Starting /dee2/code/volunteer_pipeline.sh SRR7169600 current disk space = 3055678570496 free memory = 1411982752 SRR7169600 SRAfilesize 325031c44f3019ed6fe1d621e9ac7491 SRR7169600.sra SRR7169600.sra file validated SRR7169600 is paired end SRR7169600 is conventional basespace SRR7169600 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169600_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9465 34.0 33.0 34.0 33.0 34.0 2 33.3025 34.0 33.0 34.0 33.0 34.0 3 33.45825 34.0 34.0 34.0 33.0 34.0 4 33.5175 34.0 34.0 34.0 33.0 34.0 5 33.49925 34.0 34.0 34.0 33.0 34.0 6 37.15875 38.0 38.0 38.0 36.0 38.0 7 37.45775 38.0 38.0 38.0 37.0 38.0 8 37.47875 38.0 38.0 38.0 37.0 38.0 9 37.49175 38.0 38.0 38.0 37.0 38.0 10-14 37.51360000000001 38.0 38.0 38.0 37.4 38.0 15-19 37.508 38.0 38.0 38.0 37.2 38.0 20-24 37.46560000000001 38.0 38.0 38.0 37.4 38.0 25-29 37.516949999999994 38.0 38.0 38.0 37.8 38.0 30-34 37.528800000000004 38.0 38.0 38.0 37.6 38.0 35-39 37.4014 38.0 38.0 38.0 37.2 38.0 40-44 37.295399999999994 38.0 38.0 38.0 37.0 38.0 45-49 37.267849999999996 38.0 38.0 38.0 36.8 38.0 50-54 37.2061 38.0 38.0 38.0 36.6 38.0 55-59 37.205850000000005 38.0 38.0 38.0 36.2 38.0 60-64 37.17845 38.0 38.0 38.0 36.0 38.0 65-69 37.126850000000005 38.0 38.0 38.0 36.0 38.0 70-74 37.088 38.0 38.0 38.0 36.0 38.0 75-79 37.064350000000005 38.0 38.0 38.0 36.0 38.0 80-84 37.03959999999999 38.0 38.0 38.0 36.0 38.0 85-89 36.90105 38.0 38.0 38.0 35.2 38.0 90-94 36.8469 38.0 38.0 38.0 35.0 38.0 95-99 36.7687 38.0 38.0 38.0 34.6 38.0 100-104 36.589650000000006 38.0 38.0 38.0 34.2 38.0 105-109 36.50505 38.0 38.0 38.0 34.0 38.0 110-114 36.36195 38.0 37.8 38.0 34.0 38.0 115-119 36.13265 38.0 37.4 38.0 33.4 38.0 120-124 35.975100000000005 38.0 37.2 38.0 32.8 38.0 125-129 35.87435000000001 38.0 37.0 38.0 32.8 38.0 130-134 35.698 38.0 36.6 38.0 31.6 38.0 135-139 35.42115 38.0 36.0 38.0 31.0 38.0 140-144 35.094750000000005 38.0 35.8 38.0 29.8 38.0 145-149 34.5028 38.0 35.0 38.0 27.8 38.0 150-151 31.698625 36.5 31.5 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 1.0 17 1.0 18 0.0 19 2.0 20 5.0 21 1.0 22 4.0 23 8.0 24 10.0 25 18.0 26 19.0 27 21.0 28 24.0 29 19.0 30 34.0 31 49.0 32 57.0 33 83.0 34 114.0 35 258.0 36 547.0 37 2724.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.15736040609137 12.741116751269036 9.289340101522843 35.81218274111675 2 25.074999999999996 13.600000000000001 32.800000000000004 28.525 3 21.3 16.225 24.825 37.65 4 22.85 25.650000000000002 23.849999999999998 27.650000000000002 5 22.95 30.425 23.575 23.05 6 21.224999999999998 34.65 24.125 20.0 7 15.375 27.200000000000003 40.025 17.4 8 18.775 26.85 29.4 24.975 9 18.224999999999998 24.85 34.525 22.400000000000002 10-14 20.02 30.185000000000002 27.24 22.555 15-19 20.25 28.89 27.35 23.51 20-24 20.369999999999997 28.38 27.700000000000003 23.549999999999997 25-29 20.265 28.735 27.384999999999998 23.615 30-34 19.63 28.28 27.74 24.349999999999998 35-39 20.275000000000002 28.655 27.185 23.885 40-44 20.48 29.03 27.11 23.380000000000003 45-49 20.369999999999997 28.26 27.325 24.044999999999998 50-54 19.96 28.854999999999997 27.315 23.87 55-59 20.21 28.04 27.644999999999996 24.104999999999997 60-64 20.21 28.215 27.18 24.395 65-69 20.555 28.625 26.884999999999998 23.935000000000002 70-74 20.485 28.255000000000003 27.065 24.195 75-79 20.645 28.1 27.305 23.95 80-84 20.625 28.025 27.815 23.535 85-89 20.26 28.055000000000003 