Starting /dee2/code/volunteer_pipeline.sh SRR7169601 current disk space = 3055800205312 free memory = 1018550752 SRR7169601 SRAfilesize a0254b0b1a303cd55986a60da0bff433 SRR7169601.sra SRR7169601.sra file validated SRR7169601 is paired end SRR7169601 is conventional basespace SRR7169601 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169601_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.02325 34.0 33.0 34.0 33.0 34.0 2 33.4195 34.0 34.0 34.0 33.0 34.0 3 33.44125 34.0 34.0 34.0 33.0 34.0 4 33.386 34.0 34.0 34.0 33.0 34.0 5 33.49925 34.0 34.0 34.0 33.0 34.0 6 37.09825 38.0 37.0 38.0 36.0 38.0 7 37.331 38.0 38.0 38.0 37.0 38.0 8 37.43375 38.0 38.0 38.0 37.0 38.0 9 37.524 38.0 38.0 38.0 38.0 38.0 10-14 37.50885 38.0 38.0 38.0 37.6 38.0 15-19 37.467650000000006 38.0 38.0 38.0 37.2 38.0 20-24 37.49945 38.0 38.0 38.0 37.8 38.0 25-29 37.44085 38.0 38.0 38.0 37.0 38.0 30-34 37.42355 38.0 38.0 38.0 37.0 38.0 35-39 37.37185000000001 38.0 38.0 38.0 37.0 38.0 40-44 37.2444 38.0 38.0 38.0 37.0 38.0 45-49 37.21660000000001 38.0 38.0 38.0 36.6 38.0 50-54 37.177600000000005 38.0 38.0 38.0 36.2 38.0 55-59 37.1198 38.0 38.0 38.0 36.0 38.0 60-64 37.0882 38.0 38.0 38.0 36.0 38.0 65-69 37.03635 38.0 38.0 38.0 36.0 38.0 70-74 36.96025 38.0 38.0 38.0 36.0 38.0 75-79 36.884100000000004 38.0 38.0 38.0 35.8 38.0 80-84 36.8043 38.0 38.0 38.0 35.2 38.0 85-89 36.808949999999996 38.0 38.0 38.0 35.2 38.0 90-94 36.7321 38.0 38.0 38.0 35.0 38.0 95-99 36.609449999999995 38.0 38.0 38.0 34.6 38.0 100-104 36.43265 38.0 38.0 38.0 34.0 38.0 105-109 36.34635 38.0 38.0 38.0 34.0 38.0 110-114 36.260749999999994 38.0 37.8 38.0 34.0 38.0 115-119 36.01455 38.0 37.0 38.0 32.8 38.0 120-124 35.813750000000006 38.0 37.0 38.0 31.6 38.0 125-129 35.7127 38.0 36.6 38.0 31.4 38.0 130-134 35.53405 38.0 36.0 38.0 31.0 38.0 135-139 35.37095 38.0 36.0 38.0 31.0 38.0 140-144 34.8363 38.0 35.6 38.0 27.8 38.0 145-149 34.2325 38.0 35.0 38.0 26.4 38.0 150-151 31.343249999999998 36.5 31.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 1.0 14 0.0 15 1.0 16 2.0 17 3.0 18 4.0 19 4.0 20 2.0 21 6.0 22 6.0 23 12.0 24 3.0 25 8.0 26 22.0 27 23.0 28 23.0 29 29.0 30 43.0 31 43.0 32 70.0 33 108.0 34 112.0 35 192.0 36 587.0 37 2693.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.03343465045592 13.221884498480243 9.19452887537994 36.55015197568389 2 23.400000000000002 13.725000000000001 32.5 30.375000000000004 3 20.0 20.05 25.8 34.150000000000006 4 21.5 27.925 22.475 28.1 5 23.425 31.275 23.549999999999997 21.75 6 20.674999999999997 34.9 25.174999999999997 19.25 7 13.975000000000001 29.049999999999997 39.900000000000006 17.075000000000003 8 17.1 26.450000000000003 31.25 25.2 9 17.675 25.55 32.65 24.125 10-14 19.72 30.69 26.68 22.91 15-19 19.73 29.185 27.21 23.875 20-24 19.775000000000002 29.720000000000002 27.560000000000002 22.945 25-29 20.155 29.315 26.99 23.54 30-34 19.725 29.445 27.175 23.655 35-39 20.095 29.24 26.755000000000003 23.91 40-44 20.185 28.785 27.275 23.755000000000003 45-49 20.715 28.71 26.985 23.59 50-54 