.0 45-49 37.347300000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.2772 38.0 38.0 38.0 36.8 38.0 55-59 37.2164 38.0 38.0 38.0 36.6 38.0 60-64 37.1915 38.0 38.0 38.0 36.2 38.0 65-69 37.178250000000006 38.0 38.0 38.0 36.0 38.0 70-74 37.14095 38.0 38.0 38.0 36.0 38.0 75-79 37.0573 38.0 38.0 38.0 36.0 38.0 80-84 37.0053 38.0 38.0 38.0 36.0 38.0 85-89 36.95455 38.0 38.0 38.0 35.8 38.0 90-94 36.8495 38.0 38.0 38.0 35.2 38.0 95-99 36.7345 38.0 38.0 38.0 35.0 38.0 100-104 36.550349999999995 38.0 38.0 38.0 34.0 38.0 105-109 36.48625 38.0 38.0 38.0 34.2 38.0 110-114 36.379549999999995 38.0 38.0 38.0 34.0 38.0 115-119 36.1982 38.0 37.8 38.0 33.8 38.0 120-124 36.019999999999996 38.0 37.4 38.0 33.2 38.0 125-129 35.87265 38.0 37.0 38.0 32.2 38.0 130-134 35.59375 38.0 36.6 38.0 31.6 38.0 135-139 35.303749999999994 38.0 36.0 38.0 30.6 38.0 140-144 35.0698 38.0 35.8 38.0 30.0 38.0 145-149 34.5966 38.0 35.2 38.0 28.2 38.0 150-151 31.854125 36.5 31.5 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 1.0 12 1.0 13 1.0 14 0.0 15 1.0 16 0.0 17 1.0 18 2.0 19 1.0 20 5.0 21 3.0 22 8.0 23 6.0 24 8.0 25 9.0 26 20.0 27 11.0 28 19.0 29 36.0 30 31.0 31 41.0 32 56.0 33 83.0 34 130.0 35 215.0 36 530.0 37 2780.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.92878942014242 12.767039674465922 8.697863682604273 38.606307222787386 2 23.325000000000003 13.25 34.0 29.425 3 19.650000000000002 17.349999999999998 24.925 38.074999999999996 4 22.05 25.825 24.525 27.6 5 23.375 30.875000000000004 25.074999999999996 20.674999999999997 6 20.0 34.4 24.65 20.95 7 13.450000000000001 27.875 41.099999999999994 17.575 8 17.0 26.525 30.65 25.825 9 15.625 25.874999999999996 33.800000000000004 24.7 10-14 19.925 30.080000000000002 27.485 22.509999999999998 15-19 19.865993299664982 28.7914395719786 27.74638731936597 23.59617980899045 20-24 19.64 28.935 27.705000000000002 23.72 25-29 20.34 28.68 27.595 23.385 30-34 20.13 28.76 27.534999999999997 23.575 35-39 19.59 28.660000000000004 27.72 24.03 40-44 19.509999999999998 28.78 28.03 23.68 45-49 20.105 28.26 27.634999999999998 24.0 50-54 20.185 28.43 27.755000000000003 23.630000000000003 55-59 19.725 28.935 27.295 24.044999999999998 60-64 19.975 28.67 27.555000000000003 23.799999999999997 65-69 20.225 27.965 28.035 23.775 70-74 20.3 28.93 26.795 23.974999999999998 75-79 20.185 27.955000000000002 28.04 23.82 80-84 19.935 27.87 27.79 24.404999999999998 85-89 20.630000000000003 28.025 27.63 23.715 90-94 20.52 28.410000000000004 27.005000000000003 24.065 95-99 20.46 27.915 27.71 23.915 100-104 20.31 28.605000000000004 27.095000000000002 23.990000000000002 105-109 20.185 28.455000000000002 27.915 23.445 110-114 20.831041552077604 28.281414070703537 26.84134206710336 24.046202310115504 115-119 20.560000000000002 28.505000000000003 27.115000000000002 23.82 120-124 20.015 27.889999999999997 28.075 24.02 125-129 20.65 27.905 27.47 23.974999999999998 130-134 20.745 28.665000000000003 27.405 23.185 135-139 21.21 27.534999999999997 27.355 23.9 140-144 20.674999999999997 27.889999999999997 27.279999999999998 24.154999999999998 145-149 20.77 28.58 27.26 23.39 150-151 19.9125 28.349999999999998 27.237499999999997 24.