27.79 23.895 90-94 20.66 28.23 27.415 23.695 95-99 20.415 28.305000000000003 27.0 24.279999999999998 100-104 20.419999999999998 28.095 27.1 24.385 105-109 20.595 27.650000000000002 27.43 24.325 110-114 20.846042302115105 27.731386569328464 27.166358317915893 24.25621281064053 115-119 20.68 28.275 27.025 24.02 120-124 20.855 27.279999999999998 27.694999999999997 24.169999999999998 125-129 20.990000000000002 27.200000000000003 27.76 24.05 130-134 20.685000000000002 28.139999999999997 27.415 23.76 135-139 21.12 27.37 27.045 24.465 140-144 21.355 28.17 26.86 23.615 145-149 21.005 27.82 26.935 24.240000000000002 150-151 20.825 28.349999999999998 26.700000000000003 24.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.5 22 1.5 23 0.5 24 0.5 25 2.0 26 3.0 27 4.5 28 5.5 29 9.0 30 14.5 31 18.5 32 23.0 33 29.5 34 42.5 35 64.0 36 70.0 37 81.0 38 122.0 39 169.5 40 193.0 41 207.0 42 241.0 43 267.5 44 292.5 45 292.5 46 269.5 47 254.5 48 239.0 49 206.5 50 173.5 51 146.5 52 121.5 53 104.0 54 84.5 55 60.5 56 42.0 57 35.0 58 26.0 59 20.0 60 13.0 61 10.0 62 10.5 63 7.5 64 3.5 65 2.0 66 2.0 67 2.0 68 4.0 69 3.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.005 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.23750000000000002 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.725 0.0 0.0 0.0 0.0 104-105 0.8375 0.0 0.0 0.0 0.0 106-107 0.95 0.0 0.0 0.0 0.0 108-109 1.1 0.0 0.0 0.0 0.0 110-111 1.2625000000000002 0.0 0.0 0.0 0.0 112-113 1.4500000000000002 0.0 0.0 0.0 0.0 114-115 1.55 0.0 0.0 0.0 0.0 116-117 1.7625 0.0 0.0 0.0 0.0 118-119 1.925 0.0 0.0 0.0 0.0 120-121 2.0625 0.0 0.0 0.0 0.0 122-123 2.3125 0.0 0.0 0.0 0.0 124-125 2.6625 0.0 0.0 0.0 0.0 126-127 2.925 0.0 0.0 0.0 0.0 128-129 3.225 0.0 0.0 0.0 0.0 130-131 3.55 0.0 0.0 0.0 0.0 132-133 4.025 0.0 0.0 0.0 0.0 134-135 4.325 0.0 0.0 0.0 0.0 136-137 4.675000000000001 0.0 0.0 0.0 0.0 138-139 5.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7169600 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169600_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.84825 33.0 33.0 34.0 32.0 34.0 2 32.9775 34.0 33.0 34.0 32.0 34.0 3 32.91025 34.0 33.0 34.0 32.0 34.0 4 32.93875 34.0 33.0 34.0 32.0 34.0 5 32.9965 34.0 33.0 34.0 32.0 34.0 6 37.11675 38.0 38.0 38.0 37.0 38.0 7 37.14525 38.0 38.0 38.0 37.0 38.0 8 37.0805 38.0 38.0 38.0 37.0 38.0 9 37.1305 38.0 38.0 38.0 37.0 38.0 10-14 37.080799999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.09060000000001 38.0 38.0 38.0 37.0 38.0 20-24 36.99365 38.0 38.0 38.0 37.0 38.0 25-29 37.0338 38.0 38.0 38.0 37.0 38.0 30-34 36.92875 38.0 38.0 38.0 36.6 38.0 35-39 36.95725 38.0 38.0 38.0 36.8 38.0 40-44 36.975649999999995 38.0 38.0 38.0 37.0 38.0 45-49 36.99015000000001 38.0 38.0 38.0 37.0 38.0 50-54 36.95975 38.0 38.0 38.0 37.0 38.0 55-59 36.88824999999999 38.0 38.0 38.0 36.0 38.0 60-64 36.82285 38.0 38.0 38.0 36.0 38.0 65-69 36.804500000000004 38.0 38.0 38.0 36.0 38.0 70-74 36.671949999999995 38.0 38.0 38.0 35.8 38.0 75-79 36.6211 38.0 38.0 38.0 35.6 38.0 80-84 36.53055 38.0 38.0 38.0 35.0 38.0 85-89 36.4298 38.0 38.0 38.0 34.8 38.0 90-94 36.3976 38.0 38.0 38.0 34.4 38.0 95-99 36.32735 38.0 38.0 38.0 34.2 38.0 100-104 36.3082 38.0 38.0 38.0 34.0 38.0 105-109 36.14625000000001 38.0 38.0 38.0 34.0 38.0 110-114 35.98485 38.0 38.0 38.0 33.6 38.0 115-119 35.790299999999995 38.0 37.6 38.0 33.0 38.0 120-124 35.570299999999996 38.0 37.0 38.0 31.6 38.0 125-129 35.438300000000005 38.0 36.8 38.0 31.0 38.0 130-134 35.248599999999996 38.0 36.2 38.0 31.0 38.0 135-139 34.7693 38.0 36.0 38.0 28.0 38.0 140-144 34.51105 38.0 35.4 38.0 26.4 38.0 145-149 34.0111 38.0 34.8 38.0 24.2 38.0 150-151 30.718 36.5 30.