20.54 28.74 27.21 23.51 55-59 19.765 28.455000000000002 27.725 24.055 60-64 20.195 29.035 26.700000000000003 24.07 65-69 19.90099504975249 28.176408820441022 27.486374318715935 24.436221811090554 70-74 20.16 28.655 26.935 24.25 75-79 19.98 28.465 27.215 24.34 80-84 20.165 28.65 27.025 24.16 85-89 20.09 28.325 27.68 23.905 90-94 20.62 28.025 26.884999999999998 24.47 95-99 20.285 28.299999999999997 27.084999999999997 24.33 100-104 20.560000000000002 28.425 26.955000000000002 24.060000000000002 105-109 20.380000000000003 28.365000000000002 26.625 24.63 110-114 20.59 27.77 27.42 24.22 115-119 20.57 28.439999999999998 27.46 23.53 120-124 20.71 27.935 26.924999999999997 24.43 125-129 20.875 27.794999999999998 27.12 24.21 130-134 20.87 28.134999999999998 26.900000000000002 24.095 135-139 21.065 27.775 27.21 23.95 140-144 21.240000000000002 27.950000000000003 26.96 23.849999999999998 145-149 21.285 28.225 26.400000000000002 24.09 150-151 20.1875 28.3375 26.5875 24.887500000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 1.0 23 1.5 24 3.0 25 4.0 26 5.0 27 6.0 28 10.0 29 16.5 30 19.5 31 22.5 32 27.0 33 34.0 34 55.5 35 71.0 36 82.5 37 96.0 38 120.5 39 155.0 40 174.0 41 205.0 42 226.0 43 249.0 44 269.5 45 267.5 46 273.5 47 255.5 48 239.5 49 224.0 50 193.0 51 156.0 52 121.0 53 101.5 54 85.5 55 65.0 56 42.0 57 33.0 58 26.5 59 13.5 60 10.0 61 12.0 62 8.0 63 4.5 64 1.5 65 0.5 66 2.5 67 3.0 68 1.0 69 1.0 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.005 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5727569741141 99.05000000000001 2 0.3769791404875597 0.75 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.025131942699170642 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATGAGCATCTCGTATGC 5 0.125 TruSeq Adapter, Index 1 (97% over 37bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.7124999999999999 0.0 0.0 0.0 0.0 102-103 0.8 0.0 0.0 0.0 0.0 104-105 0.975 0.0 0.0 0.0 0.0 106-107 1.125 0.0 0.0 0.0 0.0 108-109 1.275 0.0 0.0 0.0 0.0 110-111 1.4 0.0 0.0 0.0 0.0 112-113 1.6625 0.0 0.0 0.0 0.0 114-115 1.8375 0.0 0.0 0.0 0.0 116-117 2.0999999999999996 0.0 0.0 0.0 0.0 118-119 2.2750000000000004 0.0 0.0 0.0 0.0 120-121 2.4749999999999996 0.0 0.0 0.0 0.0 122-123 2.7875 0.0 0.0 0.0 0.0 124-125 3.1125 0.0 0.0 0.0 0.0 126-127 3.5125 0.0 0.0 0.0 0.0 128-129 3.9 0.0 0.0 0.0 0.0 130-131 4.2125 0.0 0.0 0.0 0.0 132-133 4.6625 0.0 0.0 0.0 0.0 134-135 5.0 0.0 0.0 0.0 0.0 136-137 5.425 0.0 0.0 0.0 0.0 138-139 5.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTAGAGA 10 0.006830828 145.0 8 CAATTCA 10 0.006830828 145.0 9 >>END_MODULE SRR7169601 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7169601_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.841 33.0 33.0 34.0 32.0 34.0 2 32.92975 33.0 33.0 34.0 32.0 34.0 3 32.9095 34.0 33.0 34.0 32.0 34.0 4 32.92125 34.0 33.0 34.0 32.0 34.0 5 32.96825 34.0 33.0 34.0 32.0 34.0 6 37.151 38.0 38.0 38.0 37.0 38.0 7 37.136 38.0 38.0 38.0 37.0 38.0 8 37.14575 38.0 38.0 38.0 37.0 38.0 9 36.9895 38.0 38.0 38.0 37.0 38.0 10-14 