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 2.5 23 3.0 24 2.0 25 1.0 26 3.5 27 7.0 28 8.0 29 12.5 30 18.0 31 24.5 32 32.0 33 36.5 34 48.0 35 65.5 36 79.5 37 102.0 38 121.5 39 159.0 40 197.5 41 218.0 42 232.5 43 249.5 44 283.5 45 286.5 46 266.5 47 261.0 48 234.5 49 201.5 50 172.5 51 143.0 52 129.5 53 103.0 54 73.0 55 54.5 56 41.5 57 30.5 58 21.5 59 21.5 60 16.0 61 7.0 62 8.0 63 6.5 64 4.0 65 1.5 66 1.0 67 1.5 68 0.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7000000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.005 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.005 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0125 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.425 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.5375000000000001 0.0 0.0 0.0 0.0 106-107 0.6 0.0 0.0 0.0 0.0 108-109 0.7125 0.0 0.0 0.0 0.0 110-111 0.8 0.0 0.0 0.0 0.0 112-113 0.825 0.0 0.0 0.0 0.0 114-115 0.95 0.0 0.0 0.0 0.0 116-117 1.1125 0.0 0.0 0.0 0.0 118-119 1.3 0.0 0.0 0.0 0.0 120-121 1.375 0.0 0.0 0.0 0.0 122-123 1.5125 0.0 0.0 0.0 0.0 124-125 1.7000000000000002 0.0 0.0 0.0 0.0 126-127 1.8375 0.0 0.0 0.0 0.0 128-129 1.975 0.0 0.0 0.0 0.0 130-131 2.1624999999999996 0.0 0.0 0.0 0.0 132-133 2.4625 0.0 0.0 0.0 0.0 134-135 2.7375 0.0 0.0 0.0 0.0 136-137 3.1125 0.0 0.0 0.0 0.0 138-139 3.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTCAAT 10 0.006832588 144.9875 6 >>END_MODULE SRR7169599 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169599_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9695 33.0 33.0 34.0 32.0 34.0 2 33.021 34.0 33.0 34.0 32.0 34.0 3 33.056 34.0 33.0 34.0 33.0 34.0 4 32.989 34.0 33.0 34.0 33.0 34.0 5 33.0275 34.0 33.0 34.0 33.0 34.0 6 37.16475 38.0 38.0 38.0 37.0 38.0 7 37.221 38.0 38.0 38.0 37.0 38.0 8 37.1955 38.0 38.0 38.0 37.0 38.0 9 37.17725 38.0 38.0 38.0 37.0 38.0 10-14 37.253400000000006 38.0 38.0 38.0 37.0 38.0 15-19 37.246050000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.1483 38.0 38.0 38.0 37.0 38.0 25-29 37.1294 38.0 38.0 38.0 37.0 38.0 30-34 37.095349999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.12025 38.0 38.0 38.0 37.0 38.0 40-44 37.0745 38.0 38.0 38.0 37.0 38.0 45-49 37.0553 38.0 38.0 38.0 37.0 38.0 50-54 37.050850000000004 38.0 38.0 38.0 37.0 38.0 55-59 36.992650000000005 38.0 38.0 38.0 37.0 38.0 60-64 36.9286 38.0 38.0 38.0 36.8 38.0 65-69 36.949400000000004 38.0 38.0 38.0 36.2 38.0 70-74 36.813599999999994 38.0 38.0 38.0 36.0 38.0 75-79 36.7662 38.0 38.0 38.0 36.0 38.0 80-84 36.71274999999999 38.0 38.0 38.0 35.8 38.0 85-89 36.641200000000005 38.0 38.0 38.0 35.4 38.0 90-94 36.64975 38.0 38.0 38.0 35.2 38.0 95-99 36.50914999999999 38.0 38.0 38.0 34.6 38.0 100-104 36.4265 38.0 38.0 38.0 34.8 38.0 105-109 36.324799999999996 38.0 38.0 38.0 34.0 38.0 110-114 36.14469999999999 38.0 38.0 38.0 34.0 38.0 115-119 35.99605 38.0 38.0 38.0 33.6 38.0 120-124 35.7813 38.0 37.4 38.0 32.8 38.0 125-129 35.71405 38.0 37.4 38.0 32.2 38.0 130-134 35.4587 38.0 36.6 38.0 31.4 38.0 135-139 35.1519 38.0 36.0 38.0 29.6 38.0 140-144 34.8756 38.0 36.0 38.0 28.8 38.0 145-149 34.44635 38.0 36.0 38.0 27.6 38.0 150-151 31.031750000000002 36.5 31.