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 21.0 3 4.0 4 5.0 5 1.0 6 0.0 7 0.0 8 3.0 9 0.0 10 1.0 11 3.0 12 0.0 13 1.0 14 1.0 15 0.0 16 1.0 17 4.0 18 6.0 19 5.0 20 8.0 21 8.0 22 13.0 23 8.0 24 11.0 25 14.0 26 8.0 27 23.0 28 20.0 29 38.0 30 38.0 31 41.0 32 68.0 33 87.0 34 132.0 35 193.0 36 510.0 37 2724.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.15546639919759 24.749247743229688 14.142427281845539 25.952858575727184 2 29.134253450439147 28.10539523212045 27.578419071518194 15.181932245922209 3 21.37117026619789 29.181315921647418 29.357106981416376 20.09040683073832 4 23.41279799247177 34.00250941028858 24.11543287327478 18.469259723964868 5 24.54203262233375 36.91342534504392 20.677540777917187 17.867001254705144 6 21.245605223505777 36.71521848317428 23.78201908588649 18.25715720743345 7 21.672526368658964 21.747865394274235 37.04168759417378 19.53792064289302 8 21.81772533266382 26.61310569922169 26.813959327140346 24.75520964097414 9 21.96285140562249 26.380522088353413 29.292168674698793 22.364457831325304 10-14 23.246472862378873 29.81372696691269 25.36526585329116 21.57453431741728 15-19 23.83008636272344 27.94235790319341 27.37497489455714 20.85258083952601 20-24 23.933899241549046 28.33894218695063 26.41518911045256 21.311969461047767 25-29 23.469439003565867 28.612324845562753 27.321581035608457 20.596655115262923 30-34 23.4228356336261 28.005018820577167 27.593475533249684 20.978670012547052 35-39 23.757405361984134 28.024902098604276 27.02580580379556 21.191886735616023 40-44 23.351069169762074 28.3957433992571 27.5474349964863 20.705752434494528 45-49 23.407779171894603 27.62358845671267 27.809284818067752 21.15934755332497 50-54 23.94217738292426 27.375395271796414 27.415549866987902 21.26687747829142 55-59 24.263562001304763 28.12766598083003 27.15913082752045 20.449641190344757 60-64 23.745231881148364 27.449307367998394 27.926119253162017 20.879341497691225 65-69 23.255346922381765 27.74374937242695 27.829099307159353 21.17180439803193 70-74 24.269358240433867 27.38274580696997 27.759365270663857 20.58853068193231 75-79 23.75094150138087 27.285965352749187 27.833291488827516 21.129801657042428 80-84 23.8841190942411 28.39785108199026 27.097454435909025 20.620575387859617 85-89 23.890116512655684 28.073523503415025 27.295098433105665 20.741261550823626 90-94 23.704559148423378 27.585860614581243 27.324764008837114 21.384816228158265 95-99 24.129278329820337 28.03372478169226 27.160493827160494 20.67650306132691 100-104 24.136892814130874 28.19650742673625 26.911882778000802 20.754716981132077 105-109 23.766996136671516 27.881190105865233 27.575134213034968 20.776679544428276 110-114 24.951051759626488 27.948190170189267 27.129875997791054 19.97088207239319 115-119 24.47155696138977 27.64472561128684 27.102475272380378 20.781242154943016 120-124 23.80498091986343 28.14320144607351 27.51556537457321 20.536252259489856 125-129 24.535409342039177 27.353088900050228 27.448518332496235 20.662983425414364 130-134 24.61700738359536 28.2485308152092 27.26405143402481 19.870410367170628 135-139 24.517878666130976 27.902772197669744 27.485938127762154 20.093411008437123 140-144 25.42041062195673 27.714472165051955 26.700466844033933 20.164650368957382 145-149 25.663805651759276 28.1282939316368 26.567284043567735 19.640616373036192 150-151 25.266057343182673 27.331914360836358 27.256792287467135 20.145236008513834 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 12.0 1 7.0 2 1.