37.0511 38.0 38.0 38.0 37.0 38.0 15-19 37.04915 38.0 38.0 38.0 37.0 38.0 20-24 36.9489 38.0 38.0 38.0 36.2 38.0 25-29 36.911 38.0 38.0 38.0 36.6 38.0 30-34 36.7981 38.0 38.0 38.0 36.0 38.0 35-39 36.873650000000005 38.0 38.0 38.0 36.0 38.0 40-44 36.870050000000006 38.0 38.0 38.0 36.0 38.0 45-49 36.861450000000005 38.0 38.0 38.0 36.0 38.0 50-54 36.87865000000001 38.0 38.0 38.0 36.0 38.0 55-59 36.793499999999995 38.0 38.0 38.0 36.0 38.0 60-64 36.79445 38.0 38.0 38.0 36.0 38.0 65-69 36.7298 38.0 38.0 38.0 36.0 38.0 70-74 36.665150000000004 38.0 38.0 38.0 35.4 38.0 75-79 36.63435 38.0 38.0 38.0 35.2 38.0 80-84 36.401399999999995 38.0 38.0 38.0 34.2 38.0 85-89 36.358599999999996 38.0 38.0 38.0 34.2 38.0 90-94 36.3273 38.0 38.0 38.0 34.0 38.0 95-99 36.2479 38.0 38.0 38.0 34.0 38.0 100-104 36.1857 38.0 38.0 38.0 34.0 38.0 105-109 36.0283 38.0 38.0 38.0 33.6 38.0 110-114 35.93065 38.0 38.0 38.0 33.2 38.0 115-119 35.768 38.0 37.6 38.0 32.6 38.0 120-124 35.4481 38.0 37.0 38.0 31.2 38.0 125-129 35.22595 38.0 36.0 38.0 29.2 38.0 130-134 34.98425 38.0 36.0 38.0 28.6 38.0 135-139 34.7324 38.0 35.8 38.0 27.8 38.0 140-144 34.285900000000005 38.0 35.0 38.0 24.0 38.0 145-149 33.76425 38.0 35.0 38.0 21.2 38.0 150-151 30.012875 36.5 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 3.0 4 3.0 5 3.0 6 2.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 1.0 13 4.0 14 6.0 15 2.0 16 4.0 17 6.0 18 2.0 19 6.0 20 9.0 21 7.0 22 7.0 23 4.0 24 21.0 25 16.0 26 26.0 27 32.0 28 31.0 29 47.0 30 40.0 31 51.0 32 63.0 33 84.0 34 125.0 35 203.0 36 504.0 37 2674.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.91989987484355 22.753441802252816 14.818523153942428 26.5081351689612 2 29.31897846770155 26.264396594892336 27.74161241862794 16.675012518778168 3 20.035061357375408 28.549962434259957 31.755572251440018 19.659403956924617 4 23.71056584877316 33.550325488232346 23.309964947421133 19.42914371557336 5 24.611917876815223 35.17776664997496 22.458688032048073 17.751627441161745 6 21.66291009266216 36.814425244177315 22.789882294014525 18.732782369146005 7 21.42320220496116 22.37534452518166 36.90804309696818 19.293410172889 8 22.325231771485843 26.509646705086443 26.259082936607363 24.906038586820344 9 22.300175394637936 25.306940616386868 29.366073665747933 23.026810323227263 10-14 23.782809056301343 28.751753155680227 26.10699258665598 21.358445201362454 15-19 23.796885172016626 27.382442786318794 27.722970604436874 21.097701437227702 20-24 24.09819639278557 27.970941883767537 27.009018036072145 20.92184368737475 25-29 24.076950052602577 27.709032613596513 26.887430489454434 21.326586844346476 30-34 22.987930084639654 28.55711924675715 27.325086392547703 21.12986427605549 35-39 23.21759607194749 27.626634600931908 27.87213788265945 21.283631444461147 40-44 24.100430991279946 27.98937556379673 27.13741605693094 20.772777387992384 45-49 24.060527106924543 27.778334502455156 27.392524301032168 20.768614089588137 50-54 24.1807796372382 28.274376189998996 26.741156428499853 20.80368774426295 55-59 