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 0.0 4 3.0 5 1.0 6 1.0 7 0.0 8 1.0 9 1.0 10 1.0 11 1.0 12 1.0 13 1.0 14 1.0 15 0.0 16 2.0 17 3.0 18 7.0 19 4.0 20 8.0 21 5.0 22 12.0 23 9.0 24 9.0 25 17.0 26 14.0 27 23.0 28 15.0 29 29.0 30 34.0 31 46.0 32 55.0 33 61.0 34 124.0 35 178.0 36 496.0 37 2820.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.57986980470706 22.43365047571357 13.520280420630945 27.466199298948425 2 27.315973960941413 27.04056084126189 28.86830245368052 16.775162744116173 3 20.205565304587616 28.22762597142141 31.01027826522938 20.556530458761593 4 23.246492985971944 33.416833667334664 24.874749498997996 18.46192384769539 5 26.69003505257887 35.853780671006504 20.255383074611917 17.200801201802705 6 20.982702431687137 38.20506392579594 23.113562296314864 17.698671346202055 7 20.45625470042617 22.73752820255703 36.90147906743545 19.90473802958135 8 21.93532213587365 25.068939583855602 27.901729756831283 25.09400852343946 9 21.19238476953908 24.949899799599198 30.38577154308617 23.471943887775552 10-14 22.63044458924365 29.021101699162948 26.615207257781563 21.733246453811837 15-19 23.088102636062946 28.224917309812568 27.67364939360529 21.013330660519195 20-24 22.526949110052644 28.904487340185508 27.53070945099022 21.03785409877162 25-29 23.02987768197313 28.308602366151998 27.66693402847403 20.99458592340084 30-34 23.143973549744516 27.802825368199578 27.572387536319003 21.4808135457369 35-39 22.79514932852275 28.50771697735017 27.520545199438768 21.176588494688314 40-44 23.48697394789579 27.595190380761526 27.880761523046093 21.037074148296593 45-49 23.088868850816553 27.557358982065928 28.293758140466885 21.060014026650638 50-54 23.12509393316968 28.004608987525675 28.10480436851861 20.76549271078603 55-59 23.477564102564102 27.864583333333332 27.939703525641026 20.71814903846154 60-64 23.17519162366615 28.370322128149894 28.189970442362604 20.26451580582135 65-69 23.213390798837324 27.55838428385286 28.259997995389398 20.968226921920415 70-74 23.43859649122807 28.06516290726817 27.859649122807017 20.636591478696744 75-79 23.982558139534884 27.506014434643145 28.05733761026464 20.45408981555734 80-84 23.43890949183121 28.03447930239551 27.763856870802844 20.76275433497043 85-89 23.4008421896932 27.471425706837778 28.143172247844394 20.984559855624624 90-94 23.467495363640918 27.33196331010977 28.474763169765925 20.725778156483386 95-99 23.896819434009515 27.918858001502628 27.9038317054846 20.280490859003255 100-104 24.20493814794411 27.35513597435769 28.11138378324235 20.32854209445585 105-109 24.041061592388584 28.16725087631447 27.666499749624435 20.12518778167251 110-114 24.192174740744452 27.183006863383596 28.164921597114372 20.459896798757576 115-119 23.878727136056128 27.72237534452518 27.802555750438486 20.596341768980206 120-124 23.837209302325583 27.937048917401764 27.806736166800324 20.419005613472333 125-129 24.47229882175984 27.92178490849837 27.295061418901977 20.31085485083981 130-134 24.461152882205514 27.513784461152884 27.463659147869674 20.56140350877193 135-139 24.11269300180469 28.469019450571487 27.34108682574694 20.07720072187688 140-144 24.1769805080924 27.945081926141203 27.514155434183497 20.3637821315829 145-149 24.089565696538596 27.806441917547463 27.816460451835894 20.287531934078043 150-151 23.845865131990493 27.92443387964469 28.625046916051545 19.604654072313274 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 6.0 1 3.