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 2.0 25 2.5 26 2.5 27 4.5 28 4.0 29 3.5 30 5.5 31 10.5 32 20.5 33 24.5 34 25.0 35 47.0 36 66.5 37 80.5 38 118.5 39 156.0 40 180.0 41 225.0 42 260.0 43 283.5 44 297.0 45 302.0 46 303.5 47 282.0 48 254.0 49 213.5 50 168.0 51 137.0 52 123.0 53 94.5 54 79.0 55 66.0 56 37.5 57 26.0 58 20.5 59 14.5 60 11.5 61 9.5 62 7.0 63 5.0 64 3.5 65 2.5 66 1.5 67 1.5 68 2.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.375 3 0.44999999999999996 4 0.375 5 0.375 6 0.44999999999999996 7 0.44999999999999996 8 0.42500000000000004 9 0.4 10-14 0.415 15-19 0.42 20-24 0.455 25-29 0.445 30-34 0.375 35-39 0.41000000000000003 40-44 0.38999999999999996 45-49 0.375 50-54 0.385 55-59 0.365 60-64 0.38 65-69 0.41000000000000003 70-74 0.43 75-79 0.42500000000000004 80-84 0.415 85-89 0.44 90-94 0.42 95-99 0.37 100-104 0.36 105-109 0.345 110-114 0.40499999999999997 115-119 0.415 120-124 0.42 125-129 0.44999999999999996 130-134 0.455 135-139 0.44 140-144 0.395 145-149 0.385 150-151 0.1625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42007060010086 98.575 2 0.529500756429652 1.05 3 0.02521432173474534 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02521432173474534 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 12 0.3 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.16249999999999998 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.6 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.775 0.0 0.0 0.0 0.0 104-105 0.8875 0.0 0.0 0.0 0.0 106-107 1.0 0.0 0.0 0.0 0.0 108-109 1.1375000000000002 0.0 0.0 0.0 0.0 110-111 1.2999999999999998 0.0 0.0 0.0 0.0 112-113 1.5125 0.0 0.0 0.0 0.0 114-115 1.6 0.0 0.0 0.0 0.0 116-117 1.8125 0.0 0.0 0.0 0.0 118-119 1.975 0.0 0.0 0.0 0.0 120-121 2.1125 0.0 0.0 0.0 0.0 122-123 2.3625 0.0 0.0 0.0 0.0 124-125 2.725 0.0 0.0 0.0 0.0 126-127 3.0 0.0 0.0 0.0 0.0 128-129 3.3 0.0 0.0 0.0 0.0 130-131 3.6375 0.0 0.0 0.0 0.0 132-133 4.075 0.0 0.0 0.0 0.0 134-135 4.4125 0.0 0.0 0.0 0.0 136-137 4.775 0.0 0.0 0.0 0.0 138-139 5.2125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 854876 spots for SRR7169600.sra Written 854876 spots for SRR7169600.sra Read 854876 spots for SRR7169600.sra Written 854876 spots for SRR7169600.sra Read 854876 spots for SRR7169600.sra Written 854876 spots for SRR7169600.sra Read 854876 spots for SRR7169600.sra Written 854876 spots for SRR7169600.sra Read 854876 spots for SRR7169600.sra Written 854876 spots for SRR7169600.sra Read 854895 spots for SRR7169600.sra Written 854895 spots for SRR7169600.sra Read 854876 spots for SRR7169600.sra Written 854876 spots for SRR7169600.sra Read 854876 spots for SRR7169600.sra Written 854876 spots for SRR7169600.sra Read 854876 spots for SRR7169600.sra Written 854876 spots for SRR7169600.sra Read 854876 spots for SRR7169600.sra Written 854876 spots for SRR7169600.sra Read 854876 spots for SRR7169600.sra Written 854876 spots for SRR7169600.sra Read 854876 spots for SRR7169600.sra Written 854876 spots for SRR7169600.sra Read 854876 spots for SRR7169600.sra Written 854876 spots for SRR7169600.sra Read 854876 spots for SRR7169600.sra