23.844111606471973 27.876571657566494 27.065070380203377 21.214246355758153 60-64 24.205832247720213 28.24932357951699 26.95159835654875 20.59324581621405 65-69 23.817635270541082 27.45991983967936 27.75551102204409 20.96693386773547 70-74 24.644217278011627 27.605732611745843 27.00440970134295 20.74564040889958 75-79 23.207216236532197 27.97795038837384 28.088198446504638 20.726634928589327 80-84 24.32229292979907 27.38888610512602 27.604349351104872 20.684471613970036 85-89 23.882317562149158 27.235364875701684 27.97213311948677 20.910184442662388 90-94 24.041689632710327 27.554241619481886 27.594327804780278 20.80974094302751 95-99 24.180943793207092 27.402063921450758 27.77777777777778 20.639214507564372 100-104 24.277340814588445 28.0496969089725 26.907469565653024 20.76549271078603 105-109 24.08576294960425 26.7408075343152 28.053301272417592 21.120128243662958 110-114 23.9753482312857 27.572903096502653 27.53782944182784 20.913919230383808 115-119 24.69939879759519 28.181362725450903 26.948897795591183 20.170340681362724 120-124 24.278412507516535 27.600721587492483 27.710964121066343 20.40990178392463 125-129 24.533881315156375 27.27044907778669 28.252806736166804 19.942862870890135 130-134 25.394756629404984 27.660534362624695 27.30963958093138 19.63506942703895 135-139 24.718087505638252 27.88553099784494 27.544730115772065 19.85165138074475 140-144 25.44479526888187 27.444494562221223 27.33423545331529 19.776474715581614 145-149 25.360793746241733 27.771096412106633 27.715975145319703 19.15213469633193 150-151 24.777875109498186 28.14416218245526 27.08046552371418 19.997497184332374 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 5.0 1 2.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.0 23 0.5 24 0.5 25 0.5 26 0.5 27 1.5 28 3.5 29 5.0 30 7.0 31 13.5 32 20.0 33 23.5 34 33.0 35 47.0 36 61.5 37 91.0 38 121.0 39 142.0 40 184.5 41 223.0 42 248.0 43 269.5 44 278.5 45 281.5 46 285.5 47 282.0 48 245.0 49 208.0 50 183.5 51 168.0 52 143.0 53 107.5 54 78.0 55 55.0 56 47.5 57 35.0 58 21.5 59 19.0 60 19.0 61 11.5 62 5.0 63 3.5 64 3.0 65 3.5 66 2.0 67 1.0 68 2.5 69 1.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.15 3 0.17500000000000002 4 0.15 5 0.15 6 0.17500000000000002 7 0.22499999999999998 8 0.22499999999999998 9 0.22499999999999998 10-14 0.18 15-19 0.155 20-24 0.2 25-29 0.19499999999999998 30-34 0.165 35-39 0.20500000000000002 40-44 0.22999999999999998 45-49 0.21 50-54 0.21 55-59 0.185 60-64 0.21 65-69 0.2 70-74 0.22 75-79 0.22499999999999998 80-84 0.215 85-89 0.24 90-94 0.215 95-99 0.19 100-104 0.19499999999999998 105-109 0.19 110-114 0.21 115-119 0.2 120-124 0.22 125-129 0.24 130-134 0.255 135-139 0.23500000000000001 140-144 0.23500000000000001 145-149 0.22 150-151 0.11249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47143216712811 98.8 2 0.4278882456581928 0.8500000000000001 3 0.07550969041026932 0.22499999999999998 4 0.0 0.0 5 0.025169896803423106 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.23750000000000002 