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 1.5 14 1.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 2.5 26 4.0 27 4.5 28 6.5 29 8.5 30 10.0 31 11.0 32 18.0 33 32.0 34 40.5 35 53.5 36 74.0 37 92.5 38 126.5 39 157.5 40 198.0 41 245.0 42 253.0 43 280.5 44 300.5 45 287.5 46 288.5 47 275.5 48 252.5 49 218.0 50 169.5 51 144.5 52 119.5 53 87.5 54 67.0 55 47.0 56 32.0 57 20.5 58 14.0 59 10.5 60 6.5 61 6.0 62 5.0 63 3.5 64 3.5 65 2.5 66 2.0 67 1.0 68 0.0 69 0.0 70 0.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.15 3 0.27499999999999997 4 0.2 5 0.15 6 0.27499999999999997 7 0.27499999999999997 8 0.27499999999999997 9 0.2 10-14 0.245 15-19 0.22999999999999998 20-24 0.27499999999999997 25-29 0.26 30-34 0.19 35-39 0.22 40-44 0.2 45-49 0.19 50-54 0.19499999999999998 55-59 0.16 60-64 0.19499999999999998 65-69 0.22999999999999998 70-74 0.25 75-79 0.24 80-84 0.22999999999999998 85-89 0.26 90-94 0.245 95-99 0.17500000000000002 100-104 0.165 105-109 0.15 110-114 0.19499999999999998 115-119 0.22499999999999998 120-124 0.24 125-129 0.27499999999999997 130-134 0.25 135-139 0.26 140-144 0.215 145-149 0.185 150-151 0.08750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52213279678068 98.925 2 0.4275653923541248 0.8500000000000001 3 0.025150905432595575 0.075 4 0.0 0.0 5 0.0 0.0 6 0.025150905432595575 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0125 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.425 0.0 0.0 0.0 0.0 104-105 0.4875 0.0 0.0 0.0 0.0 106-107 0.55 0.0 0.0 0.0 0.0 108-109 0.6625 0.0 0.0 0.0 0.0 110-111 0.75 0.0 0.0 0.0 0.0 112-113 0.775 0.0 0.0 0.0 0.0 114-115 0.9 0.0 0.0 0.0 0.0 116-117 1.0625 0.0 0.0 0.0 0.0 118-119 1.25 0.0 0.0 0.0 0.0 120-121 1.325 0.0 0.0 0.0 0.0 122-123 1.4375 0.0 0.0 0.0 0.0 124-125 1.625 0.0 0.0 0.0 0.0 126-127 1.7374999999999998 0.0 0.0 0.0 0.0 128-129 1.85 0.0 0.0 0.0 0.0 130-131 2.05 0.0 0.0 0.0 0.0 132-133 2.3499999999999996 0.0 0.0 0.0 0.0 134-135 2.5999999999999996 0.0 0.0 0.0 0.0 136-137 2.9625 0.0 0.0 0.0 0.0 138-139 3.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 906006 spots for SRR7169599.sra Written 906006 spots for SRR7169599.sra Read 906006 spots for SRR7169599.sra Written 906006 spots for SRR7169599.sra Read 906006 spots for SRR7169599.sra Written 906006 spots for SRR7169599.sra Read 906006 spots for SRR7169599.sra Written 906006 spots for SRR7169599.sra Read 906006 spots for SRR7169599.sra Written 906006 spots for SRR7169599.sra Read 906006 spots for SRR7169599.sra Written 906006 spots for SRR7169599.sra Read 906006 spots for SRR7169599.sra Written 906006 spots for SRR7169599.sra Read 906006 spots for SRR7169599.sra Written 906006 spots for SRR7169599.sra Read 906006 spots for SRR7169599.sra Written 906006 spots for SRR7169599.sra Read 906006 spots for SRR7169599.sra Written 906006 spots for SRR7169599.sra Read 906006 spots for SRR7169599.sra Written 906006 spots for SRR7169599.sra Read 906006 spots for SRR7169599.sra Written 906006 spots for SRR7169599.sra Read 906006 spots for SRR7169599.sra Written 906006 spots for SRR7169599.sra Read 906006 spots for SRR7169599.sra Written 