Written 854876 spots for SRR7169600.sra Read 854876 spots for SRR7169600.sra Written 854876 spots for SRR7169600.sra Read 854876 spots for SRR7169600.sra Written 854876 spots for SRR7169600.sra Read 854876 spots for SRR7169600.sra Written 854876 spots for SRR7169600.sra Read 854876 spots for SRR7169600.sra Written 854876 spots for SRR7169600.sra Read 854876 spots for SRR7169600.sra Written 854876 spots for SRR7169600.sra Read 854876 spots for SRR7169600.sra Written 854876 spots for SRR7169600.sra SRR ids: ['SRR7169600.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_auiap2so SRR7169600.sra spots: 17097539 blocks: [[1, 854876], [854877, 1709752], [1709753, 2564628], [2564629, 3419504], [3419505, 4274380], [4274381, 5129256], [5129257, 5984132], [5984133, 6839008], [6839009, 7693884], [7693885, 8548760], [8548761, 9403636], [9403637, 10258512], [10258513, 11113388], [11113389, 11968264], [11968265, 12823140], [12823141, 13678016], [13678017, 14532892], [14532893, 15387768], [15387769, 16242644], [16242645, 17097539]] SRR7169600 file size 5772094 SRR7169600 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169600 SRR7169600_1.fastq SRR7169600_2.fastq Input file: SRR7169600_1.fastq Paired file: SRR7169600_2.fastq trimmed: SRR7169600-trimmed-pair1.fastq, SRR7169600-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 08:38:11 2025 >> started Tue Feb 11 08:38:40 2025 >> done (29.157s) 17097539 read pairs processed; of these: 19161 ( 0.11%) short read pairs filtered out after trimming by size control 61718 ( 0.36%) empty read pairs filtered out after trimming by size control 17016660 (99.53%) read pairs available; of these: 7086557 (41.64%) trimmed read pairs available after processing 9930103 (58.36%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 4 0.00% 21 10 0.00% 22 3 0.00% 23 11 0.00% 24 6 0.00% 25 9 0.00% 26 9 0.00% 27 8 0.00% 28 5 0.00% 29 13 0.00% 30 8 0.00% 31 12 0.00% 32 6 0.00% 33 10 0.00% 34 6 0.00% 35 12 0.00% 36 14 0.00% 37 12 0.00% 38 15 0.00% 39 15 0.00% 40 17 0.00% 41 16 0.00% 42 20 0.00% 43 23 0.00% 44 22 0.00% 45 18 0.00% 46 19 0.00% 47 24 0.00% 48 30 0.00% 49 49 0.00% 50 42 0.00% 51 38 0.00% 52 79 0.00% 53 66 0.00% 54 55 0.00% 55 86 0.00% 56 89 0.00% 57 92 0.00% 58 114 0.00% 59 120 0.00% 60 137 0.00% 61 134 0.00% 62 171 0.00% 63 184 0.00% 64 247 0.00% 65 266 0.00% 66 302 0.00% 67 331 0.00% 68 441 0.00% 69 921 0.01% 70 997 0.01% 71 621 0.00% 72 625 0.00% 73 634 0.00% 74 798 0.00% 75 847 0.00% 76 920 0.01% 77 1000 0.01% 78 1134 0.01% 79 1233 0.01% 80 1437 0.01% 81 1635 0.01% 82 1936 0.01% 83 2264 0.01% 84 3082 0.02% 85 3885 0.02% 86 4098 0.02% 87 4358 0.03% 88 4719 0.03% 89 4976 0.03% 90 5367 0.03% 91 5688 0.03% 92 6257 0.04% 93 6711 0.04% 94 7166 0.04% 95 8074 0.05% 96 8512 0.05% 97 8929 0.05% 98 9382 0.06% 99 10046 0.06% 100 10761 0.06% 101 11439 0.07% 102 12194 0.07% 103 12984 0.08% 104 13657 0.08% 105 14630 0.09% 106 15716 0.09% 107 16174 0.10% 108 17410 0.10% 109 18073 0.11% 110 19029 0.11% 111 19757 0.12% 112 20937 0.12% 113 22200 0.13% 114 23295 0.14% 115 24794 0.15% 116 26049 0.15% 117 26945 0.16% 118 27991 0.16% 119 29155 0.17% 120 30311 0.18% 121 31713 0.19% 122 33126 0.19% 123 34608 0.20% 124 36295 0.21% 125 37753 0.22% 126 40244 0.24% 127 41894 0.25% 128 43337 0.25% 129 45218 0.27% 130 47091 0.28% 131 48830 0.29% 132 51821 0.30% 133 54540 0.32% 134 57815 0.34% 135 60914 0.36% 136 64765 0.38% 137 68510 0.40% 138 