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.5375000000000001 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.7749999999999999 0.0 0.0 0.0 0.0 104-105 0.925 0.0 0.0 0.0 0.0 106-107 1.075 0.0 0.0 0.0 0.0 108-109 1.2374999999999998 0.0 0.0 0.0 0.0 110-111 1.3875000000000002 0.0 0.0 0.0 0.0 112-113 1.6625 0.0 0.0 0.0 0.0 114-115 1.8375 0.0 0.0 0.0 0.0 116-117 2.0999999999999996 0.0 0.0 0.0 0.0 118-119 2.2375 0.0 0.0 0.0 0.0 120-121 2.425 0.0 0.0 0.0 0.0 122-123 2.7375 0.0 0.0 0.0 0.0 124-125 3.0875000000000004 0.0 0.0 0.0 0.0 126-127 3.4875 0.0 0.0 0.0 0.0 128-129 3.875 0.0 0.0 0.0 0.0 130-131 4.15 0.0 0.0 0.0 0.0 132-133 4.6125 0.0 0.0 0.0 0.0 134-135 4.949999999999999 0.0 0.0 0.0 0.0 136-137 5.375 0.0 0.0 0.0 0.0 138-139 5.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 980956 spots for SRR7169601.sra Written 980956 spots for SRR7169601.sra Read 980972 spots for SRR7169601.sra Written 980972 spots for SRR7169601.sra Read 980956 spots for SRR7169601.sra Written 980956 spots for SRR7169601.sra Read 980956 spots for SRR7169601.sra Written 980956 spots for SRR7169601.sra Read 980956 spots for SRR7169601.sra Written 980956 spots for SRR7169601.sra Read 980956 spots for SRR7169601.sra Written 980956 spots for SRR7169601.sra Read 980956 spots for SRR7169601.sra Written 980956 spots for SRR7169601.sra Read 980956 spots for SRR7169601.sra Written 980956 spots for SRR7169601.sra Read 980956 spots for SRR7169601.sra Written 980956 spots for SRR7169601.sra Read 980956 spots for SRR7169601.sra Written 980956 spots for SRR7169601.sra Read 980956 spots for SRR7169601.sra Written 980956 spots for SRR7169601.sra Read 980956 spots for SRR7169601.sra Written 980956 spots for SRR7169601.sra Read 980956 spots for SRR7169601.sra Written 980956 spots for SRR7169601.sra Read 980956 spots for SRR7169601.sra Written 980956 spots for SRR7169601.sra Read 980956 spots for SRR7169601.sra Written 980956 spots for SRR7169601.sra Read 980956 spots for SRR7169601.sra Written 980956 spots for SRR7169601.sra Read 980956 spots for SRR7169601.sra Written 980956 spots for SRR7169601.sra Read 980956 spots for SRR7169601.sra Written 980956 spots for SRR7169601.sra Read 980956 spots for SRR7169601.sra Written 980956 spots for SRR7169601.sra Read 980956 spots for SRR7169601.sra Written 980956 spots for SRR7169601.sra SRR ids: ['SRR7169601.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vmmlact3 SRR7169601.sra spots: 19619136 blocks: [[1, 980956], [980957, 1961912], [1961913, 2942868], [2942869, 3923824], [3923825, 4904780], [4904781, 5885736], [5885737, 6866692], [6866693, 7847648], [7847649, 8828604], [8828605, 9809560], [9809561, 10790516], [10790517, 11771472], [11771473, 12752428], [12752429, 13733384], [13733385, 14714340], [14714341, 15695296], [15695297, 16676252], [16676253, 17657208], [17657209, 18638164], [18638165, 19619136]] SRR7169601 file size 6626581 SRR7169601 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7169601 SRR7169601_1.fastq SRR7169601_2.fastq Input file: SRR7169601_1.fastq