906006 spots for SRR7169599.sra Read 906006 spots for SRR7169599.sra Written 906006 spots for SRR7169599.sra Read 906006 spots for SRR7169599.sra Written 906006 spots for SRR7169599.sra Read 906006 spots for SRR7169599.sra Written 906006 spots for SRR7169599.sra Read 906006 spots for SRR7169599.sra Written 906006 spots for SRR7169599.sra Read 906006 spots for SRR7169599.sra Written 906006 spots for SRR7169599.sra Read 906024 spots for SRR7169599.sra Written 906024 spots for SRR7169599.sra SRR ids: ['SRR7169599.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_shyj_i3r SRR7169599.sra spots: 18120138 blocks: [[1, 906006], [906007, 1812012], [1812013, 2718018], [2718019, 3624024], [3624025, 4530030], [4530031, 5436036], [5436037, 6342042], [6342043, 7248048], [7248049, 8154054], [8154055, 9060060], [9060061, 9966066], [9966067, 10872072], [10872073, 11778078], [11778079, 12684084], [12684085, 13590090], [13590091, 14496096], [14496097, 15402102], [15402103, 16308108], [16308109, 17214114], [17214115, 18120138]] SRR7169599 file size 6118619 SRR7169599 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169599 SRR7169599_1.fastq SRR7169599_2.fastq Input file: SRR7169599_1.fastq Paired file: SRR7169599_2.fastq trimmed: SRR7169599-trimmed-pair1.fastq, SRR7169599-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 08:48:52 2025 >> started Tue Feb 11 08:49:18 2025 >> done (25.793s) 18120138 read pairs processed; of these: 12996 ( 0.07%) short read pairs filtered out after trimming by size control 53803 ( 0.30%) empty read pairs filtered out after trimming by size control 18053339 (99.63%) read pairs available; of these: 7378423 (40.87%) trimmed read pairs available after processing 10674916 (59.13%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 1 0.00% 21 4 0.00% 22 3 0.00% 23 2 0.00% 24 1 0.00% 25 5 0.00% 26 5 0.00% 27 2 0.00% 28 4 0.00% 29 7 0.00% 30 9 0.00% 31 7 0.00% 32 6 0.00% 33 5 0.00% 34 5 0.00% 35 7 0.00% 36 6 0.00% 37 14 0.00% 38 8 0.00% 39 12 0.00% 40 12 0.00% 41 16 0.00% 42 19 0.00% 43 11 0.00% 44 21 0.00% 45 26 0.00% 46 17 0.00% 47 30 0.00% 48 42 0.00% 49 41 0.00% 50 42 0.00% 51 47 0.00% 52 54 0.00% 53 57 0.00% 54 47 0.00% 55 62 0.00% 56 70 0.00% 57 87 0.00% 58 89 0.00% 59 114 0.00% 60 139 0.00% 61 134 0.00% 62 161 0.00% 63 198 0.00% 64 191 0.00% 65 224 0.00% 66 263 0.00% 67 270 0.00% 68 373 0.00% 69 585 0.00% 70 755 0.00% 71 567 0.00% 72 520 0.00% 73 557 0.00% 74 637 0.00% 75 708 0.00% 76 805 0.00% 77 849 0.00% 78 924 0.01% 79 1132 0.01% 80 1198 0.01% 81 1378 0.01% 82 1550 0.01% 83 1838 0.01% 84 2595 0.01% 85 3031 0.02% 86 3308 0.02% 87 3609 0.02% 88 3865 0.02% 89 4154 0.02% 90 4401 0.02% 91 4573 0.03% 92 4866 0.03% 93 5251 0.03% 94 5619 0.03% 95 6085 0.03% 96 6488 0.04% 97 6973 0.04% 98 7380 0.04% 99 7697 0.04% 100 8140 0.05% 101 8876 0.05% 102 9436 0.05% 103 9970 0.06% 104 10529 0.06% 105 11204 0.06% 106 11881 0.07% 107 12510 0.07% 108 12992 0.07% 109 13527 0.07% 110 14236 0.08% 111 14948 0.08% 112 15776 0.09% 113 16811 0.09% 114 17750 0.10% 115 19025 0.11% 116 19972 0.11% 117 20836 0.12% 118 21738 0.12% 119 22590 0.13% 120 23991 0.13% 121 24946 0.14% 122 25850 0.14% 123 27484 0.15% 124 29305 0.16% 125 30432 0.17% 126 32713 0.18% 127 33895 0.19% 