72048 0.42% 139 77384 0.45% 140 81284 0.48% 141 88000 0.52% 142 96035 0.56% 143 106494 0.63% 144 120918 0.71% 145 141361 0.83% 146 171285 1.01% 147 226118 1.33% 148 334420 1.97% 149 663752 3.90% 150 3573806 21.00% 151 9930103 58.36% 17016660 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=39 prefix-density=0.20 prefix-fanout=2.1 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTCAACGAACTGGATTGTGCGCTTGGTCTTGATGGTAGCCACAGCTGCATTCACATCCTTGGGCACAACATCACCTCTATACATCAGGCAGCAAGCCATGTACTTGCCATGACGTGGGTCACACTTGGCCATCATGGATGATGGCTCAAAAGCACTGTTGGTTATCTCAGCCACAGAGAGCTGCTCATGGTATGCCTTCTCTGCGGAGATGACAGGGGCATAAGAGGAAAGCATGAAATGGATCCTGGGGTATGGAACCAAGTTGGTTTGGAACTCAGTAACATCCACATTAAGAGCTCCATCAAACCTTAATGAGG criterion=fanout-score sequence-density=0.11 sequence-density-rank=12 fanout-score=245.56 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=28.3 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.60 fanout-score-rank=39 prefix-density=0.27 prefix-fanout=2.4 sequence=TTGTGATTTTGATC criterion=fanout-score sequence-density=0.11 sequence-density-rank=11 fanout-score=276.71 fanout-score-rank=1 prefix-density=0.98 prefix-fanout=30.0 sequence=AAGAAGAAGAAA SRR7169600 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 08:39:32 Started mapping on | Feb 11 08:39:32 Finished on | Feb 11 08:41:34 Mapping speed, Million of reads per hour | 502.13 Number of input reads | 17016660 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 16246573 Uniquely mapped reads % | 95.47% Average mapped length | 295.09 Number of splices: Total | 15755917 Number of splices: Annotated (sjdb) | 15497319 Number of splices: GT/AG | 15522173 Number of splices: GC/AG | 189057 Number of splices: AT/AC | 14085 Number of splices: Non-canonical | 30602 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 286263 % of reads mapped to multiple loci | 1.68% Number of reads mapped to too many loci | 26724 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.65% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 499685 499685 499685 N_multimapping 286263 286263 286263 N_noFeature 323272 16078952 399033 N_ambiguous 157714 1599 64540 UnstrandedReadsAssigned:15765587 PositiveStrandReadsAssigned:166022 NegativeStrandReadsAssigned:15783000 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169600 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169600-trimmed-pair1.fastq SRR7169600-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,016,660 reads, 15,682,579 reads pseudoaligned [quant] estimated average fragment length: 240.757 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,250 rounds 52401 SRR7169600.ke.tsv 34699 SRR7169600.se.tsv 87100 total ==> SRR7169600.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.24 310 10.9663 Potri.005G024800.1.v4.1 1035 795.243 45 3.5596 Potri.004G059700.1.v4.1 961 721.252 2 0.174434 Potri.007G009000.2.v4.1 1416 1176.24 0 0 Potri.003G141000.2.v4.1 2943 2703.24 368 8.5635 Potri.016G087400.1.v4.1 270 77.9781 1479 1193.12 Potri.015G069301.1.v4.1 564 328.122 0 0 Potri.010G195200.1.v4.1 1773 1533.24 35 1.43597 Potri.012G127500.1.v4.1 977 737.252 7700 656.997 ==> SRR7169600.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1230 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 310 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 11 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 0 SRR7169600 completed mapping pipeline successfully