Paired file: SRR7169601_2.fastq trimmed: SRR7169601-trimmed-pair1.fastq, SRR7169601-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 08:45:59 2025 >> started Tue Feb 11 08:46:20 2025 >> done (21.815s) 19619136 read pairs processed; of these: 27314 ( 0.14%) short read pairs filtered out after trimming by size control 70697 ( 0.36%) empty read pairs filtered out after trimming by size control 19521125 (99.50%) read pairs available; of these: 9610384 (49.23%) trimmed read pairs available after processing 9910741 (50.77%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 7 0.00% 20 6 0.00% 21 8 0.00% 22 5 0.00% 23 12 0.00% 24 7 0.00% 25 9 0.00% 26 13 0.00% 27 8 0.00% 28 8 0.00% 29 16 0.00% 30 12 0.00% 31 14 0.00% 32 16 0.00% 33 11 0.00% 34 16 0.00% 35 14 0.00% 36 15 0.00% 37 17 0.00% 38 15 0.00% 39 27 0.00% 40 22 0.00% 41 33 0.00% 42 28 0.00% 43 32 0.00% 44 36 0.00% 45 46 0.00% 46 80 0.00% 47 61 0.00% 48 59 0.00% 49 78 0.00% 50 91 0.00% 51 83 0.00% 52 105 0.00% 53 107 0.00% 54 160 0.00% 55 137 0.00% 56 153 0.00% 57 160 0.00% 58 207 0.00% 59 234 0.00% 60 221 0.00% 61 277 0.00% 62 317 0.00% 63 353 0.00% 64 425 0.00% 65 490 0.00% 66 558 0.00% 67 611 0.00% 68 910 0.00% 69 2148 0.01% 70 2483 0.01% 71 1430 0.01% 72 1222 0.01% 73 1287 0.01% 74 1464 0.01% 75 1550 0.01% 76 1693 0.01% 77 1848 0.01% 78 2071 0.01% 79 2311 0.01% 80 2678 0.01% 81 3047 0.02% 82 3429 0.02% 83 3897 0.02% 84 5541 0.03% 85 6067 0.03% 86 6218 0.03% 87 6763 0.03% 88 7209 0.04% 89 7600 0.04% 90 8072 0.04% 91 8947 0.05% 92 9653 0.05% 93 9846 0.05% 94 10809 0.06% 95 11352 0.06% 96 11995 0.06% 97 12705 0.07% 98 13080 0.07% 99 13875 0.07% 100 14805 0.08% 101 15413 0.08% 102 16637 0.09% 103 17940 0.09% 104 19069 0.10% 105 20284 0.10% 106 21563 0.11% 107 21838 0.11% 108 23194 0.12% 109 23424 0.12% 110 24817 0.13% 111 26132 0.13% 112 27749 0.14% 113 29209 0.15% 114 31399 0.16% 115 33005 0.17% 116 34375 0.18% 117 35830 0.18% 118 36603 0.19% 119 37962 0.19% 120 39394 0.20% 121 40900 0.21% 122 43137 0.22% 123 45823 0.23% 124 48578 0.25% 125 50943 0.26% 126 53992 0.28% 127 56753 0.29% 128 58654 0.30% 129 61546 0.32% 130 63853 0.33% 131 67174 0.34% 132 71017 0.36% 133 75276 0.39% 134 79573 0.41% 135 84931 0.44% 136 90972 0.47% 137 96226 0.49% 138 102090 0.52% 139 108373 0.56% 140 116376 0.60% 141 126557 0.65% 142 140193 0.72% 143 155433 0.80% 144 179178 0.92% 145 211934 1.09% 146 261627 1.34% 147 350136 1.79% 148 537103 2.75% 149 991058 5.08% 150 4501710 23.06% 151 9910741 50.77% 19521125 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=40 prefix-density=0.25 prefix-fanout=2.2 sequence=CCAACATACCAGTGCACAAACGCACGCTTGGCATACATGAGATCAAACTTGTGGTCAATGCGAGAGAAGACTTCTGCAACACTTGTGGAATTGGAAATCATGCAAACAGCCCTCTGAACCTTAGCAAGGTCGCCTCCTGGAACAACAGTTGGTGGCTGGTAGTTGATGCCACACTTGAACCCAGTTGGGCACCAGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=314.46 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=16.8 