128 35405 0.20% 129 38037 0.21% 130 39901 0.22% 131 41660 0.23% 132 44268 0.25% 133 47256 0.26% 134 50067 0.28% 135 53850 0.30% 136 57547 0.32% 137 61681 0.34% 138 66569 0.37% 139 71969 0.40% 140 77434 0.43% 141 84416 0.47% 142 93610 0.52% 143 105049 0.58% 144 122136 0.68% 145 145420 0.81% 146 179991 1.00% 147 243067 1.35% 148 369363 2.05% 149 750583 4.16% 150 3980907 22.05% 151 10674916 59.13% 18053339 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.19 fanout-score-rank=44 prefix-density=0.17 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCA criterion=fanout-score sequence-density=0.10 sequence-density-rank=21 fanout-score=286.95 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=30.3 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.61 fanout-score-rank=37 prefix-density=0.37 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.09 sequence-density-rank=31 fanout-score=225.72 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=25.2 sequence=GAAGAAGAAGAAA SRR7169599 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 08:50:02 Started mapping on | Feb 11 08:50:02 Finished on | Feb 11 08:51:42 Mapping speed, Million of reads per hour | 649.92 Number of input reads | 18053339 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 17313582 Uniquely mapped reads % | 95.90% Average mapped length | 296.24 Number of splices: Total | 16819072 Number of splices: Annotated (sjdb) | 16551012 Number of splices: GT/AG | 16578921 Number of splices: GC/AG | 196400 Number of splices: AT/AC | 12800 Number of splices: Non-canonical | 30951 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 304771 % of reads mapped to multiple loci | 1.69% Number of reads mapped to too many loci | 55867 % of reads mapped to too many loci | 0.31% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.05% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 447966 447966 447966 N_multimapping 304771 304771 304771 N_noFeature 398064 17115387 494296 N_ambiguous 171552 1048 68817 UnstrandedReadsAssigned:16743966 PositiveStrandReadsAssigned:197147 NegativeStrandReadsAssigned:16750469 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169599 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169599-trimmed-pair1.fastq SRR7169599-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,053,339 reads, 16,608,557 reads pseudoaligned [quant] estimated average fragment length: 258.606 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,192 rounds 52401 SRR7169599.ke.tsv 34699 SRR7169599.se.tsv 87100 total ==> SRR7169599.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1760.39 304 10.002 Potri.005G024800.1.v4.1 1035 777.394 38 2.83117 Potri.004G059700.1.v4.1 961 703.474 1 0.0823331 Potri.007G009000.2.v4.1 1416 1158.39 0 0 Potri.003G141000.2.v4.1 2943 2685.39 393.044 8.47727 Potri.016G087400.1.v4.1 270 72.4573 1375 1099.11 Potri.015G069301.1.v4.1 564 313.234 0 0 Potri.010G195200.1.v4.1 1773 1515.39 38 1.45238 Potri.012G127500.1.v4.1 977 719.435 6267 504.535 ==> SRR7169599.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1133 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 248 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7169599 completed mapping pipeline successfully