sequence=TGCTTTCTTTTCCGTTACAGAAGTCTTTACTGTTTGAAGCGCAAGGCCAATAAGAAATCTTTTCACATGTATTAAGAATTTTGAGGAAGGCGGTGAAGTTATTTGAGAAAATCAGGCATACAAAACGCAACCTTAACCTTATATGTTTCATAAGAGATAGCTACTCCTCGTATAAAAAAGCAATCACAACATCAAAAGCAGAGACAGCAGCAACGTTGTATGGAAAACCCCAAGTAACTTGGAGCTTGGACTTGAGCCTTAGTTCTTGCGGAATTCAATGACATGTGTGTTGAATGCACAGCACATTACTTCAAAACCTTGAAAGCCAGCTCCCTTTGCTAAGCCCTCAAATTCCTTTTCGGTCCTCTCTTTCCCACCGGGGTTGTGCGCCAGCATGATAACATCAATGTGCACGACTCCCTTGGTGGCAAGGCTTGTGTCAGGAGCCACGGGAAGAATGCACTCAACAAGTATCACCTTGCCGTTTTCCGGCAAGGCGTCATAGCAATTC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=40 prefix-density=0.26 prefix-fanout=2.1 sequence=TTCTCTCGCATTGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCGTTTGTGCACTGGTATGTTGG criterion=fanout-score sequence-density=0.12 sequence-density-rank=16 fanout-score=37.06 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=10.1 sequence=TCAAGGAAGCTTTCAG SRR7169601 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 08:47:07 Started mapping on | Feb 11 08:47:07 Finished on | Feb 11 08:49:14 Mapping speed, Million of reads per hour | 553.35 Number of input reads | 19521125 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 18438161 Uniquely mapped reads % | 94.45% Average mapped length | 293.77 Number of splices: Total | 16718866 Number of splices: Annotated (sjdb) | 16435168 Number of splices: GT/AG | 16478696 Number of splices: GC/AG | 192664 Number of splices: AT/AC | 13693 Number of splices: Non-canonical | 33813 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 350682 % of reads mapped to multiple loci | 1.80% Number of reads mapped to too many loci | 26866 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.53% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 755910 755910 755910 N_multimapping 350682 350682 350682 N_noFeature 369549 18201704 472809 N_ambiguous 209962 1575 75582 UnstrandedReadsAssigned:17858650 PositiveStrandReadsAssigned:234882 NegativeStrandReadsAssigned:17889770 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7169601 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7169601-trimmed-pair1.fastq SRR7169601-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,521,125 reads, 17,807,952 reads pseudoaligned [quant] estimated average fragment length: 233.206 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,198 rounds 52401 SRR7169601.ke.tsv 34699 SRR7169601.se.tsv 87100 total ==> SRR7169601.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1785.79 266 7.22282 Potri.005G024800.1.v4.1 1035 802.794 33 1.99327 Potri.004G059700.1.v4.1 961 728.821 2 0.133065 Potri.007G009000.2.v4.1 1416 1183.79 0 0 Potri.003G141000.2.v4.1 2943 2710.79 295.064 5.27808 Potri.016G087400.1.v4.1 270 80.4066 2244 1353.28 Potri.015G069301.1.v4.1 564 335.24 0 0 Potri.010G195200.1.v4.1 1773 1540.79 25 0.786777 Potri.012G127500.1.v4.1 977 744.805 10897 709.448 ==> SRR7169601.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1636 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 286 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 7 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR7169601 completed mapping pipeline successfully